|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
inhibits cellular proliferation and ACTH production in corticotroph tumor cells through a novel janus kinases–signal transducer and activator of transcription 1/nuclear factor-kappa B inhibitory signaling pathway
1 Department of Neuroendocrinology2 , Department of Molecular Neurogenetics3 Department of Inflammatory Disorders of the CNS at the Max Planck Institute of Psychiatry, Munich 80804, Germany4 Department of Neurosurgery, University of Erlangen, Erlangen 91054, Germany5 Affectis Pharmaceuticals, Munich 82152, Germany6 Laboratorio de Fisiología y Biología Molecular, University of Buenos Aires and CONICET, Buenos Aires 1428, Argentina
(Correspondence should be addressed to M Labeur; Email: labeur{at}mpipsykl.mpg.de)
| Abstract |
|---|
|
|
|---|
(IFNG) is a cytokine that exerts potent antiproliferative and tumoricidal effects in a variety of cancers. Moreover, IFNG modulates normal pituitary hormone secretion, and was shown to inhibit the expression of the ACTH precursor POMC in murine ACTH-secreting AtT-2010/21/2008 tumor cells. We have studied the functional role of IFNG on pituitary tumor cells, focusing on the involvement of IFNG in the molecular events leading to the control of POMC transcriptional repression. Herein, it is shown that IFNG inhibits AtT-20 tumor cell proliferation without inducing apoptosis. Unexpectedly, an activated janus kinases–signal transducer and activator of transcription (JAK–STAT1) cascade is required for IFNG inhibitory action on POMC promoter activity. Factor-kappa B (NF-
B) is necessary for the inhibitory action of IFNG on Pomc transcription, since loss of NF-
B activity with I
B super-repressor abolishes this effect. In addition, 1 and 2 IFNG receptor immunoreactivity was detected in human corticotropinoma cells. Interestingly, IFNG inhibits ACTH production from these cells in primary cell culture, without affecting basal ACTH biosynthesis in normal non-tumoral pituitary cells. In conclusion, our data show for the first time that POMC transcription can be negatively regulated by a JAK–STAT1 and NF-
B-dependent pathway. | Introduction |
|---|
|
|
|---|
ACTH biosynthesis is coordinately controlled by different corticotrophin-releasing hormone (CRH)-triggered transcription factors at the level of the proopiomelanocortin (Pomc) promoter. Two Nur DNA-binding sites have been identified on the Pomc promoter. The proximal binding sequence named NUR77-binding response element (NBRE) binds NUR77 or Nurr1 monomers. The distal Nur response element (NurRE), constituted two everted NBRE-related sites, binds NUR77 homodimers or NUR77/NURR1 heterodimers, and plays a dominant role in mediating stimulation by CRH (Murphy & Conneely 1997, Philips et al. 1997a, Maira et al. 1999). CRH also induces transcriptional activity of activating protein 1 (AP1) and cAMP-responsive element-binding protein 1 (CREB1), which have been proposed to be involved in POMC transcription at the level of the AP1 site located in the first exon (Boutillier et al. 1995, 1998). Recent studies have provided evidence that, in corticotrophs, the inhibition of nuclear factor-kappa B (NF-
B) binding at its consensus binding site on the POMC promoter is required for the transcriptional activation of the POMC gene by CRH (Karalis et al. 2004). Additionally, a functional signal transducer and activator of transcription 1/3 (STAT1/3) low-affinity binding site overlapping in part with the NurRE was identified in the distal region of the Pomc promoter (Bousquet et al. 2000). A synergistic signaling by CRH and the pleiotropic cytokine, leukemia inhibitory factor (LIF), bridged by phosphorylated CREB1 at the NurRE–STAT element of the POMC promoter was already described (Mynard et al. 2004). Transcription factors PITX1 and TBX19 are critical for terminal differentiation and identity of corticotroph cells. TBX19 activates POMC transcription in cooperation with PITX homeoproteins (Lamolet et al. 2001).
Cytokines play an important role in modulating normal pituitary hormone secretion (Besedovsky & del Rey 1996, Ray & Melmed 1997, Auernhammer & Melmed 2000, Arzt 2001, Nudi et al. 2005). Previous reports showed that interferon-
(IFNG), a potent immunostimulatory cytokine, also plays a regulatory role in the adenohypophysis. Vankelecom et al. (1990, 1992) described that IFNG inhibits agonist-stimulated ACTH, prolactin (PRL), and growth hormone secretion in normal rat pituitary cell cultures via folliculostellate cells. On the other side, it was shown that IFNG increased PRL and IL6 production (Yamaguchi et al. 1991), but had no effect on unstimulated ACTH secretion (Holsboer et al. 1988) in rat pituitary cell cultures. In vivo, IFNG enhances human cortisol secretion without a comparable rise in ACTH secretion (Holsboer et al. 1988).
Beyond the modulatory role exerted by IFNG on normal pituitary hormone secretion, this cytokine displays antiproliferative (Buszello 1995, Wu et al. 1996, Suk et al. 2001, Ikeda et al. 2002, Wall et al. 2003) and tumoricidal (Saiki et al. 1992, Belardelli 1995, Billiau 1996, Boehm et al. 1997) effects in a variety of cancers. However, the potential role of IFNG on tumor pituitary cells is poorly understood. It has been described that in corticotroph AtT-20 tumor cell line, IFNG decreases POMC promoter-driven expression of luciferase reporter gene (Katahira et al. 1998). Pointing to a role for IFNG as a para/autocrine pituitary factor, Ifng mRNA was detected by RT-PCR in unstimulated and lipopolysaccharide (LPS)-treated normal murine pituitary cells (Pitossi et al. 1997). Moreover, mRNA for IFNG receptor was expressed after LPS stimulation in the pituitary gland from young and old mice (Utsuyama & Hirokawa 2002).
IFNG acts through a transmembrane receptor composed by two subunits: the ligand-binding subunit 1 (IFN-
R1 and the signal-transducing subunit 2 (IFN-
R2; Aguet et al. 1988, Kumar et al. 1989, Hemmi et al. 1994). Binding of IFNG to its receptor activates the receptor-associated Janus kinases (JAK1 and JAK2), allowing the recruitment and phosphorylation of STAT1. Phosphorylated STAT1 undergoes dimerization, translocates to the nucleus, and regulates gene expression (Ramana et al. 2002, Platanias 2005). Negative regulation of the JAK–STAT pathway involves several inhibitory mechanisms, such as binding to receptor sites and inactivation of JAKs by suppressor of cytokine (SOCS; Aaronson & Horvath 2002). STAT3 can also be weakly activated by IFNG (Qing & Stark 2004). STAT1 and STAT3 have similar structures, both are phosphorylated upon cytokine stimulation, and both form dimers, move to the nucleus, bind to
-activated sequence elements, and activate transcription of many genes (Schindler & Darnell 1995, Darnell 1997, Levy & Darnell 2002). STAT1 and 3 dimers bind selectively to very similar but not identical elements (Horvath et al. 1995, Seidel et al. 1995).
In this work, we studied the role of IFNG on the molecular events leading to the control of POMC transcriptional repression. The rationale for choosing IFNG was both its inhibitory action on POMC transcription and its potent tumoricidal/antiproliferative effects. Herein, we demonstrated that in the pituitary corticotroph tumor cell line AtT-20, IFNG-induced activation of the JAK–STAT1 cascade results in Pomc promoter repression through a NF-
B-mediated mechanism. Moreover, IFNG inhibits ACTH production in AtT-20 cells and in human corticotropinomas, but not in the primary culture of normal murine pituitary cells. Besides that, IFNG inhibits proliferation in AtT-20 cells.
| Materials and Methods |
|---|
|
|
|---|
Cells were kept at 37 °C in 5% CO2. AtT-20 pituitary corticotroph tumor cells (Utsuyama & Hirokawa 2002) were cultured in 45 cm3 culture flasks in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, and 105 U/l penicillin/streptomycin. AtT-20 cells were distributed for cell growth and hormone secretion studies in 96-well plates (1x105 cells/ml). For western blot analysis and luciferase assay, the cells were seeded onto 6-well plates (3.5x105 cells/ml).
ACTH-secreting pituitary tumors were obtained from patients with Cushing's disease. Pituitary cell culture from human pituitary tumors or mice pituitary glands obtained from adult mice (20 g) was performed as described previously (Paez-Pereda et al. 2001). The tissue was washed with preparation buffer (137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, 10 mM glucose, and 15 mM HEPES (pH 7.3)). Sliced fragments were dispersed in preparation buffer containing 4 g/l collagenase (Cooper Biochemicals, Malvern, PA, USA), 10 mg/l DNase II, 0.1 g/l soybean trypsin inhibitor, and 1 g/l hyaluronidase. Dispersed cells were centrifuged and resuspended in DMEM supplemented with 2 mM essential vitamins, 5 mg/l insulin, 20 mg/l selenium, 5 mg/l transferrin, 30 nM triiodothyronine (Henning, Berlin, Germany), 10% FCS, and 1x105 U/l penicillin–streptomycin. Mice and human pituitary cells were seeded onto 48-well (1x105 cells/ml) and 96-well plates (1x105 cells/ml) respectively.
The cells were treated as indicated in each experiment with recombinant human or mouse IFNG (Roche) and human/rat CRH (Bachem, Heidelberg, Germany). Cycloheximide was obtained from Sigma–Aldrich.
Immunohistochemistry
Human pituitary tissue was obtained from autopsies performed 12–16 h post-mortem in healthy subjects after accidental death. Experiments were performed according to the guidelines of the Ethical Committee of the Max Planck Institute for using autopsy and biopsy materials. Eight micrometer sections were cut in a cryostat and fixed in cold 4% phosphate-buffered paraformaldehyde (Sigma). IFNG receptor subunits were detected using anti-IFN-
R
(1:1500; Acris, Hiddenhausen, Germany) and anti-IFN-
Rβ (1:800; Santa Cruz Biotechnology, Santa Cruz, CA, USA), in combination with anti-rabbit biotinylated IgG (1:800; Santa Cruz Biotechnology) and avidin–biotin–peroxidase complex with diaminobenzidine (Vector Laboratories, Burlingame, CA, USA).
ACTH was detected with a mouse mAb (Dako, Hamburg, Germany) in combination with anti-mouse IgG and mouse alkaline phosphatase (AP)–anti-AP complex (Sigma) with Vector Red, according to the manufacturer's instructions.
Cell proliferation and viability assays
After plating for 24 h, the cells were washed and incubated in DMEM with 2% FCS. The next day the cells were stimulated with 1–100 U/ml murine recombinant IFNG, between 1 and 5 days, as indicated. A cell proliferation reagent WST-1 assay (Roche Molecular Biochemicals) was used to measure cell proliferation and viability, following the manufacturer's instructions (Paez-Pereda et al. 2000). Acridine orange–ethidium bromide staining was used to rule out toxic effects.
Hormone measurements
After plating for 48 (AtT-20 cells) or 72 h (murine and human pituitary cells), the cells were washed and incubated in DMEM with 2% FCS. The next day the medium was changed and the cells were stimulated with 1–100 U/ml murine recombinant IFNG for 24 h as indicated. Samples were stored at –80 °C until measurement of ACTH was performed. ACTH was measured by RIA as described previously (Paez-Pereda et al. 2000).
Transfection assays
The Pomc-Luc plasmid, kindly provided by Dr Low, Oregon Health and Science University, Portland, OR, USA (Liu et al. 1995), containing the luciferase gene under the control of 770 bp of the rat Pomc promoter includes all the necessary sequences for the expression and regulation of Pomc. The AP1–Luc construct contains seven repeats of the AP1-responsive sequence (Stratagene, La Jolla, CA, USA). The NurRE–Luc and NBRE–Luc constructs contain three copies of the NurRE or NBRE coupled to the minimal Pomc promoter (–34/+63) and the complete Pomc-mut-NurRE promoter contains a mutant NurRE. The NurRE, NBRE, and the Pomc-mut-NurRE-Luc plasmid were provided by Dr Drouin, Laboratoire de Génétique Moléculaire, Institut de Recherches Cliniques de Montréal, Québec, Canada. The activity of NF-
B was specifically suppressed employing transfections with the I
B
super-repressor construct containing a mutated site at Ser 32 and Ser 36, which impedes phosphorylation and proteolysis and therefore prevents nuclear translocation of NF-
B (Dr altschmidt, Institut für Neurobiochemie, University of Witten/Herdecke, Witten, Germany). The Pomc-mut-NF-
B, kindly provided by Dr Karalis, Division of Endocrinology, Children's Hospital, Boston, MA, USA (Karalis et al. 2004), contains a mutated NF-
B-binding site. SOCS1 expression vector was kindly provided by Willson, The Walter and Eliza Hall Institute of Medical Research and the Cooperative Research Centre for Cellular Growth Factors, PO Royal Melbourne Hospital, Parkville, Australia (Starr et al. 1997).
B-Luc was provided by Dr Bell, Mayo Clinic, Rochester, MN, USA. STAT-Luc reporter plasmid containing three repeated STAT sites from the Ly6e promoter cloned into pZLuc-TK plasmid (Addgene plasmid 8689) and STAT3 pcDNA3 (Addgene plasmid 8706), provided by Darnell (Zhong et al. 1994, Wen et al. 1995), were obtained from Addgene, Cambridge, MA, USA. The pEFBOS-HA-STAT1 plasmid was kindly provided by Dr Hirano, Osaka University Medical School, Osaka, Japan (Nakajima et al. 1996). Site-directed mutagenesis was performed in order to obtain the Pomc-mut-STAT plasmid. The sequence of the STAT-binding site on the Pomc promoter was, for the STAT-binding site, TGCCAGGAA, and for the mutated binding site, TGCCAGCGG (Mynard et al. 2004). The mutated plasmid was sequenced for verification.
Cell transfection was performed using Lipofectamine (Invitrogen). Twenty-four hours after plating, the cells were transfected for 6 h in OptiMEM medium using 10 µl Lipofectamine per well and a 1.5 µg total plasmid DNA. Transfection efficiency was determined using a plasmid containing the CMV promoter driving the Renilla reporter gene. After 18 h in the culture medium, the cells were incubated for 6, 18, or 24 h with IFNG, CRH, or both. At the end of the treatment, the protein lysate was collected and luciferase and Renilla activities were measured by the Dual Luciferase Reporter Assay System (Promega), according to the manufacturer's instructions. The results are ratios of luciferase to Renilla activity. Results are expressed as fold induction with respect to basal.
Real-time quantitative reverse transcription PCR
Total RNA was isolated from AtT-20 cells after 30-min cycloheximide (10 µg/ml) and 18-h IFNG stimulations, as well as from control cells (18-h IFNG). Each group consisted of three experimental independent subjects. RNA was extracted using TRIzol reagent (Invitrogen), following the manufacturer's instructions. cDNA was synthesized from 1 µg total RNA using the Superscript II Reverse Transcriptase (Invitrogen). PCR amplifications were performed using the LightCycler 2.0 Real-Time PCR Systems and the QuantiFast SYBR Green PCR (Qiagen), according to the manufacturer's protocol. The primers used for the Pomc quantification are as follows: forward, ATAGATGTGTGGAGCTGGTGC; reverse, GGCTCTGGACTGCCATCTC. Quantification was carried out using a dilution standard from pooled sample probes. Relative expression was determined by normalization to hypoxanthine guanine phosphoribosyl transferase (Hprt; forward, ACCTCTCGAAGTGTTGGATACAGG; reverse, CTTGCGCTCATCTTAGGCTTTG).
Western blot
Western blot was performed as described previously (Paez-Pereda et al. 2001, Giacomini et al. 2006). Briefly, AtT-20 cells were washed with PBS and cell lysates were collected and analyzed by western blot. Equal levels of protein were electrophoresed by 10% SDS-PAGE. Proteins were blotted onto nitrocellulose blotting membranes (Sigma) using standard procedures and the following antibodies were added: IFN-
R1 (CD119; Acris) and IFN-
R2 (Santa Cruz Biotechnology). For the expression of P-STAT1 and P-STAT3 (Santa Cruz Biotechnology), AtT-20 cells were first incubated with IFNG (10 U/ml) for 30 min or 3 h. β-ACTIN levels were analyzed using a monoclonal anti-β-ACTIN antibody (Chemicon, Temecula, CA, USA).
Statistical analysis
Results are expressed as mean±S.E.M. Differences were assessed by one-way ANOVA in combination with Scheffé's test, considering P<0.05 as significant.
| Results |
|---|
|
|
|---|
The expression of IFN-
R1 and 2 in the corticotroph cell line AtT-20 was examined by western blot analysis. Both components of the receptor complex were expressed on AtT-20 pituitary corticotroph tumor cells, as shown in Fig. 1A.
|
Accordingly, IFNG increased STAT-dependent transcriptional activity (Fig. 1C).
IFNG inhibits Pomc transcription in AtT-20 cells
Since a functional STAT1/3 low-affinity binding site was identified in the Pomc promoter and we found that STAT1 was activated by IFNG in these cells, we decided to investigate the effect of IFNG on Pomc transcriptional activity. AtT-20 cells were transiently transfected with the Pomc promoter reporter plasmid (Pomc-Luc) and treated with IFNG for different stimulation times, as indicated in Fig. 2A.
|
In parallel, we performed a reverse transcriptase real-time PCR of endogenous Pomc mRNA from AtT-20 cells treated with IFNG (10 U/ml). Eighteen hours of treatment with IFNG reduced endogenous Pomc gene transcription (Pomc/Hprt1 (mRNA): basal 0.83±0.02 versus IFNG 0.62±0.09, P<0.05).
Inhibition of Pomc gene expression by IFNG is JAK–STAT dependent
To analyze whether the inhibition on Pomc transcriptional activity by IFNG is mediated by the JAK–STAT pathway, AtT-20 cells were transfected with an SOCS1 expression vector, which inhibits cytokine-induced JAK–STAT. SOCS1 overexpression in AtT-20 cells significantly blocked the IFNG induced inhibition of the Pomc promoter activity (Fig. 3A), indicating that this effect is JAK–STAT dependent.
|
Next, we analyzed whether STAT1-binding activity to the Pomc promoter is important for the inhibition of the Pomc gene expression by IFNG. For this purpose, the Pomc promoter from the Pomc–Luc construct was mutated at the STAT-binding site according to Mynard et al. (2004). AtT-20 cells were transfected with either the intact or mutated reporter gene. The mutation at the STAT-binding site of the Pomc promoter does not abolish the inhibition of the transcriptional activation of the Pomc gene by IFNG treatment (Fig. 3C). Thus, Pomc gene repression by IFNG does not involve STAT1 binding to target DNA consensus sequences on the Pomc promoter.
IFNG does not affect basal NurRE, NBRE, AP1, and CRE transcriptional activity in AtT-20 cells
To elucidate whether IFNG also modulates elements on the Pomc promoter, which are involved in Pomc induction by CRH, we used luciferase reporters for NurRE, NBRE, AP1, and CRE. In all these experiments, CRH was used as positive control for reporter induction. We found that 6-h incubation with IFNG inhibits CRH-induced NurRE and NBRE transcriptional activities without affecting the basal transcription (Fig. 4A and B). Similar results were obtained when the cells were treated during 18 h (data not shown). Furthermore, using a reporter containing the Pomc promoter mutated on the NurRE site, it was observed that IFNG still inhibits basal Pomc transcription (Fig. 4C). These data indicate that the inhibition of the Pomc promoter by IFNG is mediated, at least in part, by NUR77/Nurr1 when CRH is present but not under basal conditions.
|
NF-
B is associated with the transcriptional inhibition of Pomc by IFNG
Considering that NF-
B has been described to exert transcriptional inhibitory action on the CRH-induced Pomc promoter (Karalis et al. 2004) and to elucidate the possible role of NF-
B on IFNG inhibitory effects, we evaluate the Pomc promoter transcriptional activity in tumor corticotroph AtT-20 cells in the presence of a super-repressor form of I
B
, resistant to both phosphorylation and proteolytic degradation. The overexpression of the repressor abolished completely the IFNG-mediated inhibition of Pomc transcriptional activity in basal conditions (Fig. 5A). Furthermore, the inhibition of NF-
B by the pharmacological inhibitor BAY 11 7082 ((E)-3-(4-Methylphenyl-sulfonyl)-2-propenenitrile), which inhibits NF-
B activation by the inhibition of I
B
phosphorylation (Gutierrez et al. 2005), reversed the inhibitory effect of IFNG on the Pomc promoter transcriptional activity (data not shown). These data indicate that NF-
B mediates the transcriptional inhibition of Pomc by IFNG. To test whether NF-
B-binding activity to the Pomc promoter is an important step for the inhibition of the pituitary Pomc gene expression, we transfected AtT-20 cells with a plasmid containing the Pomc promoter, either intact or mutated at the NF-
B-binding site, coupled to the luciferase reporter gene (Fig. 5B). IFNG treatment (24 h) of the AtT-20 cells transfected with the mutated construct resulted in an inhibition of the transcriptional activation of the Pomc gene to the same extent as the one observed using the wild-type construct. The same results were obtained when AtT-20 cells were treated for 18 h with IFNG (data not shown). These data indicate that NF-
B binding to its cognate site is not necessary for the transcriptional inhibition of Pomc by IFNG. To further understand the inhibitory effect of STAT1 and NF-
B on IFNG response, we cotransfected AtT-20 cells with STAT1 and I
B
super-repressor expression plasmids. Figure 5C shows the abrogation of the STAT1-mediated inhibition of the Pomc promoter transcriptional activity in the presence of I
B
super-repressor. Furthermore, treatment of AtT-20 cells with IFNG induces NF-
B transcriptional activity (Fig. 5D).
|
B-binding sites do not abolish IFNG inhibitory action on the Pomc promoter, indicating that the binding of these factors to their specific DNA sequences is not required. To test whether IFNG inhibition of endogenous Pomc transcription requires de novo synthesis of transcription factors, AtT-20 cells were treated with or without IFNG in the presence or absence of the protein synthesis inhibitor cycloheximide. By reverse transcriptase real-time PCR, we observed that the inhibition of endogenous Pomc transcription by IFNG was abolished in the presence of cycloheximide (percentage of inhibition after IFNG: 25.3±3.7% versus IFNG+cycloheximide: 5.2±0.6%, P<0.05). Thus, IFNG may inhibit transcription indirectly by stimulating de novo synthesis of a repressor-like molecule induced by STAT1/NF-
B or by a negative interaction of STAT1/NF-
B with newly synthesized transcription factors recruited to the Pomc promoter. IFNG inhibits ACTH production in AtT-20 cells and in human corticotroph tumors but not in normal murine pituitary cells
To determine whether the observed inhibition in Pomc transcription results in ACTH inhibition, we examined the functional role of IFNG on ACTH secretion. IFNG treatment for 24 h decreased ACTH production in tumoral mouse corticotroph AtT-20 cells (Fig. 6A) but not in normal murine pituitary cells (Fig. 6B). To evaluate the role of STAT1 on ACTH production, AtT-20 cells were transfected with STAT1 expression vector. The cells were treated with IFNG versus basal and the supernatant was taken for ACTH determination. In agreement with our data obtained using the Pomc-Luc reporter plasmid, STAT1 inhibits ACTH production and this inhibition was even more pronounced in the presence of IFNG (ACTH in ng/ml, control plasmid: basal 26.0±1.2 versus IFNG 16.0±1.2, P<0.001; STAT1 expression plasmid: basal 20.0±1.6 versus IFNG 12.0±2.0, P<0.05).
|
|
R1 and 2
To analyze whether different expression levels of the receptor complex on the corticotropinoma cells may account for the different response to IFNG on ACTH production, the expression of IFN-
R1 and 2 in corticotroph adenoma tissue was evaluated by immunohistochemistry. IFN-
R1 and 2 expression in human adult normal pituitary gland as well as in corticotroph adenoma tissue was observed (Fig. 8). No differences were observed between all corticotropinoma tissues tested (data not shown). The IFN-
R1 and 2 signals were localized in ACTH-immunoreactive cells (Fig. 8).
|
The ability of IFNG to modulate cell proliferation in AtT-20 cells was tested. A dose–response inhibition of AtT-20 cell proliferation was observed in the WST-1 assay on day 4 (Fig. 9A).
|
To analyze whether the antiproliferative effect of IFNG was secondary to an increase in apoptosis, we carried out in parallel a flow cytometry analysis of DNA fragmentation, which is the molecular hallmark of apoptosis. The cells were treated with IFNG at different time points from 1 to 5 days every 24 h. These studies clearly indicate that IFNG does not influence cell death in corticotrophs at any time point analyzed (data not shown).
| Discussion |
|---|
|
|
|---|
B-dependent pathway. IFNG receptor subunits 1 and 2 are expressed on AtT-20 cells. The receptor expression indicates a possible direct IFNG action on these cells and not only via folliculostellate cells, as suggested previously (Vankelecom et al. 1990, 1992). Binding of IFNG to its receptor induces phosphorylation of STAT1 and, to a lesser extent, STAT3, in agreement with previous reports in other cellular models (Aaronson & Horvath 2002, Ramana et al. 2002, Qing & Stark 2004). Furthermore, IFNG increased STAT-dependent transcriptional activity. These data indicate that the IFNG signaling pathway is functional in AtT-20 cells.
Our results showed that IFNG inhibits Pomc transcriptional activity in a time- and dose-dependent manner. Interestingly, this inhibitory effect of IFNG is unique among cytokines, which were reported to stimulate Pomc transcription, and the intracellular signaling mechanisms leading to this inhibition are unknown. Herein, we show that activation of corticotroph JAK–STAT is essential for IFNG-mediated inhibition of basal Pomc gene expression, since this effect can be abolished by the overexpression of the JAK–STAT inhibitor SOCS1. To our knowledge, there are no earlier reports demonstrating the inhibition of Pomc promoter by JAK–STAT signaling. Conversely, LIF activates the Pomc promoter by inducing JAK–STAT (Auernhammer et al. 1998, Auernhammer & Melmed 2000). Whereas LIF preferentially promotes STAT3 homodimerization and binding to their consensus sites (Mynard et al. 2002), IFNG induces the formation of STAT1 complexes (Ramana et al. 2002, Platanias 2005). Thus, the binding of distinct homodimers to the STAT1/3 site present in the Pomc promoter may trigger opposite responses in terms of Pomc transcription. Accordingly, data from the literature showed that STAT1 and STAT3 have opposing biological effects, with STAT3 acting as an oncogene (Bromberg et al. 1999, Bromberg 2002) and STAT1 as a tumor suppressor (Bromberg et al. 1996, Chin et al. 1996). Herein, we also showed that mutation at the STAT1-binding sites did not abolish IFNG inhibitory action, indicating that STAT1 binding to its cognate site at the Pomc promoter is not necessary for the inhibition in Pomc transcriptional activity by IFNG.
In addition to the STAT pathway, we show that NF-
B is also involved in the IFNG-mediated inhibition of Pomc gene expression. Under CRH-activating conditions, Karalis et al. (2004) found that the transcriptional activation of the Pomc gene is associated with the inhibition of NF-
B DNA binding. In the present work, loss of NF-
B activity by using the I
B super-repressor prevents the IFNG-mediated inhibition of the Pomc promoter under basal conditions. Furthermore, the presence of the I
B super-repressor abolishes the inhibition mediated by the STAT1 overexpression on Pomc transcriptional activity. Moreover, IFNG induces NF-
B transcriptional activity. It has been proposed that IFNs can activate NF-
B directly as a component of IFN-stimulated gene expression (Sizemore et al. 2004). In this direction, Deb et al. (2001) showed that IFNG alone can activate NF-
B by a JAK1-mediated mechanism. Thus, NF-
B acting downstream to STAT1 is necessary for Pomc transcriptional repression. Interestingly, IFNG inhibited the promoter activity of Pomc bearing a mutation in the NF-
B-binding site. These data indicate that an intact NF-
B DNA-binding activity is not necessary for IFNG action. Therefore, Pomc gene repression is NF-
B dependent but does not involve NF-
B binding to target DNA consensus sequences on the Pomc promoter. Hence, a direct interaction between STAT1 or NF-
B and the Pomc promoter is not necessary for the IFNG-mediated inhibition of Pomc. These results together with the fact that the inhibition of the promoter activity took place after 18 h indicate an indirect effect of the IFNG pathway on the Pomc promoter. Indeed, the effect of IFNG on endogenous Pomc was abolished by cycloheximide, indicating the involvement of new protein synthesis. Thus, IFNG inhibits transcription indirectly by stimulating de novo synthesis of a repressor-like molecule through STAT1/NF-
B or by a negative interaction of STAT1/NF-
B with new synthesized transcription factors recruited to the Pomc promoter. In other cellular models, like lung adenocarcinoma cells, direct STAT/NF-
B interactions have been described (Marks-Konczalik et al. 1998, Ganster et al. 2005). Whether STAT1 interacts with NF-
B and/or whether there is a recruitment of the complex together with other transcription factors to the Pomc promoter, which may elicit transcriptional repression of Pomc, remains to be elucidated. At present, the genes targeted by IFNG in AtT-20 cells remain unknown. Microarray or Chip-on-Chip experiments could specify which are these genes, and would allow gaining more insight into the STAT1 and NF-
B interactions on consensus binding sites.
CRH induces AP1 and CREB1 transcriptional activity, which have been proposed to be involved in Pomc transcription (Boutillier et al. 1995, 1998). However, the main mediators of CRH action on Pomc transcription are the nuclear orphan receptors NUR77 and Nurr1, which are acting on the NurRE and NBRE sites (Philips et al. 1997a,b, Maira et al. 1999, Kovalovsky et al. 2002). We found that IFNG inhibited the NUR77/Nurr1 transcriptional activities in AtT-20 cells stimulated with CRH without affecting AP1- and CRE-driven luciferase activities. By contrast, IFNG did not affect the basal transcriptional activity of these transcription factors. Thus, in tumoral corticotroph cells, IFNG inhibits basal Pomc transcriptional activity without affecting the factors involved in CRH-induced Pomc transcription. Since pituitary corticotropinomas are poorly sensitive to CRH and Pomc is not under CRH control in these cells, the inability of IFNG to affect these factors is of no consequence for its inhibitory action on ACTH synthesis. Taken together, these data reinforce the fact that IFNG inhibition on Pomc promoter is mediated by the factors different from the main mediators of CRH. Repression of Pomc transcription by interference with PITX/TPIT was described for the transcription factor Smad (Nudi et al. 2005). Further experiments are needed to evaluate whether TPIT is also involved in IFNG STAT1-mediated inhibition of Pomc transcriptional activity.
We found that IFNG not only affected Pomc transcriptional activity but also endogenous ACTH production in AtT-20 cells. In normal murine pituitary cells, the basal secretion of ACTH remained unaffected by IFNG treatment pointing to a tumor-specific Pomc inhibitory action of IFNG. Accordingly, a previous clinical study showed that IFNG administration to healthy males does not affect ACTH levels (Holsboer et al. 1988). However, in corticotropinomas derived from patients with Cushing's disease, we found that IFNG inhibits hormone production in six out of seven tumors in primary cell cultures. Essentially, the same results were found in AtT-20 cells. These results clearly indicate the specific inhibitory action of IFNG on ACTH production in tumors from patients with Cushing's disease and not in normal tissues. It is well known that the expression of STAT1 and STAT3 is often deregulated in different tumors and tumor cell lines (Schindler 2002, Calo et al. 2003). In such cases, the responses to IFNG may be different to the normal response (Qing & Stark 2004).
In agreement with our data obtained using the Pomc-Luc reporter plasmid, STAT1 inhibits ACTH production and this inhibition is even more pronounced in the presence of IFNG. Thus, inhibition of hormone release and gene transcription by IFNG occurs through a STAT1-dependent pathway.
In addition, we showed that IFNG reduces endogenous Pomc mRNA, though to a lesser extent, than the transcriptional activity directed from the Pomc reporter plasmid. Nevertheless, it has been described that changes in endogenous Pomc mRNA levels do not reflect changes in Pomc transcription, most probably due to Pomc mRNA stability and accumulation (Levin et al. 1989, Boutillier et al. 1998). Even in the presence of CRH or cAMP, Gagner & Drouin (1987) showed a slight induction of Pomc mRNA levels after treatment of AtT-20 or primary rat anterior pituitary cells with respect to basal. In the same direction, Lundblad & Roberts (1988) observed that the rapidity of the effects of stimulators or inhibitors of Pomc peptide release on Pomc gene transcription is sharply contrasted against the changes observed in mRNA levels in the cytoplasm. Thus, changes in Pomc mRNA levels may be physiologically relevant despite its low magnitude. In this direction, IFNG inhibits ACTH production in about 39.5±4.2%, showing the physiological importance of IFNG in setting ACTH levels despite the endogenous Pomc mRNA inhibition of 25.3±3.7%.
We report here that IFNG receptor subunits
and β are expressed in normal pituitary corticotroph cells, being colocalized with ACTH-immunoreactive cells. Furthermore, the expression of both subunits is also found in corticotroph adenoma tissue from patients with Cushing's disease. IFN-
R1 and 2 expression levels in all seven corticotroph pituitary tumors examined was similar to that detected in normal pituitary tissues. These data indicate that the receptor levels may not account for the different response to IFNG between tumoral and non-tumoral corticotroph cells.
In addition to ACTH production and gene expression, we demonstrated here for the first time that IFNG inhibited corticotroph tumor cell proliferation. A dose-dependent inhibition of AtT-20 cell growth was observed. Similar results of an IFNG-dependent inhibition of cellular proliferation have been observed in ovarian cancer, fibrosarcomas, and murine fibroblasts, but not in mutagenized human cells lacking STAT1 or in murine cells derived from STAT1-deficient mice (Ikeda et al. 2002). On the basis of the presented data, it can be proposed that the antiproliferative effect of IFNG on AtT-20 cells may be mediated by the JAK–STAT1 pathway. The IFNG/STAT1 cascade has been implicated in promoting tumor cell apoptosis (Suk et al. 2001). Furthermore, the robust inhibitory effect of IFNG suggests that the reduction in cell number might be due to apoptotic cell death. Nevertheless, recent reports demonstrate that IFNG arrests the cell cycle in different cellular models by the inhibition of the expression of Cyclin D1 and induction of the cyclin-dependent kinase inhibitor p27-Kip1 (Harvat et al. 1997, Mandal et al. 1998, Chew et al. 2005). Flow cytometry studies analyzing DNA fragmentation did not reveal apoptotic cell death, strongly indicating that IFNG acts by causing cell cycle arrest.
In summary, our data show for the first time that IFNG-induced STAT1 activation inhibits Pomc promoter transcriptional activity in AtT-20 corticotroph cells. IFNG induces the phosphorylation of STAT1 and, to a lesser extent, STAT3. STAT3 overexpression abolished the STAT1 effect on Pomc, indicating that alternative activation of STAT1 or STAT3 has opposing biological effects. Furthermore, we found that NF-
B, acting downstream to STAT1, is necessary for the IFNG STAT1-mediated inhibitory effect on Pomc transcription.
Thus, we demonstrate for the first time a novel JAK–STAT1/NF-
B-dependent inhibitory pathway acting on basal Pomc promoter activity. Pharmacological treatments that ameliorate the hypercortisolemic features of Cushing's disease do not decrease pituitary ACTH levels or tumor growth. Signaling pathways triggered by IFNG inhibit pituitary tumor cell proliferation and ACTH synthesis and secretion. Thus, the development of therapeutic agents that target this novel IFNG–JAK–STAT1/NF-
B pathway might provide a valuable approach for treating Cushing's disease.
| Declaration of interest |
|---|
|
|
|---|
| Funding |
|---|
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Aguet M, Dembic Z & Merlin G 1988 Molecular cloning and expression of the human interferon-gamma receptor. Cell 55 273–280.[Medline]
Arzt E 2001 gp130 cytokine signaling in the pituitary gland: a paradigm for cytokine-neuro-endocrine pathways. Journal of Clinical Investigation 108 1729–1733.[CrossRef][Web of Science][Medline]
Auernhammer CJ & Melmed S 2000 Leukemia-inhibitory factor-neuroimmune modulator of endocrine function. Endocrine Reviews 21 313–345.
Auernhammer CJ, Chesnokova V, Bousquet C & Melmed S 1998 Pituitary corticotroph SOCS-3: novel intracellular regulation of leukemia-inhibitory factor-mediated proopiomelanocortin gene expression and adrenocorticotropin secretion. Molecular Endocrinology 12 954–961.
Belardelli F 1995 Role of interferons and other cytokines in the regulation of the immune response. Acta Pathologica, Microbiologica. et Immunologica Scandinavica 103 161–179.
Besedovsky HO & del Rey A 1996 Immune–neuro-endocrine interactions: facts and hypotheses. Endocrine Reviews 17 64–102.
Billiau A 1996 Interferon-gamma: biology and role in pathogenesis. Advances in Immunology 62 61–130.[Web of Science][Medline]
Boehm U, Klamp T, Groot M & Howard JC 1997 Cellular responses to interferon-gamma. Annual Review of Immunology 15 749–795.[CrossRef][Web of Science][Medline]
Bousquet C & Melmed S 1999 Critical role for STAT3 in murine pituitary adrenocorticotropin hormone leukemia inhibitory factor signaling. Journal of Biological Chemistry 274 10723–10730.
Bousquet C, Zatelli MC & Melmed S 2000 Direct regulation of pituitary proopiomelanocortin by STAT3 provides a novel mechanism for immuno–neuroendocrine interfacing. Journal of Clinical Investigation 106 1417–1425.[Web of Science][Medline]
Boutillier AL, Monnier D, Lorang D, Lundblad JR, Roberts JL & Loeffler JP 1995 Corticotropin-releasing hormone stimulates proopiomelanocortin transcription by cFos-dependent and -independent pathways: characterization of an AP1 site in exon 1. Molecular Endocrinology 9 745–755.
Boutillier AL, Gaiddon C, Lorang D, Roberts JL & Loeffler JP 1998 Transcriptional activation of the proopiomelanocortin gene by cyclic AMP-responsive element binding protein. Pituitary 1 33–43.[CrossRef][Medline]
Bromberg J 2002 Stat proteins and oncogenesis. Journal of Clinical Investigation 109 1139–1142.[CrossRef][Web of Science][Medline]
Bromberg JF, Horvath CM, Wen Z, Schreiber RD & Darnell JE Jr 1996 Transcriptionally active Stat1 is required for the antiproliferative effects of both interferon alpha and interferon gamma. PNAS 93 7673–7678.
Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C & Darnell JE Jr 1999 Stat3 as an oncogene. Cell 98 295–303.[CrossRef][Web of Science][Medline]
Buszello H 1995 Antiproliferative effects of four different cytokines on renal carcinoma cell lines. Anticancer Research 15 735–738.[Web of Science][Medline]
Calo V, Migliavacca M, Bazan V, Macaluso M, Buscemi M, Gebbia N & Russo A 2003 STAT proteins: from normal control of cellular events to tumorigenesis. Journal of Cellular Physiology 197 157–168.[CrossRef][Web of Science][Medline]
Chew LJ, King WC, Kennedy A & Gallo V 2005 Interferon-gamma inhibits cell cycle exit in differentiating oligodendrocyte progenitor cells. Glia 52 127–143.[Medline]
Chin YE, Kitagawa M, Su WC, You ZH, Iwamoto Y & Fu XY 1996 Cell growth arrest and induction of cyclin-dependent kinase inhibitor p21 WAF1/CIP1 mediated by STAT1. Science 272 719–722.[Abstract]
Darnell JE Jr 1997 STATs and gene regulation. Science 277 1630–1635.
Deb A, Haque SJ, Mogensen T, Silverman RH & Williams BR 2001 RNA-dependent protein kinase PKR is required for activation of NF-kappa B by IFN-gamma in a STAT1-independent pathway. Journal of Immunology 166 6170–6180.
Gagner JP & Drouin J 1987 Tissue-specific regulation of pituitary proopiomelanocortin gene transcription by corticotropin-releasing hormone, 3',5'-cyclic adenosine monophosphate, and glucocorticoids. Molecular Endocrinology 1 677–682.
Ganster RW, Guo Z, Shao L & Geller DA 2005 Differential effects of TNF-alpha and IFN-gamma on gene transcription mediated by NF-kappaB–Stat1 interactions. Journal of Interferon & Cytokine Research 25 707–719.[CrossRef][Medline]
Giacomini D, Paez-Pereda M, Theodoropoulou M, Labeur M, Refojo D, Gerez J, Chervin A, Berner S, Losa M, Buchfelder M et al. 2006 Bone morphogenetic protein-4 inhibits corticotroph tumor cells: involvement in the retinoic acid inhibitory action. Endocrinology 147 247–256.[CrossRef][Web of Science][Medline]
Gutierrez H, Hale VA, Dolcet X & Davies A 2005 NF-kappaB signalling regulates the growth of neural processes in the developing PNS and CNS. Development 132 1713–1726.
Harvat BL, Seth P & Jetten AM 1997 The role of p27Kip1 in gamma interferon-mediated growth arrest of mammary epithelial cells and related defects in mammary carcinoma cells. Oncogene 14 2111–2122.[CrossRef][Web of Science][Medline]
Hemmi S, Bohni R, Stark G, Di Marco F & Aguet M 1994 A novel member of the interferon receptor family complements functionality of the murine interferon gamma receptor in human cells. Cell 76 803–810.[CrossRef][Web of Science][Medline]
Holsboer F, Stalla GK, von Bardeleben U, Hammann K, Muller H & Muller OA 1988 Acute adrenocortical stimulation by recombinant gamma interferon in human controls. Life Sciences 42 1–5.[CrossRef][Web of Science][Medline]
Horvath CM, Wen Z & Darnell JE Jr 1995 A STAT protein domain that determines DNA sequence recognition suggests a novel DNA-binding domain. Genes and Development 9 984–994.
Ikeda H, Old LJ & Schreiber RD 2002 The roles of IFN gamma in protection against tumor development and cancer immunoediting. Cytokine and Growth Factor Reviews 13 95–109.[CrossRef][Web of Science][Medline]
Karalis KP, Venihaki M, Zhao J, van Vlerken LE & Chandras C 2004 NF-kappaB participates in the corticotropin-releasing, hormone-induced regulation of the pituitary proopiomelanocortin gene. Journal of Biological Chemistry 279 10837–10840.
Katahira M, Iwasaki Y, Aoki Y, Oiso Y & Saito H 1998 Cytokine regulation of the rat proopiomelanocortin gene expression in AtT-20 cells. Endocrinology 139 2414–2422.
Kovalovsky D, Refojo D, Liberman AC, Hochbaum D, Pereda MP, Coso OA, Stalla GK, Holsboer F & Arzt E 2002 Activation and induction of NUR77/NURR1 in corticotrophs by CRH/cAMP: involvement of calcium, protein kinase A, and MAPK pathways. Molecular Endocrinology 16 1638–1651.
Kumar CS, Muthukumaran G, Frost LJ, Noe M, Ahn YH, Mariano TM & Pestka S 1989 Molecular characterization of the murine interferon gamma receptor cDNA. Journal of Biological Chemistry 264 17939–17946.
Lamolet B, Pulichino AM, Lamonerie T, Gauthier Y, Brue T, Enjalbert A & Drouin J 2001 A pituitary cell-restricted T box factor, Tpit, activates Pomc transcription in cooperation with Pitx homeoproteins. Cell 104 849–859.[CrossRef][Web of Science][Medline]
Levin N, Blum M & Roberts JL 1989 Modulation of basal and corticotropin-releasing factor-stimulated proopiomelanocortin gene expression by vasopressin in rat anterior pituitary. Endocrinology 125 2957–2966.
Levy DE & Darnell JE Jr 2002 Stats: transcriptional control and biological impact. Nature Reviews. Molecular Cell Biology 3 651–662.[CrossRef][Web of Science][Medline]
Liu B, Mortrud M & Low MJ 1995 DNA elements with AT-rich core sequences direct pituitary cell-specific expression of the pro-opiomelanocortin gene in transgenic mice. Biochemical Journal 312 827–832.[Web of Science][Medline]
Lundblad JR & Roberts JL 1988 Regulation of proopiomelanocortin gene expression in pituitary. Endocrine Reviews 9 135–158.
Maira M, Martens C, Philips A & Drouin J 1999 Heterodimerization between members of the Nur subfamily of orphan nuclear receptors as a novel mechanism for gene activation. Molecular and Cellular Biology 19 7549–7557.
Mandal M, Bandyopadhyay D, Goepfert TM & Kumar R 1998 Interferon-induces expression of cyclin-dependent kinase-inhibitors p21WAF1 and p27Kip1 that prevent activation of cyclin-dependent kinase by CDK-activating kinase (CAK). Oncogene 16 217–225.[CrossRef][Web of Science][Medline]
Marks-Konczalik J, Chu SC & Moss J 1998 Cytokine-mediated transcriptional induction of the human inducible nitric oxide synthase gene requires both activator protein 1 and nuclear factor kappaB-binding sites. Journal of Biological Chemistry 273 22201–22208.
Murphy EP & Conneely OM 1997 Neuroendocrine regulation of the hypothalamic–pituitary–adrenal axis by the nurr1/nur77 subfamily of nuclear receptors. Molecular Endocrinology 11 39–47.
Mynard V, Guignat L, Devin-Leclerc J, Bertagna X & Catelli MG 2002 Different mechanisms for leukemia inhibitory factor-dependent activation of two proopiomelanocortin promoter regions. Endocrinology 143 3916–3924.
Mynard V, Latchoumanin O, Guignat L, Devin-Leclerc J, Bertagna X, Barre B, Fagart J, Coqueret O & Catelli MG 2004 Synergistic signaling by corticotropin-releasing hormone and leukemia inhibitory factor bridged by phosphorylated 3',5'-cyclic adenosine monophosphate response element binding protein at the Nur response element (NurRE)-signal transducers and activators of transcription (STAT) element of the proopiomelanocortin promoter. Molecular Endocrinology 18 2997–3010.
Nakajima K, Yamanaka Y, Nakae K, Kojima H, Ichiba M, Kiuchi N, Kitaoka T, Fukada T, Hibi M & Hirano T 1996 A central role for Stat3 in IL-6-induced regulation of growth and differentiation in M1 leukemia cells. EMBO Journal 15 3651–3658.[Web of Science][Medline]
Nudi M, Ouimette JF & Drouin J 2005 Bone morphogenic protein (Smad)-mediated repression of proopiomelanocortin transcription by interference with Pitx/Tpit activity. Molecular Endocrinology 19 1329–1342.
Paez-Pereda M, Ledda MF, Goldberg V, Chervin A, Carrizo G, Molina H, Muller A, Renner U, Podhajcer O, Arzt E et al. 2000 High levels of matrix metalloproteinases regulate proliferation and hormone secretion in pituitary cells. Journal of Clinical Endocrinology and Metabolism 85 263–269.
Paez-Pereda M, Kovalovsky D, Hopfner U, Theodoropoulou M, Pagotto U, Uhl E, Losa M, Stalla J, Grubler Y, Missale C et al. 2001 Retinoic acid prevents experimental Cushing syndrome. Journal of Clinical Investigation 108 1123–1131.[CrossRef][Web of Science][Medline]
Philips A, Lesage S, Gingras R, Maira MH, Gauthier Y, Hugo P & Drouin J 1997a Novel dimeric NUR77 signaling mechanism in endocrine and lymphoid cells. Molecular and Cellular Biology 17 5946–5951.
Philips A, Maira M, Mullick A, Chamberland M, Lesage S, Hugo P & Drouin J 1997b Antagonism between NUR77 and glucocorticoid receptor for control of transcription. Molecular and Cellular Biology 17 5952–5959.
Pitossi F, del Rey A, Kabiersch A & Besedovsky H 1997 Induction of cytokine transcripts in the central nervous system and pituitary following peripheral administration of endotoxin to mice. Journal of Neuroscience Research 48 287–298.[CrossRef][Web of Science][Medline]
Platanias LC 2005 Mechanisms of type-I- and type-II-interferon-mediated signalling. Nature Reviews. Immunology 5 375–386.[CrossRef][Web of Science][Medline]
Qing Y & Stark GR 2004 Alternative activation of STAT1 and STAT3 in response to interferon-gamma. Journal of Biological Chemistry 279 41679–41685.
Ramana CV, Gil MP, Schreiber RD & Stark GR 2002 Stat1-dependent and -independent pathways in IFN-gamma-dependent signaling. Trends in Immunology 23 96–101.[CrossRef][Web of Science][Medline]
Ray D & Melmed S 1997 Pituitary cytokine and growth factor expression and action. Endocrine Reviews 18 206–228.
Saiki I, Sato K, Yoo YC, Murata J, Yoneda J, Kiso M, Hasegawa A & Azuma I 1992 Inhibition of tumor-induced angiogenesis by the administration of recombinant interferon-gamma followed by a synthetic lipid-A subunit analogue (GLA-60). International Journal of Cancer 51 641–645.[Web of Science][Medline]
Schindler C & Darnell JE Jr 1995 Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annual Review of Biochemistry 64 621–651.[Web of Science][Medline]
Schindler CW 2002 Series introduction. JAK-STAT signaling in human disease. Journal of Clinical Investigation 109 1133–1137.[CrossRef][Web of Science][Medline]
Seidel HM, Milocco LH, Lamb P, Darnell JE Jr, Stein RB & Rosen J 1995 Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activators of transcription) DNA binding and transcriptional activity. PNAS 92 3041–3045.
Sizemore N, Agarwal A, Das K, Lerner N, Sulak M, Rani S, Ransohoff R, Shultz D & Stark GR 2004 Inhibitor of kappaB kinase is required to activate a subset of interferon gamma-stimulated genes. PNAS 101 7994–7998.
Starr R, Willson TA, Viney EM, Murray LJ, Rayner JR, Jenkins BJ, Gonda TJ, Alexander WS, Metcalf D, Nicola NA et al. 1997 A family of cytokine-inducible inhibitors of signalling. Nature 387 917–921.[CrossRef][Web of Science][Medline]
Suk K, Chang I, Kim YH, Kim S, Kim JY, Kim H & Lee MS 2001 Interferon gamma (IFNgamma) and tumor necrosis factor alpha synergism in ME-180 cervical cancer cell apoptosis and necrosis. IFNgamma inhibits cytoprotective NF-kappa B through STAT1/IRF-1 pathways. Journal of Biological Chemistry 276 13153–13159.
Utsuyama M & Hirokawa K 2002 Differential expression of various cytokine receptors in the brain after stimulation with LPS in young and old mice. Experimental Gerontology 37 411–420.[CrossRef][Web of Science][Medline]
Vankelecom H, Carmeliet P, Heremans H, Van Damme J, Dijkmans R, Billiau A & Denef C 1990 Interferon-gamma inhibits stimulated adrenocorticotropin, prolactin, and growth hormone secretion in normal rat anterior pituitary cell cultures. Endocrinology 126 2919–2926.
Vankelecom H, Andries M, Billiau A & Denef C 1992 Evidence that folliculo-stellate cells mediate the inhibitory effect of interferon-gamma on hormone secretion in rat anterior pituitary cell cultures. Endocrinology 130 3537–3546.
Wall L, Burke F, Smyth JF & Balkwill F 2003 The anti-proliferative activity of interferon-gamma on ovarian cancer: in vitro and in vivo. Gynecologic Oncology 88 S149–S151.[CrossRef][Web of Science][Medline]
Wen Z, Zhong Z & Darnell JE Jr 1995 Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82 241–250.[CrossRef][Web of Science][Medline]
Wu AJ, Chen ZJ, Tsokos M, O'Connell BC, Ambudkar IS & Baum BJ 1996 Interferon-gamma induced cell death in a cultured human salivary gland cell line. Journal of Cellular Physiology 167 297–304.[CrossRef][Web of Science][Medline]
Yamaguchi M, Koike K, Matsuzaki N, Yoshimoto Y, Taniguchi T, Miyake A & Tanizawa O 1991 The interferon family stimulates the secretions of prolactin and interleukin-6 by the pituitary gland in vitro. Journal of Endocrinological Investigation 14 457–461.[Web of Science][Medline]
Zhong Z, Wen Z & Darnell JE Jr 1994 Stat3 and Stat4: members of the family of signal transducers and activators of transcription. PNAS 91 4806–4810.
Received in final form 5 August 2008
Accepted 19 August 2008
Made available online as an Accepted Preprint 19 August 2008
This article has been cited by other articles:
![]() |
A. J. Vangsted, T. W. Klausen, P. Gimsing, N. F. Andersen, N. Abildgaard, H. Gregersen, and U. Vogel A polymorphism in NFKB1 is associated with improved effect of interferon-{alpha} maintenance treatment of patients with multiple myeloma after high-dose treatment with stem cell support Haematologica, September 1, 2009; 94(9): 1274 - 1281. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |