JOE Society for Endocrinology Archive
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2008) 196, 529-538       DOI: 10.1677/JOE-07-0300
© 2008 Society for Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, Z.
Right arrow Articles by Sakai, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, Z.
Right arrow Articles by Sakai, T.

Gastric leptin, but not estrogen and somatostatin, contributes to the elevation of ghrelin mRNA expression level in fasted rats

Zheng Zhao, Ichiro Sakata, Yusuke Okubo, Kanako Koike, Kenji Kangawa1 and Takafumi Sakai

Department of Regulation Biology, Faculty of Science, Saitama University, 255 Shimo-ohkubo, Sakuraku, Saitama 338-8570, Japan1 Department of Biochemistry, National Cardiovascular Center Research Institute, 5-7-1 Fujishirodai, Suita, Osaka 565-8565, Japan

(Correspondence should be addressed to T Sakai; Email: tsakai{at}mail.saitama-u.ac.jp)


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ghrelin, an endogenous ligand for the GH secretagog receptor, is predominantly produced in the stomach. It has been reported that endogenous ghrelin levels are increased by fasting and decreased after refeeding. It has also been reported that estrogen upregulates ghrelin expression and production and that somatostatin inhibits ghrelin secretion, whereas leptin has a paradoxical effect. Recently, several studies have shown that estrogen, somatostatin, and leptin are produced in the stomach, but the direct effects of these gastric hormones on ghrelin expression in a fasting state remain obscure. In this study, we examined the mRNA expression levels of gastric ghrelin, aromatase (estrogen synthetase), leptin and somatostatin, and concentrations of stomach leptin and portal vein 17β-estradiol in fasted male rats. After 48 h of fasting, although gastric ghrelin mRNA level was significantly increased, both gastric leptin mRNA level and leptin content were decreased. Further, refeeding of fasted rats resulted in a decrease in ghrelin expression level and an increase in leptin expression level. On the other hand, gastric estrogen and somatostatin levels did not change after fasting. In vitro studies revealed that leptin dose-dependently inhibited ghrelin expression and also inhibited estrogen-stimulated ghrelin expression. Moreover, ghrelin cells were found to be tightly surrounded by leptin cells. RT-PCR analysis clearly showed that long and short forms of the leptin receptor are expressed in the rat stomach. These results strongly suggest that an elevated gastric ghrelin expression level in a fasting state is regulated by attenuated restraint from decreased gastric leptin level.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ghrelin, a 28-amino acid peptide with an essential n-octanoyl modification on the third amino acid, was identified as the endogenous ligand for the growth hormone (GH) secretagog receptor (Kojima et al. 1999). Initially, ghrelin was known for its potent stimulatory action on GH secretion (Kojima et al. 1999, Yamazaki et al. 2002, Malagon et al. 2003), but later findings showed that it was also involved in the regulation of feeding behavior and energy homeostasis (Tschop et al. 2000, 2001a, Wren et al. 2000, Nakazato et al. 2001, Shintani et al. 2001). Actually, ghrelin is the primary orexigenic signal from the periphery, and it has been reported that peripheral ghrelin exerts its orexigenic effects through circulation (Cowley 2003) or by acting in the periphery to suppress gastric vagal afferents (Date et al. 2002).

Ghrelin is predominantly produced in the stomach (Kojima et al. 1999), and previous studies on the regulation of ghrelin expression and secretion therefore focused on gastric ghrelin. The most important physiological state for the regulation of gastric ghrelin synthesis is feeding. Results of many studies have shown that endogenous ghrelin levels are increased by fasting and decreased after refeeding in several species (Tschop et al. 2000, 2001b, Asakawa et al. 2001, Cummings et al. 2001, Toshinai et al. 2001), and further observations suggest that ghrelin has a role in regulation of energy homeostasis. In addition to feeding, several hormonal states have been shown to be involved in the regulation of ghrelin expression and production.

Recently, Ueyama et al. (2002) clearly demonstrated that gastric parietal cells are capable of producing and secreting a substantial amount of estrogen. Furthermore, in our latest work, we clearly demonstrated that gastric estrogen but not gonadal estrogen directly stimulated ghrelin expression and production in the rat stomach (Sakata et al. 2006). Somatostatin produced in the gastric mucosa is known to suppress secretion of several gastrointestinal hormones in a paracrine fashion, and many studies have shown that somatostatin and its analogs inhibited ghrelin secretion in both humans and rats (Barkan et al. 2003, Shimada et al. 2003, Silva et al. 2005). Moreover, reciprocal circadian rhythms in circulating ghrelin and leptin levels and antagonistic hypothalamus-mediated control of appetite by ghrelin and leptin have been revealed by several studies (Friedman & Halaas 1998, Tschop et al. 2000, Nakazato et al. 2001, Bagnasco et al. 2002); however, results of studies on the modulation of ghrelin expression and secretion by leptin are inconsistent. One group showed that leptin administration to rats for 5 days stimulated gastric ghrelin mRNA expression (Toshinai et al. 2001), whereas two other groups reported the opposite results (Asakawa et al. 2001, Kamegai et al. 2004). In humans, no effect of leptin administration on circulating ghrelin levels has been found (Chan et al. 2004). Due to these conflicting results, the regulatory role of leptin in ghrelin synthesis remains unclear. On the other hand, leptin was initially thought to be adipocyte derived (Zhang et al. 1994), and it has also been identified in various tissues, including the stomach (Bado et al. 1998). The fact that the release of gastric leptin is rapidly stimulated by food intake or cholecystokinin (CCK) treatment suggests that gastric leptin is involved in the short-term control of energy balance (Bado et al. 1998), although adipocyte leptin is known to be a long-term regulator of energy balance.

However, it is not clear whether these hormones produced in the stomach directly contribute to the elevation of ghrelin level in a fasting state. Therefore, in this study, we examined the mRNA expression levels of gastric ghrelin, aromatase (estrogen synthetase), leptin and somatostatin, and concentrations of stomach leptin and portal vein 17β-estradiol in fasted male rats, and we found an inverse relationship between gastric ghrelin and leptin levels. We hypothesized that gastric leptin contributes to the elevation of ghrelin mRNA expression level in a fasting state, and we investigated the effect of gastric leptin on ghrelin mRNA expression using minced stomach and cells isolated from gastric mucosa by a method established in our previous work (Sakata et al. 2006).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

Adult (8 weeks old) male Wistar rats weighing 250–300 g were used in this study. The rats were housed in a temperature-controlled room (23±2 °C) with a 12 h light:12 h darkness cycle (lights on 0800 h). Water and food were available ad libitum. All procedures were performed in accordance with the institutional guidelines for animal care at Saitama University.

Experimental design

Experiment 1: effects of fasting and fasting-refeeding  Rats were randomly separated into three groups: free-feeding, fasting, and fasting-refeeding groups. The free-feeding group had free access to food, the fasting group was deprived of food for 48 h, and the fasting-refeeding group was allowed ad libitum refeeding for 5 h after 48 h of fasting. All groups had free access to water. After fasting, half of rats in free-feeding or fasting group were killed under ether anesthesia, and the stomachs were quickly removed. The stomachs were opened and rinsed with 10 mM PBS (pH 7.5) for mRNA quantification, the gastric fundi were collected and stored in ISOGEN (Nippon Gene, Tokyo, Japan) at –80 °C until use; and for stomach leptin measurement, the epithelium of gastric fundus was scraped off, and then the obtained fundic mucosa weighed about 0.2 g was immediately frozen in liquid nitrogen and also stored at –80 °C until leptin assay. The other half of rats were deeply anesthetized with sodium pentobarbital (50 mg/kg i.p.), and 1 ml blood from the portal vein close to the liver was collected, centrifuged, and plasma was collected and stored at –80 °C until further measurement for 17β-estradiol concentration. After refeeding, the rats were killed under ether anesthesia, and the stomachs were also removed. Then the stomachs were opened and rinsed with 10 mM PBS, and the gastric fundi were collected and stored in ISOGEN at –80 °C until mRNA quantification.

Experiment 2: effects of somatostatin and leptin on ghrelin mRNA expression in stomach tissue culture  Overnight fasted rats were killed under ether anesthesia, and the stomachs were quickly removed. Stomach tissue culture was performed as previously described (Sakata et al. 2006). Briefly, the mucosa of the gastric fundus was minced (~1 mm3) with a sharp razor blade in phenol red-free Dulbecco's modified Eagle medium (DMEM; Life Technologie). These minced stomach tissues were then incubated with serum and phenol red-free DMEM containing 10–7 M somatostatin (Calbiochem, San Diego, CA, USA) or 10–7 M recombinant rat leptin (Sigma) or a vehicle for 12 h or with serum and phenol red-free DMEM containing increasing doses of recombinant rat leptin (10–9–10–7 M) or a vehicle for 12 h at 37 °C in humidified 95% air and 5% CO2. After incubation, these stomach tissues were collected and stored in ISOGEN at –80 °C until analysis.

Experiment 3: effect of leptin on estrogen-stimulated ghrelin mRNA expression in isolated stomach cells  Stomach cells were isolated by the enzymatic dispersion method established in our previous study (Sakata et al. 2006) with little modification. Briefly, male rats were killed under ether anesthesia, and the stomachs were quickly removed and then turned inside out. The stomachs were inflated and incubated in dispase I solution (1000 PU/ml dispase I (Godo Shusei, Tokyo, Japan), 135 mM NaCl, 5 mM KCl, 0.8 mM MgCl2, 10 mM glucose, 10 mM HEPES (DOJINDO, Kumamoto, Japan), and 0.6 mM NaHCO3 (pH 7.4)) for 1.5 h. Stomach cells were removed from gastric mucosa using a glass pipette with a diameter of ~5 mm and passed through a 102 µm filter and then collected by centrifugation at 400 g for 5 min. The pellet was suspended in medium B (135 mM NaCl, 5 mM KCl, 0.8 mM MgCl2, 10 mM glucose, 10 mM HEPES, and 0.6 mM NaHCO3 (pH 7.4)) and was stratified on 30% Percoll (Amersham Biosciences Corp.) in medium B. After centrifugation at 400 g for 5 min, the pellet was collected from the bottom of the tube and then stratified on the 40% layer on 50% Percoll medium and centrifuged again for 5 min. After centrifugation, cell solution fractioned on 50% Percoll medium was collected. These ghrelin-rich cells were resuspended in phenol red-free DMEM (Life Technologies Inc.) with 10% charcoal–dextran-treated fetal bovine serum. The cells were plated on a poly-L-lysine-coated culture dish (2.0x105 cells/ml, 5 ml/dish) and incubated in humidified 95% air and 5% CO2 at 37 °C. After preincubation for 12–16 h, the cells were washed twice with phenol red-free DMEM. Then the cells were incubated in phenol red-free DMEM with 1% charcoal–dextran-treated fetal bovine serum containing 10–7 M recombinant rat leptin and 10–5 M water-soluble 17β-estradiol (E2; Sigma) or 10–5 M water-soluble 17β-estradiol alone for 8 h in humidified 95% air and 5% CO2 at 37 °C. After 8 h of incubation, the cells were collected and stored in ISOGEN at –80 °C until use for ghrelin mRNA quantification.

Double staining

Tissue preparation for double staining  After killed under ether anesthesia, rat stomachs were quickly removed and opened along their longitudinal axes. The stomachs were then rinsed with PBS, for leptin mRNA and ghrelin double staining, the stomachs were fixed with 4% paraformaldehyde (PFA) in 50 mM phosphate buffer (PB), pH 7.4, for 24 h, and for leptin and ghrelin double immunostaining, the stomachs were fixed in bouin's solution for 24 h. The tissue blocks were dehydrated with an ascending ethanol series and xylene, and then embedded in paraplast (Oxford, Labware, MO, USA). Serial sections (5 µm in thickness) were cut and mounted on slides coated with silane (Shin-Etsu Chemicals, Tokyo, Japan).

Double staining for leptin mRNA and ghrelin  Double staining was performed by a previous reported procedure (Sakata et al. 2006) with some modification. Briefly, the sections were deparaffinized with xylene for 20 min and immersed in descending ethanol series (100, 90, 80, and 70%) for 15 s each. Then the sections were washed with PBS, treated with 32 µg/ml proteinase K for 30 min at 37 °C, and fixed with 4% PFA in 0.067 M PB (pH 7.4) for 10 min. After washing with PBS for 1 min, the sections were treated with 0.25% acetic anhydride in 0.1 M triethanolamine for 10 min, washed with PBS for 1 min, immersed in a graded ethanol series (70, 80, and 90%) for 15 s each and then immersed twice in 100% ethanol for 15 s, and dried for 20 min. Digoxigenin (DIG)-labeled antisense and sense rat leptin cRNA probes (GenBank accession no. D45862 [GenBank] , nucleotides 22–560) were synthesized using a labeling kit (Roche Diagnostics GmbH) with T7 or SP6 RNA polymerases. The probes were diluted to 1 ng/µl with hybridization buffer (50% formamide, 3xSSC, 0.12 M diethyl pyrocarbonate-treated PB (pH 7.4), 1xDenhardt's solution, 125 µg/ml tRNA, 0.1 mg/ml sonicated salmon sperm DNA, and 10% dextran sulfate) and dropped on the tissue sections. A sense RNA probe was used as a negative control. The sections were covered with Parafilm (American National Can, Chicago, IL, USA) and incubated for 16 h at 42 °C in a humid chamber. After incubation, the covers were removed, and the sections were immersed in 2xSSC containing 50% formamide at 42 °C for 30 min. The sections were then treated with TNE buffer (10 mM Tris–HCl (pH 7.6), 500 mM NaCl, and 1 mM EDTA) for 10 min and next with RNase A (1 µg/ml in TNE) for 30 min at 37 °C. The sections were immersed in TNE for 10 min at 37 °C, washed with 2xSSC for 20 min at 42 °C, and then with 0.2xSSC for 20 min twice at 42 °C. The sections were incubated for 5 min in buffer-1 (100 mM Tris–HCl (pH 7.5), 150 mM NaCl, 0.01% Tween 20), immersed in 1.5% blocking reagent (Roche Diagnostics GmbH) in buffer-1 for 1 h at 37 °C, and then washed in buffer-1 for 5 min. After washing, the sections were incubated with an alkaline phosphatase-conjugated anti-DIG antibody (Roche Diagnostics Corporation) diluted 1:1000 in buffer-1 for 1 h at 37 °C. The sections were then washed in buffer-1 for 15 min twice and in buffer-2 (100 mM Tris–HCl (pH 9.5), 100 mM NaCl, and 50 mM MgCl2) for 5 min. A chromagen solution (337 µg/ml 4-nitroblue tetrazolium chloride and 175 µg/ml 5-bromo-4-chloro-3-indolyl-phosphate in buffer-2) was added, and the sections were incubated until a visible signal was detected. The reaction was stopped by adding a reaction stop solution (10 mM Tris–HCl (pH 7.6) and 1 mM EDTA). In this study, we used Gengard water (Gradient A10, Millipore, Tokyo, Japan) as RNase-free water. After the leptin mRNA-expressing cells have been detected, immunohistochemistry for ghrelin was performed using a rabbit anti-ghrelin serum (no. 603, Department of Biochemistry, National Cardiovascular Centre Research Institute, Suita, Japan). The production and the specificity of this anti-rat ghrelin serum were previously reported, and it is known that this antiserum recognizes the N-terminal region of rat ghrelin (Hosoda et al. 2000). After washing thrice with PBS, the sections were incubated with TNBS buffer (1% normal horse serum and 0.4% Triton X-100 in PBS) for 30 min. After the second wash with PBS, the sections were incubated with anti-ghrelin serum diluted 1:10 000 in TNBS in a humid chamber for 2 h. After the third wash with PBS, the sections were incubated with Alexa594-conjugated donkey anti-rabbit IgG (Molecular Probes, Eugene, OR, USA) as a second antibody for 2 h. The sections were washed with PBS thrice, mounted with 5% DABCO containing 90% glycerol in PBS, and then viewed and photographed under a light microscope (BX60, Olympus, Tokyo, Japan).

Double-label fluorescent immunostaining for leptin and ghrelin  The sections were deparaffinized with xylene and rehydrated through descending concentrations of ethanol. Next, the sections were treated with 0.5% sodium metaperiodate to block endogenous peroxidase for 15 min at room temperature. After washing with distilled water, the sections were incubated with TNBS for 1 h and then washed thrice with PBS, incubated overnight with rabbit polyclonal antibody against leptin (Ob A20, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) diluted 1:100 (2 µg/ml) in TNBS in a humid chamber. After washing thrice with PBS, a second incubation with Alexa594-conjugated donkey anti-rabbit IgG (Molecular Probes) was carried out for 2 h, and this was followed by further washing with PBS. For ghrelin double staining, the sections were incubated with a monoclonal antibody against octanoylated (i.e., acylated) ghrelin (11F9) for 3 h, washed with PBS. After final incubation with Alexa488-conjugated donkey anti-mouse IgG (Molecular Probes) as a secondary antibody for 2 h, the sections were washed with PBS, mounted with 5% DABCO containing 90% glycerol in PBS, and then viewed and photographed under a light microscope (BX60, Olympus).

Reverse transcriptase (RT)-PCR for short and long forms of the leptin receptor (OB-R) mRNA

Total RNA was extracted from the isolated stomach cells or stomach tissues using ISOGEN according to manufacturer's instructions. Trace DNA contamination was removed by DNase digestion (Promega). cDNA was synthesized from 1 µg total RNA using Superscript III reverse transcriptase (Invitrogen) for OB-Ra and from 2 µg total RNA using Primescript reverse transcriptase (Takara, Tokyo, Japan) for OB-Rb. The following primers were designed to amplify a rat long form (OB-Rb) OB-R fragment (1131 bp; accession no. D85558 [GenBank] ): sense primer, TGGCCCATGAGTAAAGTGAA and antisense primer, CAGACAGTGAGCTGGGAATG. The following primers were designed to amplify a rat short form (OB-Ra) OB-R fragment (399 bp; accession no. AF304191 [GenBank] ): sense primer, GATGATATCGCCAAACAGCA and antisense primer, CCCAACTGAACTACATCAAACC. PCR amplification was carried out with Ex Taq polymerse (Takara) according to manufacturer's instructions. Initial template denaturation was programmed for 5 min at 94 °C. For OB-Rb, the cycle profiles were programed as follows: 1 min at 94 °C (denaturation), 1 min at 64 °C (annealing and extension), and 1 min at 74 °C (extension). Forty-five cycles of the profile were run. For OB-Ra, the cycle profiles were programed as follows: 1 min at 94 °C (denaturation), 1 min at 55 °C (annealing and extension), and 1 min at 74 °C (extension). Forty cycles of the profile were run. Then PCR products were visualized by 1% agarose gel electrophoresis for OB-Rb and 2% agarose gel electrophoresis for OB-Ra.

Quantitative RT-PCR for mRNA of ghrelin, aromatase, leptin, and somatostatin

RNA extraction and cDNA synthesis were performed as described above. The following primers were designed to amplify a rat ghrelin fragment (191 bp; accession no. AB029433 [GenBank] ): sense primer, CAGGTTCCAGCTTCTTGA and antisense primer, GACAGCTTGATGCCAACA. The following primers were designed to amplify a rat aromatase fragment (194 bp; accession no. M33986 [GenBank] ): sense primer, GGAATCCATCAAGCAGCATT and antisense primer, TGATAAGGAGTGCTTGCCAGG. The following primers were designed to amplify a rat leptin fragment (187 bp; accession no. D45862 [GenBank] ): sense primer, GAGACCTCCTCCATCTGCTG and antisense primer, CATTCAGGGCTAAGGTCCAA. The following primers were designed to amplify a rat somatostatin fragment (117 bp; accession no. M25890 [GenBank] ): sense primer, CCCAGACTCCGTCAGTTTCT and antisense primer, GGCATCGTTCTCTGTCTGGT. The following primers were designed to amplify a rat β-actin fragment (106 bp; accession no. NM031144): sense primer, TGGCACCACACTTTCTACAATGAG and antisense primer, GGGTCATCTTTTCACGGTTGG. Real-time quantitative PCR was performed using SYBR Premix Ex Taq (TakaraBIO, Shiga, Japan) according to manufacturer's instructions. Amplification reactions were performed using a LightCycler (Roche Diagnostics). Initial template denaturation was performed for 30 s at 95 °C. The cycle profiles were programed as follows: for ghrelin, β-actin, and somatostatin, 5 s at 95 °C (denaturation) and 15 s at 60 °C (annealing and extension); for aromatase, 5 s at 95 °C (denaturation) and 20 s at 60 °C (annealing and extension); and for leptin, 5 s at 95 °C (denaturation) and 18 s at 65 °C (annealing and extension). Forty-five cycles of the profile were run, and the final cooling step was continued for 30 s at 40 °C. Quantitative measurement of each mRNA was achieved by establishing a linear amplification curve from serial dilutions of each plasmid containing the amplicon sequence. The relative amount of each mRNA was normalized by the amount of β-actin mRNA. Amplicon size and specificity were confirmed by melting curve analysis and 2% agarose gel electrophoresis.

ELISA for estrogen and leptin

Estrogen ELISA  Portal vein 17β-estradiol concentration was measured using an estradiol EIA kit (Cayman Chemical Company, Ann Arbor, MI, USA) without extraction according to manufacturer's instructions. This assay is based on the competition between free estradiol and an estradiol tracer (estradiol linked to an acetylcholinesterase (AchE) molecule) for a limited number of estradiol-specific rabbit antiserum-binding sites. The 96-well plate which was pre-coated with mouse monoclonal anti-rabbit IgG was supplied by this kit. The plate was treated with estradiol AchE tracer, rabbit antiserum-estradiol, and either a series of estradiol standard diluted by EIA buffer using a concentration range of 7.8–1000 pg/ml or unknown plasma samples. The plate was then covered with plastic film and incubated for 1 h at room temperature. After incubation, the plate was washed six times with wash buffer to remove any unbound reagents and incubated with Ellman's reagent (which contains the substrate to AChE) to develop the color using an microtube mixer (orbital shaker) in the dark for 1.5 h. Then the plate was placed in a microplate reader (Bio-Rad), and the optical density was obtained at 405 nm. The detection limit is 8 pg/ml. Cross-reactivities of various steroids with the antiserum were as follows: 100% estradiol, 17% estradiol-3-glucuronide, and 4% estrone. All samples and standards were prepared in duplicate.

Leptin ELISA

Fundic mucosa was homogenized at 4 °C in 1:5 (w/v) of a Krebs–Ringer bicarconate–HEPES solution (129 mM NaCl, 5 mM NaHCO3, 4.8 mM KCl, 1.2 mM KH2PO4, 1.0 mM CaCl2, 1.2 mM MgSO4, 0.1% BSA, 10 mM HEPES, and 2.8 mM glucose (pH 7.4)) using a Teflon/glass homogenizer. The homogenate was centrifuged at 10 000 g for 10 min at 4 °C, and the resulting supernatant was used for leptin measurement. Leptin concentration in fundic homogenate was measured with a Quantikine mouse leptin ELISA kit (R&D Systems, Minneapolis, MN, USA). This kit also recognizes rat leptin well and has been validated to determine the leptin concentration in the rat stomach (Pico et al. 2002). Both intra- and inter-assay precision were <8%, with a detection limit of 22 pg/ml. Some cross-reactivities were as follows: human leptin 0.24% and 79% rat leptin. All samples and standards were prepared in duplicate.

Data analysis

All of the data are expressed as means±S.E.M. The results were statistically evaluated by Student's t-test and Fisher's protected least significant difference test with Stat View statistics software (SAS Institute, Cary, NC, USA). P<0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effects of fasting and fasting-refeeding

To determine whether gastric estrogen, leptin, and somatostatin contribute to the elevation of ghrelin expression level in a fasting state, we fasted male rats for 48 h and examined the mRNA expression levels of gastric ghrelin, aromatase, leptin, and somatostatin. We also determined the stomach leptin content and portal vein 17β-estradiol concentration. As previously shown, gastric ghrelin mRNA expression level in rats that had been fasted for 48 h was about 2.5 times higher than that in fed rats (Fig. 1A). In a previous study, we found that gastric estrogen directly stimulated ghrelin expression and production (Sakata et al. 2006). In this study, however, both aromatase mRNA expression level and portal vein 17β-estradiol concentration in the fasted rats were not different from those in the fed rats (Fig. 1B and C). Somatostatin mRNA expression levels were also similar in the fasted and fed rats (Fig. 1D). In contrast, gastric leptin mRNA expression level and leptin content significantly decreased after fasting to about 47 and 36% respectively, of those in fed rats (Fig. 1E and F). Further, refeeding of fasted rats for 5 h also induced inverse changes in gastric ghrelin and leptin expression levels, a decrease in ghrelin expression level (Fig. 1A) and an increase in leptin expression level (Fig. 1E), and the expression levels of both ghrelin and leptin recovered to the levels in fed rats (Fig. 1A and E).


Figure 1
View larger version (20K):
[in this window]
[in a new window]

 
Figure 1 mRNA expression levels of gastric ghrelin, aromatase, leptin, and somatostatin measured by quantitative RT-PCR and concentrations of stomach leptin and portal vein 17β-estradiol determined by ELISA under different feeding conditions. The mRNA expression level of gastric ghrelin was significantly increased by 48 h of fasting, whereas refeeding of fasted rats for 5 h restored gastric ghrelin mRNA level to the control expression level (A). Both the mRNA expression level of gastric aromatase (B) and 17β-estradiol concentration in the portal vein (C) did not change after fasting. mRNA expression levels of somatostatin were similar in fasted and fed rats (D). The mRNA expression level of gastric leptin (E) and stomach leptin concentration (F) were significantly decreased by fasting, and 5 h of refeeding resulted in recovery of gastric leptin mRNA level to the control expression level (E). Ghrelin, aromatase, leptin, and somatostatin mRNA levels are expressed relative to β-actin mRNA levels. Data are presented as means±S.E.M. n=3–4/group. *P<0.05; **P<0.01; NS, no significant difference.

 
In vitro effects of somatostatin and leptin on ghrelin mRNA expression

To determine the direct effect of somatostatin or leptin on ghrelin mRNA expression, we investigated whether treatment of somatostatin or leptin affects ghrelin mRNA expression in minced stomach tissue or isolated stomach cells. In the minced stomach tissue, somatostatin at a dose of 10–7 M suppressed ghrelin mRNA expression, although this effect was not statistically significant (Fig. 2A); on the other hand, leptin significantly inhibited ghrelin mRNA expression level in a dose-dependent manner (10–9–10–7 M; Fig. 2B). Using a previously established method (Sakata et al. 2006), we obtained a ghrelin cell-rich fraction from gastric mucosa. We treated these cells with estrogen alone or estrogen combined with leptin and found that ghrelin mRNA expression level was significantly increased by estrogen treatment as in our previous study, whereas this effect was significantly reversed by leptin pre-treatment (Fig. 2C).


Figure 2
View larger version (10K):
[in this window]
[in a new window]

 
Figure 2 In vitro effects of somatostatin and leptin on ghrelin mRNA expression levels. Effects of somatostatin (10–7 M) and leptin (10–7 M) on ghrelin mRNA expression levels in minced stomach tissue (A). Leptin significantly inhibited ghrelin mRNA expression in a dose-dependent manner in minced stomach tissue (B). Estrogen at a dose of 10–5 M significantly stimulated ghrelin mRNA expression in isolated stomach cells, but this effect was completely abolished by leptin treatment at a dose of 10–7 M (C). sst, somatostatin; est, estrogen; and lep, leptin. Ghrelin mRNA level is expressed relative to β-actin mRNA level. Data are presented as means±S.E.M. n=3–4/group. *P<0.05; **P<0.01; NS, no significant difference.

 
Distribution of leptin and ghrelin cells in the stomach

Both leptin mRNA-expressing cells detected by in situ hybridization (Fig. 3A) and leptin-immunopositive cells (leptin-ip cells; Fig. 3D) were mainly located in the lower half of the fundic gland. No signals were detected by in situ hybridization in the negative control section (sense probe; Fig. 3A, inset). Ghrelin-ip cells were observed throughout the gastric mucosa (Fig. 3B and E), and leptin mRNA-expressing cells or leptin-ip cells were adjacent to ghrelin-ip cells, some ghrelin-ip cells being closely surrounded by leptin-expressing or leptin-ip cells or in direct contact with them (Fig. 3C and F).


Figure 3
View larger version (47K):
[in this window]
[in a new window]

 
Figure 3 Double staining of leptin mRNA-expressing cells and ghrelin-immunopositive (ip) cells (A–C) and leptin- and ghrelin-ip cells (D–F). Both leptin mRNA-expressing cells (A) and leptin-ip cells (D) were found in the lower half of the fundic gland, and no signals were detected by in situ hybridization in the negative control section (sense probe; A, inset). Ghrelin-ip cells were found to be randomly scattered in the gastric mucosa (B and E). Leptin mRNA-expressing cells (C, blue, arrows) and leptin-ip cells (F, red, arrows) were adjacent to ghrelin-ip cells (C, pink, arrowheads and F, green, arrowheads), and some ghrelin-ip cells were closely surrounded by leptin-expressing or leptin-ip cells or in direct contact with them (C and F). Scale bar=200 µm (A, A inset, B, D and E) and 20 µm (C and F) respectively. MU, mucosa and SL, smooth muscle layer.

 
RT-PCR analysis of OB-Ra and OB-Rb mRNA expression

RT-PCR analysis clearly demonstrated that mRNAs of both OB-Ra (Fig. 4A) and OB-Rb (Fig. 4B) were expressed in whole stomach tissue and isolated stomach cells.


Figure 4
View larger version (29K):
[in this window]
[in a new window]

 
Figure 4 RT-PCR of OB-Ra and OB-Rb mRNA. Both (A) OB-Ra and (B) OB-Rb mRNAs were expressed in the stomach and isolated cells. Lane 1 (A and B), wide-range DNA ladder; lane 2 (A and B), stomach tissue (gastric fundus); lane 3 (A and B), ghrelin-rich isolated stomach cell fraction; and lane 4 (A and B), negative control (distilled water). Expected sizes for PCR products: 399 bp for OB-Ra and 1131 bp for OB-Rb.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results of our previous study showing a stimulatory effect of gastric estrogen on both ghrelin expression and production (Sakata et al. 2006) prompted us to further investigate the regulation of ghrelin synthesis by gastric estrogen under various physiological conditions including fasting, a negative energy balance state. In the present study, however, neither the expression level nor the secretion level of gastric estrogen was altered by fasting, although the expression level of ghrelin mRNA was significantly increased as predicted. The lack of response of gastric estrogen to fasting may be due to the minor role of estrogen in short-term regulation of feeding and does not support the idea that gastric estrogen is a major contributor to fasting-induced increase in gastric ghrelin expression. Meanwhile, although our in vitro study revealed an inhibitory effect of somatostatin on ghrelin expression, the expression level of somatostatin mRNA in the gastric fundus was also not changed by fasting. Interestingly, this result is similar to that of a previous study showing that fasting reduced antral but not fundic somatostatin mRNA level (Yamada et al. 1997). These findings clearly support the hypothesis that in a fasting state somatostatin is involved in the regulation of antral ghrelin rather than fundic ghrelin, which is the major source of ghrelin.

On the other hand, results of several studies have shown that leptin mRNA levels in the stomach and adipocytes and levels of gastric and circulating leptin are decreased by fasting in rats (Frederich et al. 1995, Pico et al. 2002). In accordance with these findings, both gastric leptin mRNA and leptin levels were found to be significantly decreased by fasting in the present study. However, another study revealed that fasting only produced a slight but not significant decrease in gastric leptin (Bado et al. 1998). This discrepancy can be attributed to the different fasting durations used in two studies, 18 h in the earlier study and 48 h in our study. Actually, gastric ghrelin mRNA level also did not change in rats that had been fasted for 24 h (data not shown). Indeed, an inverse pattern was also observed between circulating ghrelin and leptin levels in response to fasting (Sanchez et al. 2004). Since opposing effects of circulating ghrelin and leptin on appetite control via NPYergic signaling in the arcuate nucleus–paraventricular nucleus (ARC–PVN) axis of the hypothalamus have been revealed by many studies (Friedman & Halaas 1998, Tschop et al. 2000, Nakazato et al. 2001), under a fasting condition, enhanced stimulation by ghrelin concomitant with attenuated restraint from leptin on NPYergic signaling must directly contribute to the robust feeding and energy saving. It has been reported that both decreases in body fat content and circulating insulin level contribute to the suppression of circulating leptin level in a fasting state (Weigle et al. 1997). Although the mechanism of reduction in gastric leptin level under a fasting condition remains unknown, one could assume that this fasting-induced decrease in gastric leptin level would enable gastric leptin to exert regulatory effects on energy saving and food intake by indirectly activating nerve endings on gastric and intestine mucosa or by directly modulating gastrointestinal hormone secretion in a paracrine or endocrine manner. Therefore, the inverse relationship between gastric ghrelin and leptin levels led us to hypothesize that the elevation of gastric ghrelin expression level in a fasting state is mediated by decreased gastric leptin level. Moreover, in the present study, the expression of gastric ghrelin and that of leptin also showed opposite responses to refeeding, i.e., reduced ghrelin mRNA level and increased leptin mRNA level, indicating a similar role of gastric leptin in regulating ghrelin expression under the refeeding condition. To test this hypothesis, we studied whether leptin directly regulates ghrelin mRNA expression in vitro and found that leptin treatment inhibited ghrelin mRNA expression in minced stomach tissue in a dose-dependent manner and also inhibited estrogen-stimulated ghrelin mRNA expression in isolated stomach cells. Consistent with results of several studies (Wang et al. 1996, Mix et al. 2000, Sobhani et al. 2000), our RT-PCR analysis clearly showed that mRNA of both OB-Ra and OB-Rb was expressed in the gastric fundus, indicating a role of the leptin receptor in leptin-induced suppression of ghrelin expression. Further detection of the expression of leptin receptors on ghrelin-producing cells will probably help to confirm this. Moreover, we revealed that leptin-producing cells were mainly located in the lower half of the gastric mucosa, where most of the ghrelin cells were tightly surrounded by leptin-producing cells, suggesting that gastric leptin has a paracrine role in regulation of ghrelin cells and that ghrelin cells may be exposed to a higher concentration of gastric leptin than that of plasma leptin since leptin infusion at 0.1 nM, which can mimic the plasma leptin concentration under basal conditions in rats, has been shown to be incapable of suppressing ghrelin release from the isolated rat stomach (Kamegai et al. 2004).

Our present findings support the idea that gastric leptin directly suppresses ghrelin expression in the rat stomach and that elevation of gastric ghrelin expression level in a fasting state is mediated by decreased gastric leptin level. Several lines of evidence support this hypothesis. In zucker fatty (fa/fa) rats, an animal model that is characterized by a lack of leptin signaling due to a default in the leptin receptor, both mRNA level of ghrelin in the stomach and circulating ghrelin level have been shown to be augmented (Beck et al. 2003, 2004). Moreover, fasting of young zucker fatty rats for 48 h induced only a slight increase in circulating ghrelin level, which was significantly lower than that in lean control rats, and even no change in circulating ghrelin levels has been shown in older fatty rats after fasting (Ariyasu et al. 2002). It should be noted that the synthesis of ghrelin in the stomach is also positively regulated by gastric estrogen and negatively regulated by gastric somatostatin. Therefore, the following regulatory model of the elevated expression level of ghrelin in a fasting state can be proposed. Under a basal (fed) condition, the expression of ghrelin is maintained at a certain level due to a balance between positive regulation from gastric estrogen and negative regulation from gastric leptin and somatostatin. Under a fasting condition, when fasting suppresses gastric leptin level with no change in gastric estrogen and somatostatin levels, this balance is broken by attenuated negative regulation due to decreased gastric leptin level and finally results in increased ghrelin expression. This model does not, however, exclude the involvement of other factors such as neural control through the vagal nerve system or hormones outside the stomach such as insulin, but an elevated gastric ghrelin expression level in a fasting state is due at least in part to attenuated restraint by decreased gastric leptin level. Further studies are needed to determine the regulatory mechanisms of leptin produced in the stomach in a fasting state. Insulin has been shown to stimulate the secretion of gastric leptin, but this effect is dependent on the integrity of the vagal nerve system (Sobhani et al. 2002). It has been reported that decreased plasma insulin level is involved in suppression of circulating leptin level in a fasting state (Weigle et al. 1997). Another study further revealed that withdrawal of insulin from adipose cells results in a dramatic decrease in leptin mRNA content (Leroy et al. 1996). These findings strongly support the possible contribution of insulin to fasting-induced reduction in gastric leptin level. It would also be interesting to investigate the changes in estrogen, leptin, and somatostatin in relation to ghrelin in the stomach in other physiological states.

In summary, the present study is the first to demonstrate that leptin produced in the stomach directly suppresses ghrelin expression in the rat stomach and that elevation of gastric ghrelin expression level in a fasting state is mediated at least in part by decreased gastric leptin level. The findings of the present study provide new evidence on how ghrelin expression is regulated in a fasting state and shed new light on the physiological interaction of ghrelin and leptin in the periphery. These results may have implications in the control of high ghrelin levels in some negative energy balance states, which may directly contribute to increased food intake and adiposity.


    Acknowledgements
 
This work was supported in part by a grant from Saitama University Innovative Research Organization and by the Program for Promotion of Fundamental Studies in Health Sciences of the National Institute of Biomedical Innovation (NIBIO). The authors declare that there is no conflict of interest that would prejudice the impartiality of this research work.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ariyasu H, Takaya K, Hosoda H, Iwakura H, Ebihara K, Mori K, Ogawa Y, Hosoda K, Akamizu T, Kojima I et al. 2002 Delayed short term secretory regulation of ghrelin in obese animals: evidenced by a specific RIA for the active form of ghrelin. Endocrinology 143 3341–3350.[Abstract/Free Full Text]

Asakawa A, Inui A, Kaga T, Yuzuriha H, Nagata T, Ueno N, Makino S, Fujimiya M, Niijima A, Fujino MA et al. 2001 Ghrelin is an appetite-stimulatory signal from stomach with structural resemblance to motilin. Gastroenterology 120 337–345.[CrossRef][Web of Science][Medline]

Bado A, Levasseur S, Attoub S, Kermorgant S, Laigneau JP, Bortoluzzi MN, Moizo L, Lehy T, GuerreMillo M, LeMarchandBrustel Y et al. 1998 The stomach is a source of leptin. Nature 394 790–793.[CrossRef][Medline]

Bagnasco M, Kalra PS & Kalra SP 2002 Ghrelin and leptin pulse discharge in fed and fasted rats. Endocrinology 143 726–729.[Abstract]

Barkan AL, Dimaraki EV, Jessup SK, Symons KV, Ermolenko M & Jaffe CA 2003 Ghrelin secretion in humans is sexually dimorphic, suppressed by somatostatin, and not affected by the ambient growth hormone levels. Journal of Clinical Endocrinology and Metabolism 88 2180–2184.[Abstract/Free Full Text]

Beck B, Richy S & Stricker-Krongrad A 2003 Ghrelin and body weight regulation in the obese Zucker rat in relation to feeding state and dark/light cycle. Experimental Biology and Medicine 228 1124–1131.[Abstract/Free Full Text]

Beck B, Richy S & Stricker-Krongrad A 2004 Feeding response to ghrelin agonist and antagonist in lean and obese Zucker rats. Life Sciences 76 473–478.[CrossRef][Web of Science][Medline]

Chan JL, Bullen J, Lee JH, Yiannakouris N & Mantzoros CS 2004 Ghrelin levels are not regulated by recombinant leptin administration and/or three days of fasting in healthy subjects. Journal of Clinical Endocrinology and Metabolism 89 335–343.[Abstract/Free Full Text]

Cowley MA 2003 Hypothalamic melanocortin neurons integrate signals of energy state. European Journal of Pharmacology 480 3–11.[CrossRef][Web of Science][Medline]

Cummings DE, Purnell JQ, Frayo RS, Schmidova K, Wisse BE & Weigle DS 2001 A preprandial rise in plasma ghrelin levels suggests a role in meal initiation in humans. Diabetes 50 1714–1719.[Abstract/Free Full Text]

Date Y, Murakami N, Toshinai K, Matsukura S, Niijima A, Matsuo H, Kangawa K & Nakazato M 2002 The role of the gastric afferent vagal nerve in ghrelin-induced feeding and growth hormone secretion in rats. Gastroenterology 123 1120–1128.[CrossRef][Web of Science][Medline]

Frederich RC, Lollmann B, Hamann A, Napolitano-Rosen A, Kahn BB, Lowell BB & Flier JS 1995 Expression of ob mRNA and its encoded protein in rodents. Impact of nutrition and obesity. Journal of Clinical Investigation 96 1658–1663.[Web of Science][Medline]

Friedman JM & Halaas JL 1998 Leptin and the regulation of body weight in mammals. Nature 395 763–770.[CrossRef][Medline]

Hosoda H, Kojima M, Matsuo H & Kangawa K 2000 Ghrelin and des-acyl ghrelin: two major forms of rat ghrelin peptide in gastrointestinal tissue. Biochemical and Biophysical Research Communications 279 909–913.[CrossRef][Web of Science][Medline]

Kamegai J, Tamura H, Shimizu S, Ishii S, Sugihara H & Oikawa S 2004 Effects of insulin, leptin, and glucagon on ghrelin secretion from isolated perfused rat stomach. Regulatory Peptides 119 77–81.[CrossRef][Web of Science][Medline]

Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H & Kangawa K 1999 Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402 656–660.[CrossRef][Medline]

Leroy P, Dessolin S, Villageois P, Moon BC, Friedman JM, Ailhaud G & Dani C 1996 Expression of ob gene in adipose cells. Regulation by insulin. Journal of Biological Chemistry 271 2365–2368.[Abstract/Free Full Text]

Malagon MM, Luque RM, Ruiz-Guerrero E, Rodriguez-Pacheco F, Garcia-Navarro S, Casanueva FF, Gracia-Navarro F & Castano JP 2003 Intracellular signaling mechanisms mediating ghrelin-stimulated growth hormone release in somatotropes. Endocrinology 144 5372–5380.[Abstract/Free Full Text]

Mix H, Widjaja A, Jandl O, Cornberg M, Kaul A, Goke M, Beil W, Kuske M, Brabant G, Manns MP et al. 2000 Expression of leptin and leptin receptor isoforms in the human stomach. Gut 47 481–486.[Abstract/Free Full Text]

Nakazato M, Murakami N, Date Y, Kojima M, Matsuo H, Kangawa K & Matsukura S 2001 A role for ghrelin in the central regulation of feeding. Nature 409 194–198.[CrossRef][Medline]

Pico C, Sanchez J, Oliver P & Palou A 2002 Leptin production by the stomach is up-regulated in obese (fa/fa) Zucker rats. Obesity Research 10 932–938.[Web of Science][Medline]

Sakata I, Tanaka T, Yamazaki M, Tanizaki T, Zheng Z & Sakai T 2006 Gastric estrogen directly induces ghrelin expression and production in the rat stomach. Journal of Endocrinology 190 749–757.[Abstract/Free Full Text]

Sanchez J, Oliver P, Palou A & Pico C 2004 The inhibition of gastric ghrelin production by food intake in rats is dependent on the type of macronutrient. Endocrinology 145 5049–5055.[Abstract/Free Full Text]

Shimada M, Date Y, Mondal MS, Toshinai K, Shimbara T, Fukunaga K, Murakami N, Miyazato M, Kangawa K, Yoshimatsu H et al. 2003 Somatostatin suppresses ghrelin secretion from the rat stomach. Biochemical and Biophysical Research Communications 302 520–525.[CrossRef][Web of Science][Medline]

Shintani M, Ogawa Y, Ebihara K, Aizawa-Abe M, Miyanaga F, Takaya K, Hayashi T, Inoue G, Hosoda K, Kojima M et al. 2001 Ghrelin, an endogenous growth hormone secretagogue, is a novel orexigenic peptide that antagonizes leptin action through the activation of hypothalamic neuropeptide Y/Y1 receptor pathway. Diabetes 50 227–232.[Abstract/Free Full Text]

Silva AP, Bethmann K, Raulf F & Schmid HA 2005 Regulation of ghrelin secretion by somatostatin analogs in rats. European Journal of Endocrinology 152 887–894.[Abstract/Free Full Text]

Sobhani I, Bado A, Vissuzaine C, Buyse M, Kermorgant S, Laigneau J, Attoub S, Lehy T, Henin D, Mignon M et al. 2000 Leptin secretion and leptin receptor in the human stomach. Gut 47 178–183.[Abstract/Free Full Text]

Sobhani I, Buyse M, Goiot H, Weber N, Laigneau JP, Henin D, Soul JC & Bado A 2002 Vagal stimulation rapidly increases leptin secretion in human stomach. Gastroenterology 122 259–263.[CrossRef][Web of Science][Medline]

Toshinai K, Mondal MS, Nakazato M, Date Y, Murakami N, Kojima M, Kangawa K & Matsukura S 2001 Upregulation of ghrelin expression in the stomach upon fasting, insulin-induced hypoglycemia, and leptin administration. Biochemical and Biophysical Research Communications 281 1220–1225.[CrossRef][Web of Science][Medline]

Tschop M, Smiley DL & Heiman ML 2000 Ghrelin induces adiposity in rodents. Nature 407 908–913.[CrossRef][Medline]

Tschop M, Weyer C, Tataranni PA, Devanarayan V, Ravussin E & Heiman ML 2001a Circulating ghrelin levels are decreased in human obesity. Diabetes 50 707–709.[Abstract/Free Full Text]

Tschop M, Wawarta R, Riepl RL, Friedrich S, Bidlingmaier M, Landgraf R & Folwaczny C 2001b Post-prandial decrease of circulating human ghrelin levels. Journal of Endocrinological Investigation 24 RC19–RC21.[Web of Science][Medline]

Ueyama T, Shirasawa N, Numazawa M, Yamada K, Shelangouski M, Ito T & Tsuruo Y 2002 Gastric parietal cells: potent endocrine role in secreting estrogen as a possible regulator of gastro-hepatic axis. Endocrinology 143 3162–3170.[Abstract/Free Full Text]

Wang MY, Zhou YT, Newgard CB & Unger RH 1996 A novel leptin receptor isoform in rat. FEBS Letters 392 87–90.[CrossRef][Web of Science][Medline]

Weigle DS, Duell PB, Connor WE, Steiner RA, Soules MR & Kuijper JL 1997 Effect of fasting, refeeding, and dietary fat restriction on plasma leptin levels. Journal of Clinical Endocrinology and Metabolism 82 561–565.[Abstract/Free Full Text]

Wren AM, Small CJ, Ward HL, Murphy KG, Dakin CL, Taheri S, Kennedy AR, Roberts GH, Morgan DG, Ghatei MA et al. 2000 The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 141 4325–4328.[Abstract/Free Full Text]

Yamada H, Chen D, Monstein HJ & Hakanson R 1997 Effects of fasting on the expression of gastrin, cholecystokinin, and somatostatin genes and of various housekeeping genes in the pancreas and upper digestive tract of rats. Biochemical and Biophysical Research Communications 231 835–838.[CrossRef][Web of Science][Medline]

Yamazaki M, Nakamura K, Kobayashi H, Matsubara M, Hayashi Y, Kangawa K & Sakai T 2002 Regulational effect of ghrelin on growth hormone secretion from perifused rat anterior pituitary cells. Journal of Neuroendocrinology 14 156–162.[CrossRef][Web of Science][Medline]

Zhang Y, Proenca R, Maffei M, Barone M, Leopold L & Friedman JM 1994 Positional cloning of the mouse obese gene and its human homologue. Nature 372 425–432.[CrossRef][Medline]

Received in final form 12 November 2007
Accepted 26 November 2007
Made available online as an Accepted Preprint 26 November 2007




This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. Zheng, A. Dobner, R. Babygirija, K. Ludwig, and T. Takahashi
Effects of repeated restraint stress on gastric motility in rats
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2009; 296(5): R1358 - R1365.
[Abstract] [Full Text] [PDF]


Home page
Acta Biochim Biophys SinHome page
X. Yin, Y. Li, G. Xu, W. An, and W. Zhang
Ghrelin fluctuation, what determines its production?
Acta Biochim Biophys Sin, March 1, 2009; 41(3): 188 - 197.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, Z.
Right arrow Articles by Sakai, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, Z.
Right arrow Articles by Sakai, T.


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS