| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 The Research Institute for Children, Children's Hospital, 200 Henry Clay Avenue, Research and Education Building, Room 2211, New Orleans, Louisiana 70118, USA2 Departments of Pediatrics and Genetics, Louisiana State University Health Sciences Center, New Orleans, Louisiana 70112, USA
(Correspondence should be addressed to M S Lan; Email: mlan{at}chnola-research.org)
(H-W Wang is now at Section of Endocrinology, School of Medicine, The University of Chicago, Chicago, Illinois 60637, USA) 
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionDeclaration of InterestReferences |
|---|
50% of insulin message in human islets. The mechanism for transcriptional repression of the insulin gene by INSM1 is mediated through the recruitment of cyclin D1 and histone deacetylase-3 to the insulin promoter. Anti-INSM1 or anti-cyclin D1 morpholino treatment of fetal mouse pancreas enhances the insulin promoter activity. These data strongly support the view that INSM1 is a new zinc-finger transcription factor that modulates insulin gene transcription during early pancreas development. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDeclaration of InterestReferences |
|---|
The INSM1 gene encodes a 58 kDa protein that contains five zinc-finger DNA-binding motifs, originally isolated from a human insulinoma subtraction library (Goto et al. 1992). The expression pattern is restricted to the fetal pancreas, fetal nervous system, and in tumors of neuroendocrine origin (Xie et al. 2002, Zhu et al. 2002, Breslin et al. 2003). Functional studies have revealed that the amino terminus of the INSM1 protein possesses repressor activity and that the zinc-finger motifs recognize the conserved target sequence, 
, which is located in the promoter regions of both the NeuroD/β2 and INSM1 genes (Breslin et al. 2002, Liu et al. 2006). In vitro induction of AR42J amphicrine cells and normal human ductal epithelial cells induction into insulin-producing cells suggested that INSM1's gene expression is closely associated with the expression of islet-specific transcription factors and it was shown to be an immediate downstream the target gene of neurogenin3 (Ngn3; Zhu et al. 2002, Mellitzer et al. 2006, Breslin et al. 2007). Global INSM1 mutant mice revealed that INSM1 plays an essential role for the development of both pancreatic β-cells and intestinal endocrine cells (Gierl et al. 2006).
An INSM1-binding site in the insulin promoter region was identified in this study, suggesting that insulin could be a target gene of the INSM1. This INSM1-binding site is highly conserved among humans, rats, and mice. EMSA and reporter gene transfection analyses of rat and mouse insulin promoters (MIP) support that the INSM1 protein binds and suppresses insulin promoter activity. The occupancy of the INSM1 transcription factor on the insulin promoter sequence was confirmed by the chromatin immunoprecipitation (ChIP) assay. It was also shown that overexpression of INSM1 in human islets could directly downregulate the insulin gene message, whereas INSM1 anti-sense treatment of embryonic mouse pancreas increased insulin promoter activity. These results strongly support its negative regulatory role in insulin gene transcription. Furthermore, the mechanism for transcriptional repression of the insulin gene by INSM1 is mediated through the recruitment of cyclin D1 and histone deacetylase-3 (HDAC-3) to the insulin promoter.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDeclaration of InterestReferences |
|---|
Insulinoma (MIN6, HIT, and RIN) and HeLa cell lines were obtained from the American Type Culture Collection (Manasas, VA, USA) and maintained as described by the protocol. βTC-1 cells were kindly provided by Dr E H Leiter (Jackson Laboratory, Bar Harbor, ME, USA). The mouse or rabbit anti-cyclin D1, anti-HDAC-3, and anti-Flag antisera were obtained from Biosource (Camarillo, CA, USA), Upstate (Lake Placid, NY, USA), and Sigma respectively. A mouse anti-INSM1 monoclonal antibody (6-1-1) was generated against the carboxyl-terminal peptide of the INSM1 protein. Recombinant adenoviral vectors were constructed as described (Liu et al. 2006).
EMSA
EMSA was performed using two copies of double-strand oligo spanning the –64 to –47 bp region of the rat insulin I promoter (containing INSM1-binding site), 5'-AAAGTCCAGGGGGCAGAG-3', and the complementary strand. The double-stranded oligo was end-labeled using [
-32P]ATP (3000 Ci/mmol, Perkin Elmer Life Sciences) and T4 polynucleotide kinase (New England Biolabs, Beverly, MA, USA). The INSM1 carboxyl-terminal peptide (Cpep, aa 257–510) was synthesized using a pGBKT7-Cpep vector and the TNT coupled rabbit reticulocyte lysate kit (Promega). The synthesis of Cpep was confirmed by western blot analysis using an anti-Cpep antibody (6-1-1). Nuclear extracts from cultured cell lines were prepared as described (Dignam et al. 1983). The EMSA reaction condition was described previously (Liu et al. 2006). Competitive EMSA was performed using unlabeled cold probe, random probe, or mutant probe.
Construction of rat insulin I and II promoter mutants
The rat insulin I (–410 to +50 bp; accession number, J00747) and insulin II promoters (–792 to –4 bp; accession number, J00748) were PCR amplified from rat genomic DNA. The amplified sequences were confirmed by sequence analysis and cloned into a pGL3-Basic vector (Promega) for promoter-driven luciferase assay. The INSM1-binding site on the rat insulin I/II promoters, 
, was mutated into 
using PCR primers, PInI-1, GATCGGTACCTGAGCTAAGAATCCA; PInI-2, GATCAGATCTACATACCTGCTTGCT; PInI-3, CGGCAAAGTCCAGATGGCAGAGAGGA; PInI-4, TCCTCTCTCTGCCATCTGGACTTTGCCG; PInII-1, GATCGGTACCCCCAACCACTCCAAGTGG; PInII-2, GATCCTCGAGGGTTACTGAATCCCAC; PInII-3, AAACAGCAAAGTCCAGATGTCAGGGG; and PInII-4, CCCCTGACTACTGGACTTTGCTGTTT. The mutant rat insulin I and II promoters were confirmed by sequence analysis and subcloned into the pGL3-Basic vector for promoter-driven luciferase assays. Three copies of the INSM1-binding site derived from the insulin promoter were subcloned in front of the E1bTATA basic promoter and the luciferase gene.
Transient transfection and insulin promoter assays
The rat insulin promoter driven luciferase vector (1.0 µg), rInIp or rInIIp (I: –410/+50 bp; II: –792/–4 bp), was transfected into a 70% confluent rat insulinoma cell line, RIN, in the presence or absence of CMV-INSM1 (pcDNA3-INSM1) (0.5 µg). An empty pcDNA3 vector was also included to ensure that each transfection had an equal amount of DNA. A CMV-β-galactosidase construct (0.5 µg) was used as an internal control to normalize transfection efficiency. Twenty-four hours post-transfection, the cells were washed with PBS and collected for luciferase and β-galactosidase assays (Promega). Each experiment was performed at least six times, and the results represent the average of six times±S.E.M. For rat insulin I/II promoter mutants (rInIpm and rInIIpm), three insulinoma cell lines, MIN (mouse), RIN (rat), and HIT (hamster), and HeLa cells were used. The wild-type rat insulin I/II promoter activities were designated as 100% and the mutant promoter activities were expressed as fold relative to wild-type activity. Each experiment was performed at least six times, and the results represent the average of six times±S.E.M.
Co-immunoprecipitation and western blot analysis
Insulinoma cell line, βTC-1, was transduced with Flag-tag Ad-INSM1 (m.o.i. 50:1). The transduced cells were harvested 48 h post-transduction. Cell lysates were prepared with a protein-binding buffer (20 mM Tris–Cl (pH 7.5), 150 mM NaCl, 0.5% NP-40, 0.1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride). For co-immunoprecipitation, 300 µg cell lysates were pre-cleared with rProtein G-Agarose, and incubated for 2 h at 4 °C with anti-cyclin D1, anti-Flag, or normal control IgG antibody, followed by incubation for 1 h at 4 °C with rProtein G-Agarose beads. The beads were washed 5x with a binding buffer, separated on 10% SDS-PAGE, and transblotted onto a nitrocellulose membrane (Invitrogen). INSM1, cyclin D1, and HDAC-3 were detected by western blotting (1:1000) with each antibody. The horseradish peroxidase (HRP)-conjugated anti-rabbit or anti-mouse secondary antibody (1:4000) and chemiluminescent substrate (Pierce, Rockford, IL, USA) was used for detection.
ChIP assay
ChIP assays were performed in βTC-1, mouse fetal pancreas, and Ad-INSM1 transduced human islets. A ChIP assay kit (Upstate) was used and the procedures were followed as described (Liu et al. 2006). A mouse monoclonal antibody (6-1-1) to INSM1, anti-HDAC-3 (Biosource), anti-Flag (Sigma), and anti-acetyl-H3/H4 antibodies (Upstate) were used in ChIP assays. The PCR primers used to detect target sequences were as follows: mouse insulin II (forward) 5'-ACCTAGCACCAGGGAAGTGTTT-3'; (reverse) 5'-ATAGACCAAAGCACCTCCTCT-3', (132 bp); human insulin (forward) 5'-TGAGGAAGAGGTGCTGACGA-3'; (reverse) 5'-CCTCTTCTGATGCAGCCTGT-3' (225 bp); and phosphoenolpyruvate carboxykinase (PCK) (forward) 5'-GAGTGACACCTCACAGCTGTGG-3'; (reverse) 5'-GGCAGGCCTTTGGATCATAGCC-3' (339 bp) used as a control.
Northern blot and real-time RT-PCR analysis of Ad-INSM1-transduced human islets
Fresh human islets (5000 IEQs, 95% purity) obtained from Islet Cell Resources (City of Hope SC-ICR Center, Duarte, CA, USA) was transduced with either Ad-INSM1 (100:1 m.o.i.) or Ad-LacZ (100:1 m.o.i.) for 48 h. Total RNA was isolated using Trizol reagent (Invitrogen). Total RNA (20 µg) was separated on a formaldehyde denaturing gel, transblotted, and subjected to northern blot analysis. INSM1 and glyceraldehyde-3-phosphate dehydrogenase probes were random primer labeled using 
-32P-dCTP (Perkin–Elmer Life Sciences, Waltham, MA, USA). The same blot was stripped and re-hybridized with each probe. The insulin message was determined by quantitative real-time RT-PCR. First-strand cDNA was prepared from 5 µg total RNA with the SuperScript II RT kit (Invitrogen). One-tenth of the cDNA was used as a template with IQ SYBRgreen supermix (Bio-Rad) for PCR. The expression level of the insulin gene was corrected for that of the β-actin housekeeping gene. The human insulin primers are as follows: (forward) 5'-CCTTGTGAACCAACACCTG-3', (reverse) 5'-GTAGAAGAAGCCTCGTTCCC-3' (80 bp) and human β-actin primers are (forward) 5'-CTGTACGCCAACACAGTGCT-3', (reverse) 5'-GCTCAGGAGGAGCAATGATC-3' (127 bp). Three batches of human islets were received from ICR for these studies.
Morpholino treatment of MIP-enhanced green fluorescence protein (MIP-EGFP) fetal pancreas
Fetal pancreata were harvested from E16 day MIP-EGFP transgenic mice obtained from the Jackson Laboratory (Hara et al. 2003). Each fetal pancreas was cultured in Costar 96-well black opaque plate. The culture was incubated in DMEM (10% FBS and penicillin/streptomycin) supplemented with INSM1 anti-sense (5'-GCATGTTGGCGCGGTGAAAAGGGCG-3'), cyclin D1 anti-sense (5'-GCAGCACAGGAGCTGGTGTTCCATG-3'), or inverted INSM1 control (5'-GCGGGAAAAGTGGCGCGGTTGTACG-3') morpholino oligonucleotides (25 µM) (Gene Tools, LLC) and partial medium changes were performed after 24 h. The fluorescence signal was read at different time points using a BIO-TEK fluorimeter at excitation 485/20 and emission 528/20. The experiments were repeated three times using embryos from different pregnant mice.
Statistical analysis
Statistical analysis was performed using the Student's t-test for unpaired comparisons. Data are presented as means±S.E.M.; P<0.05 was considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDeclaration of InterestReferences |
|---|
The INSM1 protein consists of 510 amino acid residues with five zinc-finger DNA-binding motifs at the carboxyl terminus (Goto et al. 1992). A selected and amplified binding site selection strategy was used to identify the INSM1 consensus DNA-binding site, 
(Fig. 1) (Breslin et al. 2002). By searching the eukaryotic promoter GenBank database, a potential INSM1-binding site was found at the proximal region of the insulin gene promoter. This potential INSM1-binding site is highly conserved in human, rat, and mouse insulin genes (Fig. 1). In order to determine whether the INSM1 protein can bind to the INSM1-binding site within the insulin gene promoter, we used an in vitro synthesized carboxyl terminus of INSM1 (Cpep, 257–510 amino acid residues) protein or nuclear extracts isolated from insulinoma cells (INSM1-positive) or NIH3T3 (INSM1-negative), and a probe (–47/–64 bp) spanning the rat insulin I promoter region in an EMSA study. As shown in Fig. 1A, a band shift was seen with the Cpep lysate. This band was super-shifted by an INSM1 antibody, but not with the normal IgG control demonstrating a specific protein–DNA interaction. Competition experiments demonstrated that the binding of the Cpep lysate and insulin promoter probe can be abolished by increasing the unlabeled cold probe concentration. A similar EMSA using the nuclear extracts isolated from insulinomas and NIH3T3 cells indicated that a unique shifted band and super-shifted band can also be seen with the nuclear extracts from the INSM1-positive cell line βTC-1, but not with the INSM1-negative NIH3T3 cell line (Fig. 1B). Taken together, our data support that INSM1 protein is capable of binding to the insulin promoter. To further determine whether INSM1 functions as a transcriptional repressor of the insulin gene, rat insulin promoters I (–410/+50 bp) and II (–792/–4 bp) were subcloned into a pGL3-Basic vector. These insulin promoter-driven luciferase vectors were transfected into RIN cells with or without an INSM1 expression vector. As shown in Fig. 2A, INSM1 exhibits a 40–50% repression effect on either rat insulin I or II promoter activity. To further investigate whether this inhibitory effect was mediated through the INSM1-binding site within the insulin promoter, three copies of the INSM1-binding site sequence derived from rat insulin I or mouse insulin I/II promoters were subcloned into an E1bTATA-luciferase vector. The transfection of these vectors into RIN cells with or without an INSM1 expressing vector resulted in a 40–50% repression (Fig. 2B). While comparing three-copy binding site-E1bTATA with E1bTATA alone showed slight decreases in their reporter activities suggesting that endogenous INSM1 imposed a suppression effect but no other activators affecting the same binding sequence. These results demonstrated that the INSM1-binding site is involved in the INSM1-mediated repression activity.
|
|
|
ChIP assay is designed to study protein–DNA interactions in vivo. In the previous section, we demonstrated in vitro that INSM1 binds and represses the rat insulin I/II promoter region containing an INSM1-binding site (Fig. 2). Here, ChIP assays were performed to investigate the occupancy of the mouse insulin gene promoter region by endogenous INSM1 in βTC-1 cells. βTC-1 cells were cross-linked with formaldehyde, sheared, and precipitated with anti-INSM1. As shown in Fig. 4, the mouse insulin II promoter sequence (–152/–21 bp) was selectively amplified by PCR from chromatin precipitated by anti-INSM1 antibody, but not from the chromatin precipitated by normal mouse IgG. A PCK promoter sequence was included to show the lack of INSM1 binding as a negative control. These experiments confirmed that endogenous INSM1 occupies the endogenous mouse insulin gene promoter region spanning the INSM1-binding site in βTC-1 cells. Since INSM1 is not expressed in the human adult islets, we used the Ad-INSM1-transduced human islets to show that the INSM1 protein is capable of binding to the human insulin gene promoter by ChIP assay (Fig. 4B). To demonstrate that INSM1 is actually capable of suppressing insulin gene expression, the suppression effect of INSM1 on endogenous insulin gene expression was tested by using an adenovirus overexpression system in normal human islets. Fresh human islets were transduced with Ad-LacZ or Ad-INSM1 for 48 h. Northern blot analysis showed a strong expression of the Ad-INSM1 message in contrast to the absence of endogenous INSM1. Quantitative real-time RT-PCR analyses revealed that the insulin message was suppressed by 50% in the INSM1 overexpressing islets (Fig. 4C). The suppression effect seen in the human islets is consistent with the transient transfection study using the rat insulin promoter. The suppression effect of INSM1 should change the acetylation pattern of chromatin on the insulin promoter. We further performed the ChIP assay on the Ad-INSM1 or Ad-LacZ-transduced human islets using anti-acetyl H3/H4. As shown in Fig. 4D, acetyl-H4 on the insulin promoter decreased in Ad-INSM1-transduced islets suggesting that a suppression event could occur. Since INSM1 functions as a developmental transcription factor in fetal pancreas, we performed a ChIP assay using E16 day fetal pancreas and included fetal liver as a negative control. Figure 6A shows that fetal pancreas expressing INSM1 occupies the insulin promoter in contrast to the fetal liver control.
|
|
INSM1 was shown to form a transcriptional complex with cyclin D1 and HDAC-3 (Liu et al. 2006). The molecular mechanisms of INSM1 repressor activity on the insulin gene promoter were investigated by transient transfection and co-immunoprecipitation of INSM1 and cyclin D1 in βTC-1 insulinoma cells. Figure 5A shows that the overexpression of cyclin D1 could enhance the INSM1 repression effect on the three copies of the INSM1-binding site derived from the rat insulin I promoter linked to the E1bTATA basic promoter. However, only cyclin D1 or HDAC-3 with the reporter vector showed a minor suppression effect probably due to the endogenous INSM1. The enhanced suppression effect by the overexpression of INSM1 and cyclin D1 is statistically significant, but the low magnitude of enhancement could be explained by the presence of endogenous cyclin D1. We also compared the effects of INSM1, cyclin D1, and HDAC-3 in (In)3-E1bTATA and mutant (In)3-E1bTATA reporter vectors (Fig. 5B). The wild-type promoter showed a more than 60% suppression by the INSM1–cyclin D1–HDAC-3 complex in contrast to that of the mutant promoter, which was unaffected. Figure 5C shows that overexpressed INSM1 and endogenous cyclin D1 or histone deacetylase (HDAC-3) are capable of interacting with each other using the co-immunoprecipitation method. Furthermore, anti-cyclin D1 is capable of co-precipitating HDAC-3 directly. In ChIP experiment, anti-HDAC-3 antibody successfully precipitated the endogenous HDAC-3–insulin II promoter complex, suggesting that HDAC-3 could bind to the INSM1 transcription factor to regulate insulin promoter activity (Fig. 5D). These data illustrate that INSM1, cyclin D1, and HDAC-3 constitute three important components for the transcriptional repression of the insulin gene.
|
To further clarify that INSM1 is truly involved in regulating insulin promoter activity during pancreas development, we selected a MIP-EGFP transgenic model (Hara et al. 2003). This animal model expresses the EGFP reporter under the control of mouse insulin promoter. Day E16 fetal pancreata were isolated from mice expressing MIP-EGFP. Explants were incubated with INSM1 or cyclin D1-specific anti-sense morpholino oligos to reduce INSM1 or cyclin D1 expression. An invert INSM1 oligo was used as a negative control. The anti-sense oligonucleotide technology to knock down specific gene expression in embryonic pancreas in vitro has been reported previously (Prasadan et al. 2002, Li et al. 2004, Mellitzer et al. 2006). Our study revealed that during the first 14 h of incubation, all three groups of fetal pancreas, control, anti-INSM1, and anti-cyclin D1 exhibited a burst of fluorescence signals (Fig. 6B). The control morpholino treatment showed no further increase at 24 and 38 h. By contrast, anti-INSM1 treatment showed a similar burst of fluorescence at 14 h and continued to increase steadily through the 38 h incubation. The gradual increase in the insulin promoter activity suggested that anti-INSM1 morpholino treatment alleviates the INSM1 suppression effect to the insulin promoter. Anti-cyclin D1 treatment presented a lower burst of fluorescence signal at 14 h incubation. However, a steady increase in the fluorescence signal was observed through 38 h. It is speculated that anti-cyclin D1 could not only affect the insulin promoter, but also affect the pancreas growth in general. Therefore, these results demonstrated that INSM1 and cyclin D1 are involved in insulin promoter suppression during pancreas development.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDeclaration of InterestReferences |
|---|
50%. To further address the question whether the INSM1 suppression effect to the insulin promoter is physiologically significant, we demonstrated the occupancy of INSM1 on the insulin promoter in E16 day fetal pancreas. We also employed anti-sense experiments to an MIP-EGFP-tagged embryonic mouse pancreas. The knock down of INSM1 showed a steady increase in green fluorescence signals. Thus, INSM1 is truly involved in insulin promoter suppression during pancreas development.
The transient expression patterns of INSM1 in the fetal pancreas were reported in both humans and mice (Zhu et al. 2002, Mellitzer et al. 2006). Since the INSM1 gene is silenced in the adult stage of the pancreas, it suggests that INSM1 plays a minimum role in the insulin gene regulation in mature β-cells. However, due to its close association with ngn3, NeuroD/β2, and insulin genes, its biological function cannot be ignored during the early stages of embryonic pancreatic endocrine cell development. Recently, INSM1 has been shown to be essential for pancreatic endocrine development (Gierl et al. 2006). During pancreas development, we and others have shown that INSM1 is an immediate downstream target gene of ngn3 (Mellitzer et al. 2006, Breslin et al. 2007). The differentiation of adult ductal epithelial cells by ngn3 clearly indicated that ngn3 first activates the INSM1 gene and subsequently activates NeuroD/β2. Our previous studies have shown that the NeuroD/β2 and E47 heterodimer activate the INSM1 gene (Breslin et al. 2003). Conversely, INSM1 can suppress NeuroD/β2 gene expression (Liu et al. 2006). NeuroD/β2 is a basic helix-loop-helix transcription factor that plays an essential role in β-cell development and insulin gene activation (Naya et al. 1995, 1997). These studies situate INSM1 in between ngn3 and NeuroD/β2 in pancreatic endocrine cell differentiation, generating a scenario in which ngn3 initiates the transcription regulatory cascade by first activating INSM1 gene expression, and subsequently activating the NeuroD/β2 gene (Huang et al. 2000, Mellitzer et al. 2006). When ngn3 expression becomes silenced, NeuroD/β2 continues to activate INSM1 gene expression contrary to its feedback inhibitory mechanism (Breslin et al. 2003). Therefore, INSM1 might play a pivotal role in the control of NeuroD/β2 and insulin gene expression at an early stage of endocrine cell development. Although it is unclear whether insulin gene expression during pancreas development contributes to endocrine cell differentiation, it is speculated that in the presence of INSM1 in the early stages of endocrine cell differentiation, the suppression of insulin gene transcription in premature islets could be an important event in islet maturation. Mellitzer et al. (2006) observed that knock down of the INSM1 gene in E12.5 dorsal pancreatic epithelia blocks islet cell differentiation, and results in a 40% decrease in - and β-cells, whereas the overexpression of ngn3 and INSM1 in pancreatic duct cells can enhance NeuroD/β2 and Pax-4 gene expression as compared with ngn3 alone. The discrepancy between decreasing the - and β-cells versus increasing the insulin promoter activity through morpholino treatment could be explained by the fact that our study is directly measuring insulin gene expression instead of - and β-cell differentiation. It is most likely that either reduction or enhancement of INSM1 gene expression could disturb normal pancreatic endocrine cell differentiation, which subsequently affects mature islet cell formation. Consistently, INSM1 gene ablation results in a dramatic decrease in pancreatic β-cells (Gierl et al. 2006). All of these observations suggest that INSM1 should contribute greatly to pancreatic endocrine cell development. Overall, INSM1 not only plays a role as a transient negative regulator of NeuroD/β2, insulin, and its own gene expression, but is also required for endocrine cell differentiation.
The primary function of cyclin D1 is to initiate cell cycle progression by association with cyclin-dependent kinase 4 (CDK4) resulting in the phosphorylation of the Rb protein. Phosphorylation of the Rb protein disrupts its association with E2F, allowing transcriptional activation of S-phase genes. Additionally, cyclin D1 displays CDK4-independent roles in transcriptional regulation (Coqueret 2002). Cyclin D1 inhibits the transcriptional activation of multiple transcription factors and nuclear receptors (Skaper et al. 1996, Ganter et al. 1998, Inoue & Sherr 1998, Adnane et al. 1999, Knudsen et al. 1999, Bienvenu et al. 2001, Lin et al. 2002, Ratineau et al. 2002, Fu et al. 2005a). The co-repressor activities of cyclin D1 were shown by us and others to be closely associated with the recruitment of HDACs (Lin et al. 2002, Fu et al. 2005a, Liu et al. 2006). By contrast, cyclin D1 could also display inhibition to transcriptional activation by association with the histone acetyltransferase p300 (Ratineau et al. 2002, Fu et al. 2005b). In our previous studies, we have demonstrated that INSM1 interacts with cyclin D1 to recruit HDACs to form a transcriptional repressor complex on the NeuroD/β2 gene (Liu et al. 2006). It is conceivable that INSM1 exercises its repression effect upon the insulin gene through a similar mechanism. We performed transient transfection, co-immunoprecipitation, and ChIP assays in insulinoma cells to demonstrate that cyclin D1 cooperates with INSM1 to enhance its repression effect, and that INSM1 is capable of immunoprecipitating endogenous cyclin D1 and HDAC-3. Furthermore, anti-HDAC-3 antibody precipitates the transcriptional complex with the mouse insulin II promoter sequence in βTC-1 cells. A transcriptional complex of INSM1–cyclin D1–HDAC-3 is situated on the insulin gene promoter to confer the repression effect.
In summary, a unique INSM1-binding site in the insulin promoter that downregulated insulin gene transcription, was identified. The repression effect of INSM1 is mediated through the recruitment of cyclin D1 and HDAC-3. These studies demonstrate that INSM1 could be a negative regulator for insulin gene during early endocrine pancreas development.
|
Declaration of Interest |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDeclaration of InterestReferences |
|---|
|
Funding |
|---|
|
Acknowledgements |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDeclaration of InterestReferences |
|---|
Bienvenu F, Gasean H & Coqueret O 2001 Cyclin D1 represses STAT3 activation through a CDK4-independent mechanism. Journal of Biological Chemistry 276 16840–16847.
Breslin MB, Zhu M, Notkins AL & Lan MS 2002 Neuroendocrine differentiation factor, IA-1, is a transcriptional repressor and contains a specific DNA-binding domain: identification of consensus IA-1 binding sequence. Nucleic Acids Research 30 1038–1045.
Breslin MB, Zhu M & Lan MS 2003 NeuroD1/E47 regulates the E-box element of a novel zinc-finger transcription factor, IA-1, in developing nervous system. Journal of Biological Chemistry 278 38991–38997.
Breslin MB, Wang HW, Pierce A, Aucoin R & Lan MS 2007 Neurogenin 3 recruits CBP co-activator to facilitate histone H3/H4 acetylation in the target gene INSM1. FEBS Letters 581 949–954.[CrossRef][Web of Science][Medline]
Brink C 2003 Promoter elements in endocrine pancreas development and hormone regulation. Cellular and Molecular Life Sciences 60 1033–1048.[Web of Science][Medline]
Campbell SC, Cragg H, Elrick LJ, Macfarlane WM, Shennan KIJ & Docherty K 1999 Inhibitory effect of Pax4 on the human insulin and islet amyloid polypeptide (IAPP) promoters. FEBS Letters 463 53–57.[CrossRef][Web of Science][Medline]
Cissell MA, Zhao L, Sussel L, Henderson E & Stein R 2003 Transcription factor occupancy of the insulin gene in vivo. Journal of Biological Chemistry 278 751–756.
Coqueret O 2002 Linking cyclins to transcriptional control. Gene 299 35–55.[CrossRef][Web of Science][Medline]
Dignam JD, Lebovitz RM & Roeder RG 1983 Accurate transcription initiation by RNA polymeraseII in a soluable extract from isolated mammalian nuclei. Nucleic Acids Research 11 1475–1489.
Fu M, Rao M, Bouras T, Wang C, Wu K, Zhang X, Li Z, Yao TP & Pestell RG 2005a Cyclin D1 inhibits PPARr-meidated adipogenesis through HDAC recruitment. Journal of Biological Chemistry 280 16934–16941.
Fu M, Wang C, Rao M, Wu X, Bouras T, Zhang X, Li Z, Jiao X, Yang J, Li A et al. 2005b Cyclin D1 represses p300 transactivation through a cyclin-dependent kinase-independent mechanism. Journal of Biological Chemistry 280 29728–29742.
Ganter B, Fu S & Lipsick JS 1998 D-type cyclins repress transcriptional activation by the v-Myb but not the c-Myb DNA-binding domain. EMBO Journal 17 255–268.[CrossRef][Web of Science][Medline]
German MS, Wang J, Chadwick RB & Rutter WJ 1992 Synergistic activation of the insulin gene by a LIM-homeodomain protein and a basic helix-loop-helix protein: building a functional insulin minienhancer complex. Genes and Development 6 2165–2176.
Gierl MS, Karoulias N, Wende H, Strehle M & Birchmeier C 2006 The Zinc-finger factor Insm1 (IA-1) is essential for the development of pancreatic beta cells and intestinal endocrine cells. Genes and Development 20 2465–2478.
Goto Y, DeSilva MG, Toscani A, Prabhakar BS, Notkins AL & Lan MS 1992 A novel human insulinoma-associated cDNA, IA-1, encodes a protein with zinc-finger DNA-binding motifs. Journal of Biological Chemistry 267 15252–15257.
Hara M, Wang X, Kawamura T, Bindokas VP, Dizon RF, Alcoser SY, Magnuson MA & Bell GI 2003 Transgenic mice with green fluorescent protein-labeled pancreatic beta cells. American Journal of Physiology. Endocrinology and Metabolism 284 E177–E183.
Huang HP, Liu M, El-hodiri HM, Chu K, Jamrich M & Tsai MJ 2000 Regulation of the pancreatic islet-specific gene beta2 (neruoD) by neurogenin 3. Molecular and Cellular Biology 20 3292–3307.
Inoue K & Sherr CJ 1998 Gene expression and cell cycle arrest mediated by transcription factor DMP1 is antagonized by D-type cyclins through a cyclin-dependent kinase indenpendent mechanism. Molecular and Cellular Biology 18 1590–1600.
Kataoka K, Han S, Shioda S, Hirai M, Nishizawa M & Handa H 2002 MafA is a glucose-regulated and pancreatic beta-cell specific transcriptional activator for the insulin gene. Journal of Biological Chemistry 277 49903–49910.
Knudsen KE, Cavence WK & Arden KC 1999 D-type cyclins complex with the androgen receptor and inhibit its transcriptional transactivation ability. Cancer Research 59 2297–2301.
Li Z, Manna P, Kobayashi H, Spilde T, Bhatia A, Preuett B, Prasadan K, Hembree M & Gittes GK 2004 Multifaceted pancreatic mesenchymal control of epithelial lineage selection. Developmental Biology 269 252–263.[CrossRef][Web of Science][Medline]
Lin HM, Zhao L & Cheng SY 2002 Cyclin D1 is a ligand-indenpendent co-repressor for thyroid hormone receptors. Journal of Biological Chemistry 277 28733–28741.
Liu WD, Wang HW, Muguira M, Breslin MB & Lan MS 2006 INSM1 functions as a transcriptional repressor of the NeuroD.beta2 gene through the recruitment of cyclin D1 and histone deacetylase. Biochemical Journal 397 169–177.[CrossRef][Web of Science][Medline]
Matsuoka T, Zhao L, Artner I, Jarrett HW, Friedman D, Means A & Stein R 2003 Members of the large Maf transcription family regulate insulin gene transcription in islet beta cells. Molecular and Cellular Biology 23 6049–6062.
Mellitzer G, Bonne S, Luco RF, Van De Casteele M, Lenne N, Collombat P, Mansouri A, Lee J, Lan MS, Pipeleers D et al. 2006 IA-1 is Ngn3-dependent and essential for differentiation of the endocrine pancreas. EMBO Journal 25 1344–1352.[CrossRef][Web of Science][Medline]
Melloul D, Marshak S & Cerasi E 2002 Regulation of insulin gene transcription. Diabetologia 45 309–326.[CrossRef][Web of Science][Medline]
Mosley AL, Corbett JA & Ozcan S 2004 Glucose regulation of insulin gene expression requires the recruitment of p300 by the b-cell-specific transcripiton factor Pdx-1. Molecular Endocrinology 18 2279–2290.
Naya FJ, Stellrecht CM & Tsai MJ 1995 Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes and Development 9 1009–1019.
Naya FJ, Huang HP, Qiu Y, Mutoh H, DeMayo FJ, Leiter AB & Tsai MJ 1997 Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/NeuroD-deficient mice. Genes and Development 11 2323–2334.
Ohneda K, Ee H & German MS 2000a Regulation of insuln gene transcription. Seminars in Cell and Developmental Biology 11 227–233.[CrossRef]
Ohneda K, Mirmira RG, Wang J, Johnson JD & German MS 2000b The homeodomain of Pdx-1 mediates multiple protein–protein interactions in the formation of a transcriptional activation complex on the insulin promoter. Molecular and Cellular Biology 20 900–911.
Olbrot M, Rud J, Moss LG & Sharma A 2002 Identification of beta cell specific insulin gene transcription factor RIPE3b1 as mammalian MafA. PNAS 99 6737–6742.
Prasadan K, Daume E, Preuett B, Spilde T, Bhatia A, Kobayashi H, Hembree M, Manna P & Gittes GK 2002 Glucagon is required for early insulin-positive differentiation in the developing mouse pancreas. Diabetes 51 3229–3236.
Qiu Y, Guo M, Huang S & Stein R 2002 Insulin gene transcription is mediated by interactions between the p300 co-activator and Pdx-1, beta2, and E47. Molecular and Cellular Biology 22 412–420.
Qiu Y, Guo M, Huang S & Stein R 2004 Acetylation of the beta2 transcription factor by p300-associated factor is important in insulin gene expression. Journal of Biological Chemistry 279 9796–9802.
Ratineau C, Petry MW, Mutoh H & Leiter AB 2002 Cyclin D1 represses the basic helix-loop-helix transcription factor, beta2/NeuroD. Journal of Biological Chemistry 277 8847–8853.
Shieh SY & Tsai MJ 1991 Cell-specific and ubiquitous factors are responsible for the enhancer activity of the rat insulin II gene. Journal of Biological Chemistry 266 16708–16714.
Skaper SX, Rhee J, Kim PS, Novitch BG & Lassar AB 1996 Cyclin-mediated inhibition of muscle gene expression via a mechanism that is independent of pRB hyperhohsphorylation. Molecular and Cellular Biology 16 7043–7053.
Stanojevic V, Habener JF & Thomas MK 2004 Pancreas duodenum homeobox-1 transcriptional activation requires interactions with p300. Endocrinology 145 2918–2928.
Sussel L, Kalamaras J, Hartigan-O’Connor DJ, Meneses JJ, Pedersen RA, Rubenstein JLR & German MS 1998 Mice lacking the homeodomain transcription factor Nkx2.2 have diabetes due to arrested differentiation of pancreatic beta cells. Development 125 2213–2221.[Abstract]
Xie JP, Cai T, Zhang H, Lan MS & Notkins AL 2002 The zinc-finger transcription factor INSM1 is expressed during embryo development and interacts with the Cbl-associated protein. Genomics 80 54–61.[CrossRef][Web of Science][Medline]
Zhao L, Guo M, Matsuoka T, Hagman DK, Parazzoli SD, Poitout V & Stein R 2005 The islet b-cell enriched MafA activator is a key regulator of insulin gene transcription. Journal of Biological Chemistry 280 11887–11894.
Zhu M, Breslin MB & Lan MS 2002 Expression of a novel zinc-finger cDNA, IA-1, is associated with rat AR42J cells differentiation into insulin-positive cells. Pancreas 24 139–145.[CrossRef][Web of Science][Medline]
Received in final form 8 April 2008
Accepted 11 April 2008
Made available online as an Accepted Preprint 11 April 2008
This article has been cited by other articles:
|
|
 |
|
  M. S. Lan and M. B. Breslin Structure, expression, and biological function of INSM1 transcription factor in neuroendocrine differentiation FASEB J, July 1, 2009; 23(7): 2024 - 2033. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Zhang, W.-D. Liu, N. A. Saunee, M. B. Breslin, and M. S. Lan Zinc Finger Transcription Factor INSM1 Interrupts Cyclin D1 and CDK4 Binding and Induces Cell Cycle Arrest J. Biol. Chem., February 27, 2009; 284(9): 5574 - 5581. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, was mutated into 
. The mutant rat insulin I and II promoters (rInIpm and rInIIpm) were confirmed by sequence analysis and subcloned into the pGL3-Basic vector for promoter driven luciferase assay. (A) Three insulinoma cell lines and a HeLa cell line were tested for wild-type and mutant promoter activities. The mutant promoter activities were compared with wild-type promoter activities in each individual cell line. (B) The mutated rat insulin I promoter activity was examined for its response to the INSM1 suppression effect. INSM1 suppresses wild-type rat insulin I promoter (P<0.001), but not the mutant rat insulin I promoter in RIN cells. Transfections were normalized with β-gal. Each cell line was repeated at least six times. An EMSA study using cold probe (CP), random probe (RP), or mutant probe (MP) to compete with gel-shift band (arrow) show that mutant probe is no longer capable of competing with wild-type binding sequence.
