JOE Society for Endocrinology Archive
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2008) 196, 45-55       DOI: 10.1677/JOE-07-0145
© 2008 Society for Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nareika, A.
Right arrow Articles by Huang, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nareika, A.
Right arrow Articles by Huang, Y.

High glucose enhances lipopolysaccharide-stimulated CD14 expression in U937 mononuclear cells by increasing nuclear factor {kappa}B and AP-1 activities

Alena Nareika2, Yeong-Bin Im2, Bryan A Game1, Elizabeth H Slate3, John J Sanders4, Steven D London4, Maria F Lopes-Virella1,2 and Yan Huang1,2

1 Ralph H Johnson Veterans Affairs Medical Center, 2 Division of Endocrinology, Diabetes and Medical Genetics, Department of Medicine3 Department of Biostatistics, Bioinformatics and Epidemiology and 4 College of Dental Medicine, Medical University of South Carolina, Charleston, 114 Doughty Street, South Carolina 29401, USA

(Correspondence should be addressed to Y Huang; Email: huangyan{at}musc.edu)


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have demonstrated recently that high glucose augments lipopolysaccharide (LPS)-stimulated matrix metalloproteinase (MMP) and cytokine expression by U937 mononuclear cells and human monocyte-derived macrophages. Since CD14 is a receptor for LPS, one potential underlying mechanism is that high glucose enhances CD14 expression. In the present study, we determined the effect of high glucose on CD14 expression by U937 mononuclear cells. After being chronically exposed to normal or high glucose for 2 weeks or longer, cells were treated with LPS for 24 h. Real-time PCR showed that although high glucose by itself did not increase CD14 expression significantly, it augmented LPS-stimulated CD14 expression by 15-fold. Immunoassay showed a marked enhancement of both membrane-associated and soluble CD14 protein levels by high glucose. Further investigations using transcription factor activity assays and gel shift assays revealed that high glucose augmented LPS-stimulated CD14 expression by enhancing transcription factor nuclear factor {kappa}B (NF{kappa}B) and activator protein-1 (AP-1) activities. Finally, studies using anti-CD14 neutralizing antibody showed that CD14 expression is essential for the enhancement of LPS-stimulated MMP-1 expression by high glucose. Taken together, this study has demonstrated a robust augmentation by high glucose of LPS-stimulated CD14 expression through AP-1 and NF{kappa}B transcriptional activity enhancement, elucidating a new mechanism by which hyperglycemia boosts LPS-elicited gene expression involved in inflammation and tissue destruction.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The incidence of periodontal and vascular diseases in diabetic patients is significantly higher than that in non-diabetic population, and inflammation plays an essential role in the progression of the diseases (Kannel & McGee 1979, Pyorala et al. 1987, Position paper 1999). In the investigation of the underlying mechanisms, hyperglycemia, a major metabolic disorder in both type 1 and type 2 diabetes, has been shown to upregulate gene expression involved in inflammation (Kannel & McGee 1979, Pyorala et al. 1987, Position paper 1999). Dandona et al. have shown in their patient studies that increased glucose concentration following a glucose load leads to an increase in the expression by mononuclear cells of tumor necrosis factor-{alpha} (TNF{alpha}), tissue factor, and matrix metalloproteinase (MMP; Mohanty et al. 2000, Aljada et al. 2004, 2006), which are known to be involved in inflammation (Matrisian 1992, Libby 1995). Increased glucose concentration also leads to an increased generation of reactive oxygen species by polymorphonuclear leucocytes (Mohanty et al. 2000, Aljada et al. 2004, 2006). Furthermore, it was demonstrated that increased glucose level was associated with an enhanced transcriptional activities of AP-1, nuclear factor {kappa}B (NF{kappa}B), and early growth response 1, which play an important role in the transcriptional activation of genes involved in inflammation.

In addition to the effect of high glucose on gene expression as described above, our recent studies have demonstrated that chronic pre-exposure of mononuclear cells to high glucose augments lipopolysaccharide (LPS)-stimulated MMP and proinflammatory cytokine expression (Maldonado et al. 2004, Nareika et al. 2005, 2006). However, the mechanisms involved in the synergistic upregulation of the genes by high glucose and LPS have not been fully understood. The first step for the engagement of LPS to mononuclear cells is its binding to surface CD14, a LPS receptor, and the level of CD14 surface expression is a crucial factor to determine the extent of cellular engagement by LPS (Wong et al. 2000). Based on the clinical studies showing that CD14 expression by circulating mononuclear cells in patients with diabetes is higher than that in non-diabetic patients (Patino et al. 2000, Fogelstrand et al. 2004), we postulated that high glucose may enhance CD14 expression and thus augments the engagement of cells by LPS, leading to an increased gene expression.

CD14 is a 55 kDa protein anchored to the cell membrane via glycosyl-phosphatidylinositol and a constituent of a multiligand pattern recognition receptor complex that plays an essential role in the innate immune responses (Pugin et al. 1994, Viriyakosol & Kirkland 1996, Antal-Szalmas 2000). CD14 binds to LPS/LPS-binding protein (LBP) complexes and then interacts with toll-like receptor (TLR)-4 and its adaptor protein, myeloid differentiation (MD)-2, triggering signaling activation and subsequent transcriptional activation of gene expression involved in inflammation (Antal-Szalmas 2000). In addition to LPS, CD14 also binds to other bacterial products such as teichoic acid and peptidoglycans (Pugin et al. 1994, Antal-Szalmas 2000), human heat shock protein (Kol et al. 2000), ceramide, and anionic phospholipids (Schmitz & Orso 2002). Aside from the membrane-bound CD14 (mCD14), CD14 was also found in circulating soluble form (sCD14; Amar et al. 2003). It has been shown that sCD14 is an acute phase protein (Bas et al. 2004). Clinical studies have shown that plasma level of sCD14 is elevated in a number of inflammatory diseases such as rheumatoid arthritis (Yu et al. 1998), systemic lupus erythematosus (Nockher et al. 1994), atopic dermatitis (Wuthrich et al. 1992), liver disease (Oesterreicher et al. 1995), Kawasaki disease (Takeshita et al. 2000), and atherosclerosis (Amar et al. 2003). Membrane-bound CD14 expression by mononuclear cells as determined by flow cytometry was found to be higher in diabetic patients than that in non-diabetic patients (Patino et al. 2000, Fogelstrand et al. 2004). Obviously, all these data indicate that CD14 plays a critical role in inflammation-associated diseases.

In this study, the effect of high glucose on CD14 expression by U937 mononuclear cells was investigated and the underlying mechanism was also explored. We found that high glucose markedly enhanced LPS-stimulated CD14 expression in U937 mononuclear cells by increasing NF{kappa}B and AP-1 activities. This finding unveils a mechanism that may be involved in the synergistic stimulation of gene expression by high glucose and LPS.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture

U937 histiocytes (Sundstrom & Nilsson 1976) were purchased from American Type Culture Collection (Manassas, VA, USA) and have been used in our previous studies to show the augmentation of LPS-stimulated MMP and cytokine expression by high glucose (Maldonado et al. 2004, Nareika et al. 2005, 2006). The cells were cultured in a 5% CO2 atmosphere in RPMI 1640 medium (GIBCO, Invitrogen Corp.) containing 10% fetal calf serum, 1% MEM non-essential amino acid solution, 0.6 g/100 ml HEPES, and 5 mM (normal glucose) or 25 mM (high glucose) D-glucose. The medium was changed every 2–3 days. After being incubated with medium containing normal or high glucose for more than 2 weeks, U937 cells were treated with 100 ng/ml LPS (Sigma) that were highly purified from Escherichia coli by phenol extraction and gel filtration chromatography and was cell culture tested by the manufacturer. Our previous time course study has shown that pre-exposure of U937 cells to high glucose for 2 weeks or longer led to a significant increase in gene expression in response to LPS (Maldonado et al. 2004).

Membrane, cytosol, and nuclear protein extractions

The ProteoExtract kit (Calbiochem, San Diego, CA, USA) was used to isolate membrane and cytosol proteins from U937 cells. Briefly, cells were washed with ice-cold washing buffer and then incubated with the extraction buffer I at 4 °C under gentle agitation. After the incubation, cell lysate was centrifuged at 16 000 g for 15 min. The supernatant containing cytosol proteins was collected and the precipitate was incubated with the extraction buffer II at 4 °C for 30 min under gentle agitation. After the incubation, the samples were centrifuged at 16 000 g for 15 min and the supernatant containing membrane proteins was collected. Nuclear protein was extracted using NE-PER nuclear and cytoplasmic extraction reagents from Pierce (Rockfold, IL, USA). The concentration of protein in cytosol, membrane, and nuclear fractions was determined using a protein assay kit (Bio-Rad).

ELISA

CD14 protein in cytosol and membrane fractions and in conditioned medium was quantified using sandwich ELISA kits according to the protocol provided by the manufacturer (R&D System, Minneapolis, MN, USA). MMP-1 level in conditioned medium was also determined using a sandwich ELISA kit (R&D System).

Real-time PCR

Total RNA was isolated from cells using the RNeasy minikit (Qiagen). First-strand cDNA was synthesized with the iScript cDNA synthesis kit (Bio-Rad) using 20 µl reaction mixture containing 0.25 µg total RNA, 4 µl 5x iScript reaction mixture, and 1 µl iScript reverse transcriptase. The complete reaction was cycled for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA, USA). The reverse transcription reaction mixture was then diluted in the ratio 1:10 with nuclease-free water and used for PCR amplification of CD14 and TLR4 in the presence of the primers (CD14 primers: 5' sequence, CCGCTGCCTCTGGAAG; 3' sequence, GGCGAGTGTGCTTGGG. TLR4 primers: 5' sequence, GTCCTCAGTGTGCTTGTAG; 3' sequence, ATCCTGGCTTGAGTAGATAAC). The Beacon Designer Software (PREMIER Biosoft International, Palo Alto, CA, USA) was used for primer designing. Primers were synthesized by Integrated DNA Technologies Inc. (Coralville, IA, USA). Real-time PCR was performed in duplicate using 25 µl reaction mixture that contained 1.0 µl RT mixture, 0.2 µM of both primers, and 12.5 µl iQ SYBR Green Supermix (Bio-Rad) and run in the iCycler real-time detection system (Bio-Rad) with a two-step method. The hot-start enzyme was activated (95 °C for 3 min) and cDNA was then amplified for 40 cycles consisting of denaturation at 95 °C for 10 s and annealing/extension at 53 °C for 45 s. A melt curve was then performed (55 °C for 1 min and then temperature was increased by 0.5 °C every 10 s) to detect the formation of primer-derived trimers and dimmers. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a control was amplified with the primers (5' sequence: GCCTTCCGTGTTCCTACC; 3' sequence: GCCTGCTTCACCACCTTC). Amplicon size and reaction specificity were confirmed by 2.5% agarose gel electrophoresis. Data were analyzed using the iCycler iQ software (Biorad Laboratories, Hercules, CA, USA). The average SQ (starting quantity) of fluorescence units was used for analysis. Quantification was calculated using the SQ of CD14 cDNA relative to that of GAPDH cDNA in the same sample.

Electrophoretic mobility shift assay (EMSA)

U937 cells cultured in normal or high glucose-containing medium were treated with 1 µg/ml LPS for 1, 2, 4, and 6 h. After the treatment, cells were harvested and nuclear protein was extracted as described above. Ten micrograms of nuclear proteins were used for the electrophoretic mobility shift assay to determine NF{kappa}B DNA and AP-1 binding activities. DNA–protein binding reactions were performed at room temperature for 20 min in a buffer containing 10 mM Trizma base (pH 7.9), 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol, 1 µg poly(dI-dC), 5% (v/v) glycerol, and ~0.3 pmole of NF{kappa}B or AP-1 oligonucleotide (Promega) labeled with DIG-ddUTP using terminal deoxynucleotidyl transferase (Roche Molecular Biochemicals). Protein–DNA complexes were resolved from protein-free DNA in 5% polyacrylamide gels at room temperature in 50 mM Tris (pH 8.3), 0.38 M glycine, 2 mM EDTA, and electroblotted onto positively charged nylon membranes. The chemiluminescence detection of digoxigenin (DIG)-labeled probes was conducted by following the instruction provided by the Roche Molecular Biochemicals.

Transcription factor activity assay

Two micrograms of nuclear protein of each sample were applied to the assay for NF{kappa}B and AP-1 activities using the TransAM kits produced by Active Motif (Carlsbad, CA, USA) according to the protocol provided by the manufacturer. These kits contain a 96-stripwell plate to which the consensus-binding site oligonucleotides were immobilized. Activated nuclear extract is added to each well and the transcription factor of interest binds specifically to bound oligonucleotides. TransAM assays are up to 100 times more sensitive than gel mobility shift assay and detect transcription factors with specific antibodies.

Treatment of cells with the inhibitors of signaling pathways and curcumin

In the studies to determine the effects of the specific inhibitors of MAP kinase (MAPK) and NF{kappa}B pathways on the stimulation of CD14 expression by high glucose and LPS, U937 cells pre-exposed to normal or high glucose were treated with 100 ng/ml of LPS in the absence or presence of 10 µM PD98059 (extracellular signal-regulated kinase (ERK) pathway inhibitor), SP60025 (c-Jun N-terminal kinase or JNK pathway inhibitor), SB203580 (p38 MAPK pathway inhibitor), 1 µM Bay11-7085 (NF{kappa}B pathway inhibitor), or gelastol (NF{kappa}B pathway inhibitor). These concentrations of the inhibitors have been applied in the previous study to block LPS-stimulated gene expression (Nareika et al. 2005). To determine the inhibitory effect of curcumin on CD14 expression, U937 cells were treated with 100 ng/ml LPS in the presence or absence of different concentrations of curcumin for 18 h. Previous studies have shown that the concentrations of 10–30 µM curcumin are effective in the inhibition of gene expression (Dicknson et al. 2003, Aggarwal et al. 2005, Nareika et al. 2005). After the treatment, conditioned medium was collected for sCD14 assay using ELISA as described above.

Blocking studies on MMP-1 secretion using anti-CD14 neutralizing antibody

U937 cells exposed to high glucose were treated with 100 ng/ml LPS in the presence or absence of 5 or 10 µM sheep anti-CD14 neutralizing antibody (R&D Systems) for 24 h. After the treatment, MMP-1 in the conditioned medium was quantified using ELISA. A control sheep anti-human IgG (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) was used to determine the non-specific inhibition of MMP-1 secretion by IgG.

Statistical analysis

Data were presented as mean±S.D. Student's t-tests were performed to determine the statistically significant differences of gene expression among different experimental groups. A value of P<0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Augmentation of LPS-stimulated CD14 expression by high glucose

Results from quantitative real-time PCR showed that 100 ng/ml LPS stimulated CD14 mRNA expression in normal and high glucose-exposed U937 cells by 6-fold (0.14±0.05 vs 0.022±0.01) and 42-fold (2.09±0.28 vs 0.05±0.026) respectively when compared with cells treated without LPS (Fig. 1A, C and D). Although high glucose itself did not stimulate CD14 expression significantly, it led to a 15-fold augmentation of LPS-stimulated CD14 mRNA expression as compared with normal glucose (2.09±0.28 vs 0.14±0.05; Fig. 1A). Since TLR4, another receptor for LPS, plays an important role in LPS signaling, the effect of high glucose on TLR4 expression was also investigated. Results showed that both high glucose and LPS had no stimulatory effect on TLR4 expression (Fig. 1B).


Figure 1
View larger version (37K):
[in this window]
[in a new window]

 
Figure 1 (A) Augmentation of LPS-stimulated CD14 mRNA expression in U937 cells by high glucose. U937 cells cultured in normal or high glucose-containing medium were treated with 100 ng/ml LPS for 24 h. After the treatment, total RNA was isolated from the cells and used for real-time PCR to quantify CD14 mRNA expression as described in Materials and Methods. The ratio of CD14 versus GAPDH mRNA was calculated and presented. Data presented are the representative of three duplicate experiments with similar results. (B) The effect of high glucose on TLR4 mRNA expression by U937 cells. The RNA isolated from the above experiments was also subjected to real-time PCR to quantify the cellular TLR4 mRNA level. (C and D) Real-time PCR amplification curves for CD14 (C) and GAPDH mRNA (D). Duplicate samples were run in each experiment. HG, high glucose; NG, normal glucose; Ct, cycles for threshold.

 
Since CD14 protein is present in the plasma membrane and cytoplasm and also shaded into culture medium, CD14 localized in the membrane (mCD14), cytoplasm (cCD14) fraction, and cell-conditioned medium (sCD14) was quantified by ELISA. Results showed that LPS increased mCD14 protein level in cells exposed to normal glucose (0.16±0.004 vs 0.002±0.0002 pg/µg protein) or high glucose (7.20±0.41 vs 0.05±0.0003 pg/µg protein; Fig. 2A). The exposure to high glucose led to a 45-fold increase in mCD14 protein level in response to LPS when compared with the exposure to normal glucose. Similarly, high glucose also remarkably increased CD14 in the cytoplasm (Fig. 2A) and the conditioned medium (Fig. 2B). Figure 2C showed that glucose augmented LPS-stimulated sCD14 in a concentration-dependent fashion.


Figure 2
View larger version (14K):
[in this window]
[in a new window]

 
Figure 2 Augmentation of LPS-stimulated CD14 protein expression in membrane and cytosol fractions and in conditioned medium by high glucose. (A) U937 cells cultured in normal or high glucose-containing medium were treated with 100 ng/ml LPS for 24 h. After the treatment, cytosol and membrane proteins were extracted and used for quantification of CD14 protein using ELISA as described in Materials and Methods. (B) The soluble CD14 (sCD14) in conditioned medium was also quantified using ELISA. The CD14 protein level was normalized to cellular total protein. HG, high glucose; NG, normal glucose. (C) Concentration-dependent upregulation of sCD14 expression by glucose. U937 cells were cultured in medium containing different concentrations of glucose as indicated for 2 days and then treated with or without 100 ng/ml LPS for 24 h. After the treatment, sCD14 in the conditioned medium was determined as described above.

 
To exclude the possible involvement of increased molarity of high glucose in the upregulation of gene expression, cells were treated with 25 mM mannitol instead of glucose and sCD14 was determined after the treatment. Results showed that the amount of sCD14 in response to 25 mM mannitol was similar to that in response to 10 mM glucose (187±18 vs 182±17 pg/ml) and only accounted for 28% of sCD14 released by cells in response to 25 mM glucose (187±18 vs 660±82 pg/ml, P<0.001). Thus, the augmentation of CD14 expression by high glucose is not due to the increased molarity.

NF{kappa}B and MAPK pathways are involved in the upregulation of CD14 expression by LPS

Since it is known that LPS stimulates gene expression in mononuclear cells through NF{kappa}B and MAPK pathways, we confirmed the involvement of NF{kappa}B and MAPK in the stimulation of CD14 expression by LPS. In this experiment, sCD14 was determined and served as a surrogate for CD14 expression since our above data showed that the increase in sCD14 protein (Fig. 2B) was similar to that in CD14 mRNA (Fig. 1A) in response to LPS. Results (Fig. 3A and B) showed that in the absence of LPS stimulation, PD98059, SP60025, and SB203580 (specific inhibitors of ERK, JNK, and p38 MAPK pathways respectively) had no effect on the basal level of sCD14 in cells exposed to either normal or high glucose, while Bay11-7085 and gelastol (specific inhibitors for NF{kappa}B cascade) increased sCD14 by about twofold. In the presence of LPS stimulation, sCD14 levels were increased by 12-fold (113 vs 9 pg/µg DNA) and 63-fold (506 vs 8 pg/µg DNA) in normal and high glucose-exposed cells respectively. PD98059, SP60025, SB203580, Bay11-7085, and gelastol significantly inhibited LPS-stimulated sCD14 expression in normal glucose-exposed cells by 45–82% (Fig. 3A and Table 1) and in high glucose-exposed cells by 67–97% (Fig. 3B and Table 1). These results demonstrated that both NF{kappa}B and MAPK (ERK, JNK, p38) pathways were involved in the upregulation of CD14 by LPS.


Figure 3
View larger version (12K):
[in this window]
[in a new window]

 
Figure 3 Inhibition of sCD14 production by specific inhibitors of MAPK and NF{kappa}B pathways. U937 cells cultured in (A) normal glucose- or (B) high glucose-containing medium were treated with 100 ng/ml LPS in the presence or absence of 10 µM PD98059 (ERK pathway inhibitor), SP60025 (JNK pathway inhibitor), SB203580 (p38 MAPK pathway inhibitor), 1 µM Bay11-7085 (NF{kappa}B pathway inhibitor), or gelastol (NF{kappa}B pathway inhibitor) for 24 h. After the treatment, sCD14 in the conditioned medium was quantified using ELISA as described in Materials and Methods. The amount of sCD14 was normalized to the amount of cellular DNA. sCD14 level in each sample was presented as percent of sCD14 from cells treated with LPS in the absence of the inhibitors. Ctr, control; PD, PD98059; SP, SP60025; SB, SB203580; Bay, Bay11-7085; Gela, gelastol.

 

View this table:
[in this window]
[in a new window]

 
Table 1 Inhibition of sCD14 by inhibitors of MAP kinase and nuclear factor {kappa}B (NF{kappa}B) pathways (percentage of the control). Data shown are mean±S.D.

 
High glucose enhances LPS-stimulated NF{kappa}B and AP-1 DNA-binding activity

We determined whether high glucose augments LPS-stimulated CD14 expression by increasing LPS-triggered NF{kappa}B and AP-1 transcriptional activities using a quantitative assay system in which NF{kappa}B or AP-1 oligonucleotides are immobilized on a plate, and the bound NF{kappa}B or AP-1 is then detected by immunoassay with specific antibodies. This assay, therefore, is not only similar to gel mobility shift assay regarding DNA–protein interaction but also quantitative. Results showed that the DNA-binding activity of NF{kappa}B subunit p50, but not p65, was increased by high glucose (Fig. 4A and B). The DNA-binding activities of c-Fos and c-Jun, two major subunits of AP-1, were also determined. Results showed that while c-Fos and c-Jun activities had no statistical difference between cells exposed to normal or high glucose alone, the activities were significantly increased in high glucose-exposed cells after treatment with LPS for 4 h when compared with those in normal glucose-exposed cells (Fig. 4C and D). After LPS treatment for 6 h, the c-Fos activity continued to increase (Fig. 4C), while the c-Jun activity declined (Fig. 4D). Results from EMSA showed that, in the absence of LPS, the NF{kappa}B DNA-binding activity in cells exposed to high glucose was significantly higher than that in cells exposed to normal glucose (Fig. 5A and B). In the presence of LPS, the NF{kappa}B DNA-binding activity assayed at the different times (1–6 h) was also higher in cells exposed to high glucose than that in cells exposed to normal glucose (Fig. 5A and B). Similarly, in the absence of LPS, the AP-1 DNA-binding activity was higher in cells exposed to high glucose than that in cells exposed to normal glucose (Fig. 5C and D). In the presence of LPS, the AP-1 DNA-binding activity at 1 and 2 h was also higher in high glucose-exposed cells than that in normal glucose-exposed cells. At 4 h, the AP-1 DNA-binding activity was similar between these two groups of cells (Fig. 5C and D). These results indicate that high glucose augments LPS-stimulated CD14 expression by enhancing the activities of transcription factors NF{kappa}B and AP-1.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

 
Figure 4 Enhancement of LPS-stimulated activities of NF{kappa}B subunit p50 and AP-1 subunits c-Fos and c-Jun by high glucose. U937 cells cultured in normal or high glucose-containing medium were treated with 100 ng/ml LPS for 1, 2, 4, 6, and 8 h. After the treatment, nuclear protein was extracted from cells and used for assays of p50 (A), p65 (B), c-Fos (C), and c-Jun (D) DNA-binding activities as described in Materials and Methods. The data were presented as fold increase in the DNA-binding activity when compared with that in cells cultured with normal glucose in the absence of LPS.

 

Figure 5
View larger version (22K):
[in this window]
[in a new window]

 
Figure 5 High glucose increases NF{kappa}B (A) and AP-1 (C) DNA-binding activities. U937 cells cultured in normal or high glucose-containing medium were treated with 100 ng/ml LPS for 0, 1, 2, 4, and 6 h. After the treatment, nuclear proteins were extracted from the cells and subjected to EMSA as described in Materials and Methods. Densitometric scanning was performed to quantify the intensity of the shifted NF{kappa}B (B) or AP-1 bands (D). The data presented are the representative of two experiments.

 
Inhibition of CD14 expression by curcumin

Curcumin, also called diferuloylmethane, is a major pigment of the spice turmeric and a potent inhibitor of NF{kappa}B and AP-1 transcription activities (Dicknson et al. 2003, Aggarwal et al. 2005). To further determine whether NF{kappa}B and MAPK pathways are involved in the upregulation of CD14 by LPS and high glucose, U937 cells were treated with LPS in the presence or absence of different concentrations of curcumin. After the treatment, sCD14 in the conditioned medium was quantified by ELISA. Results showed that curcumin inhibited sCD14 production in a concentration-dependent manner and 20 µM curcumin inhibited LPS-stimulated sCD14 production from both normal and high glucose-exposed cells by 80% (Fig. 6).


Figure 6
View larger version (17K):
[in this window]
[in a new window]

 
Figure 6 Inhibition of sCD14 production by curcumin. U937 cells cultured in normal or high glucose-containing medium were treated with 100 ng/ml LPS in the absence or presence of curcumin (5–30 µM) for 24 h. After the treatment, conditioned medium was collected for quantification of sCD14 using an ELISA kit as described in Materials and Methods. The data were presented as percentage of the maximum from cells cultured in high glucose-containing medium and treated with LPS in the absence of curcumin.

 
CD14 is essential for high glucose-augmented MMP-1 expression

Our recent study demonstrated that high glucose augments LPS-stimulated MMP-1 expression by U937 cells. Since CD14 is the receptor for LPS and increased CD14 expression could enhance the interaction of cells with LPS, leading to upregulation of LPS-stimulated gene expression, we hypothesized that the enhancement of CD14 expression by high glucose may play an important role in the augmentation of LPS-stimulated MMP-1 expression. To test this hypothesis, we used anti-CD14 neutralizing antibody to block the interaction between CD14 and U937 cells. Results showed that the neutralization by 5 µg/ml anti-CD14 antibody inhibited the augmentation by high glucose of LPS-stimulated MMP-1 secretion by 81% (71.9 vs 387.1 ng/ml for secreted MMP-1 in the presence and absence of the neutralizing antibodies respectively; Fig. 7). Although the control IgG also partially inhibited MMP-1 secretion, 5 µg/ml of it inhibited MMP-1 secretion only by 36% (247.7 vs 387.1 ng/ml for secreted MMP-1 in the presence and absence of the control antibodies respectively) that is significantly less than the degree of inhibition by anti-CD14 antibody.


Figure 7
View larger version (15K):
[in this window]
[in a new window]

 
Figure 7 Inhibition of LPS-stimulated MMP-1 secretion from U937 cells by anti-CD14 neutralizing antibody. U937 cells cultured in normal or high glucose-containing medium were treated with 100 ng/ml LPS in the absence or presence of 5 and 10 µg neutralizing anti-CD14 or control antibodies for 24 h. After the treatment, conditioned medium was collected for quantification of MMP-1 using ELISA as described in Materials and Methods. The data presented were the representative of two experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CD14 is an initial receptor for LPS and plays an essential role in the pathogen recognition by the innate immune system (Bas et al. 2004). LPS binds to LBP and mCD14 to form a trimolecular complex that has a high affinity to TLR4, a LPS signaling receptor. The interaction between the complex and TLR4 triggers a strong inflammatory response through NF{kappa}B and MAPK pathways in mononuclear cells (Pugin et al. 1993). Besides mCD14, it has been shown that soluble CD14 mediates the LPS-stimulated activation of non-CD14– expressing cells such as late passage endothelial cells, epithelial, and smooth muscle cells (Haziot et al. 1993, Loppnow et al. 1995, Guha & Mackman 2001, Bas et al. 2004). Furthermore, studies have shown that macrophages isolated from CD14 knockout mice are unable to produce TNF{alpha}, IL-1β, and interferon-inducible protein-10 in response to LPS and these mice have an early death in pneumococcal infection (Vogel et al. 1998). Clearly, all these studies have well documented an essential role of CD14 in immunity and inflammation.

We reported in this study that high glucose incites a robust augmentation of LPS-stimulated CD14 expression by U937 mononuclear cells. It is interesting to note that high glucose did not have a significant effect and LPS had a 6-fold stimulation on CD14 mRNA expression, but the combination of high glucose and LPS led to a 95-fold stimulation on CD14 mRNA expression (2.09±0.28 vs 0.022±0.01). Similar robust augmentation by high glucose was consistently observed at the levels of membrane-associated CD14 and soluble CD14 in conditioned medium. Obviously, there is a strong synergy between high glucose and LPS on CD14 expression. Thus, this study has established a good cell model to further investigate the synergistic interaction between high glucose and LPS on CD14 expression.

In the following studies to explore the underlying synergistic mechanism, we found that high glucose enhances LPS-stimulated CD14 expression in U937 cells by increasing NF{kappa}B and AP-1 activities. Our EMSA study presented in Fig. 5 showed that exposure to high glucose increased LPS-stimulated NF{kappa}B DNA-binding activity at 1, 2, 4, and 6 h after the treatment. High glucose also increased LPS-stimulated AP-1 DNA-binding activity at 1 and 2 h after the treatment. Since it is known that transcription factors NF{kappa}B and AP-1 are essential for LPS-initiated inflammatory responses (Pugin et al. 1993), this finding suggests that hyperglycemia may boost inflammation in response to LPS. As illustrated in Fig. 8, our study suggests that mononuclear cells when exposed to hyperglycemia have an enhanced CD14 expression in response to LPS. The increased CD14 surface expression facilitates more engagement between mononuclear cells and LPS, which in turn further increases CD14 production under the condition of hyperglycemia. The enhanced LPS signaling leads to increased NF{kappa}B and AP-1 transcriptional activities and hence the expression of proinflammatory cytokines and MMPs.


Figure 8
View larger version (11K):
[in this window]
[in a new window]

 
Figure 8 The diagram showing the augmentation of LPS-stimulated CD14 expression and resulting CD14– mediated inflammatory responses by hyperglycemia.

 
Our results showed that high glucose and LPS stimulated the expression of CD14, but not TLR4 (Fig. 1), indicating that between LPS receptors CD14 and TLR4, high glucose and LPS specifically upregulate CD14 in U937 cells. Furthermore, our results showed that the baseline level of CD14 expression was much lower than that of TLR4 expression when compared with the housekeeping gene GAPDH. However, after stimulation with high glucose and LPS, CD14 level was dramatically increased and became similar to TLR4 (about twofold of GAPDH mRNA; Fig. 1). Thus, it appears that CD14, but not TLR4, is responsible for the regulation of interaction between LPS and U937 cells by high glucose and LPS. It is expected that the robust increase in CD14 expression would lead to a marked increase in the formation of LPS–CD14–LBP complexes that interact with TLR4 and trigger TLR4-mediated signaling activation and gene expression.

We have reported previously that high glucose augmented LPS-stimulated MMP-1 expression by U937 histiocytes (Maldonado et al. 2004). However, the underlying mechanisms have not been well understood. In this study, we determine whether CD14 expression is essential for the augmentation of LPS-stimulated MMP-1 expression. We performed a neutralization study in which anti-CD14 antibodies were added to the high glucose-exposed cells when they were treated with LPS. It is expected that the binding of the neutralizing anti-CD14 to mCD14 or sCD14 would prevent the interaction of LPS to mCD14 or sCD14 and thus reduces the LPS-stimulated gene expression. Indeed, our results demonstrate that the addition of anti-CD14 antibodies significantly attenuates LPS-stimulated MMP-1 secretion from high glucose-treated cells (Fig. 7), confirming an important role of CD14 in MMP-1 expression in response to high glucose and LPS. In this experiment, we also observed that the control antibody for anti-CD14 partially inhibited MMP-1 secretion. While the cause remains unknown, it is possible that the partial inhibition may be caused by the close localization of CD14 and Fc{gamma}-receptor II/III (CD32/16) on the cell surface. Hisaka et al. (1999) showed that the binding of anti-CD14 MAB to CD14 was inhibited by pretreatment of monocytes with anti-Fc{gamma}-receptor II/III monoclonal antibodies. They postulated that the close localization of CD14 and Fc{gamma}-receptor II/III led to the non-specific blocking of CD14 binding by anti-Fc{gamma}-receptor II/III antibody. Since the control IgG antibodies used in the present study have potential to bind to Fc{gamma}-receptor II/III through the Fc portion, it is possible that they can partially interfere with the binding of LPS to CD14.

It is known that diabetic patients have increased incidence and severity of infectious diseases such as those in the periodontal tissue (Bell et al 2000, Grossi 2001) and urinary tract (Ooi et al. 2004) in which infection with the Gram-negative bacteria is the primary cause. For patients who have poor glycemic control, mononuclear cells may be pre-exposed to hyperglycemia before interacting with LPS. Thus, hyperglycemia may boost LPS-initiated inflammation by enhancing the expression of CD14, cytokines, MMPs, and other molecules involved in the inflammatory process. Our studies have shown that in addition to MMP-1, high glucose also augments LPS-stimulated expression of MMP-7, MMP-8, MMP-9, as well as proinflammatory cytokines such as TNF{alpha}, IL-1β, and IL-6 (Maldonado et al. 2004, Nareika et al. 2006). Therefore, the synergy between high glucose and LPS for CD14, cytokine, and MMP expression is likely a potential factor causing the increased risk and severity of periodontal disease and urinary tract infection in diabetic patients.

Human monocytes have both CD14 positive (CD+) and CD14 negative (CD14–) cells (Urbich et al. 2003). Given the different baseline levels of CD14 expression, it is possible that these two cell populations may respond to high glucose and LPS differently. Similar to U937 cells, CD14– cells have undetectable level of CD14 expression which may be induced by high glucose and LPS. In contrast, since the basal expression of CD14 is high in CD14+ cells, the effect of high glucose and LPS on CD14 expression in these cells may be less remarkable. Further experiments are necessary to investigate the effect of high glucose and LPS on CD14 expression by human CD14– and CD14+ monocytes.

In summary, our present study has demonstrated that high glucose markedly enhances LPS-stimulated CD14 expression in U937 mononuclear cells by enhancing NF{kappa}B and AP-1 transcription activities. Since CD14 plays a critical role in the pathogen recognition, these findings have revealed a molecular mechanism involved in diabetes-promoted inflammatory diseases.


    Acknowledgements
 
This work was supported by NIH grant DE16353 and Merit Review Grant from Department of Veterans Affairs (to Y H). E H S, J J S, S D L, and M F L-V additionally acknowledge the partial support from the NIH/NCRR COBRE project P20 RR017696. This study was presented at American Diabetes Association 66th Scientific Session, Washington, DC, June 9–13, 2006. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Aggarwal BB, Shishodia S, Takada Y, Banerjee S, Newman RA, Bueso-Ramos CE & Price JE 2005 Curcumin suppresses the paclitaxel-induced nuclear factor-kappaB pathway in breast cancer cells and inhibits lung metastasis of human breast cancer in nude mice. Clinical Cancer Research 11 7490–7498.[Abstract/Free Full Text]

Aljada A, Ghanim H, Mohanty P, Syed T, Bandyopadhyay A & Dandona P 2004 Glucose intake induces an increase in activator protein 1 and early growth response 1 binding activities, in the expression of tissue factor and matrix metalloproteinase in mononuclear cells, and in plasma tissue factor and matrix metalloproteinase concentrations. American Journal of Clinical Nutrition 80 51–57.[Abstract/Free Full Text]

Aljada A, Friedman J, Ghanim H, Mohanty P, Hofmeyer D, Chaudhuri A & Dandona P 2006 Glucose ingestion induces an increase in intranuclear nuclear factor {kappa}B, a fall in cellular inhibitor kappaB, and an increase in tumor necrosis factor alpha messenger RNA by mononuclear cells in healthy human subjects. Metabolism: Clinical and Experimental 55 1177–1185.[Web of Science]

Amar J, Ruidavets JB, Bal Dit Sollier C, Bongard V, Boccalon H, Chamontin B, Drouet L & Ferrieres J 2003 Soluble CD14 and aortic stiffness in a population-based study. Journal of Hypertension 21 1869–1877.[CrossRef][Web of Science][Medline]

Antal-Szalmas P 2000 Evaluation of CD14 in host defense. European Journal of Clinical Investigation 30 167–179.[CrossRef][Web of Science][Medline]

Bas S, Gauthier BR, Spenato U, Stingelin S & Gabay C 2004 CD14 is an acute-phase protein. Journal of Immunology 172 4470–4479.[Abstract/Free Full Text]

Bell GW, Large DM & Barclay SC 2000 Oral health care in diabetes mellitus. South African Dental Journal 55 158–165.[Medline]

Dicknson DA, Iles KE, Zhang H, Blank V & Forman HJ 2003 Curcumin alters EpRE and AP-1 binding complexes and elevates glutamate-cysteine ligase gene expression. FASEB Journal 17 473–475.[Abstract/Free Full Text]

Fogelstrand L, Hulthe J, Hulten LM, Wiklund O & Fagerberg B 2004 Monocytic expression of CD14 and CD18, circulating adhesion molecules and inflammatory markers in women with diabetes mellitus and impaired glucose tolerance. Diabetologia 47 1948–1952.[CrossRef][Web of Science][Medline]

Grossi SG 2001 Treatment of periodontal disease and control of diabetes: an assessment of the evidence and need for future research. Annals of Periodontology 6 138–145.[CrossRef][Medline]

Guha M & Mackman N 2001 LPS induction of gene expression in human monocytes. Cellular Signalling 13 85–94.[CrossRef][Web of Science][Medline]

Haziot A, Rong GW, Silver J & Goyert SM 1993 Recombinant soluble CD14 mediates the activation of endothelial cells by lipopolysaccharide. Journal of Immunology 151 1500–1507.[Abstract]

Hisaka H, Kataoka M, Higuchi Y, Matsuura K & Yamamoto S 1999 Close localization of mouse CD14 and CD32/16 in the cell surface of monocytic cell lines. Pathobiology 67 92–98.[CrossRef][Web of Science][Medline]

Kannel WB & McGee DL 1979 Diabetes and cardiovascular disease. The Framingham Study. Journal of the American Medical Association 241 2035–2038.[Abstract/Free Full Text]

Kol A, Lichtman AH, Finberg RW, Libby P & Kurt-Jones EA 2000 Cutting edge: heat shock protein (HSP) 60 activates the innate immune response: CD14 is an essential receptor for HSP60 activation of mononuclear cells. Journal of Immunology 164 13–17.[Abstract/Free Full Text]

Libby P 1995 Molecular bases of the acute coronary syndromes. Circulation 91 2844–2850.[Free Full Text]

Loppnow H, Stelter F, Schonbeck U, Schluter C, Ernst M, Schutt C & Flad HD 1995 Endotoxin activates human vascular smooth muscle cells despite lack of expresson of CD14 mRNA or endogenous membrane CD14. Infection and Immunity 63 1020–1026.[Abstract]

Maldonado A, He L, Game BA, Nareika A, Sanders JJ, London SD, Lopes-Virella MF & Huang Y 2004 Pre-exposure to high glucose augments lipopolysaccharide-stimulated matrix metalloproteinase-1 expression by human U937 histiocytes. Journal of Periodontal Research 39 415–423.[CrossRef][Web of Science][Medline]

Matrisian LM 1992 The matrix-degrading metalloproteinases. BioEssays 14 455–463.[CrossRef][Web of Science][Medline]

Mohanty P, Hamouda W, Garg R, Aljada A, Ghanim H & Dandona P 2000 Glucose challenge stimulates reactive oxygen species (ROS) generation by leucocytes. Journal of Clinical Endocrinology and Metabolism 85 2970–2973.[Abstract/Free Full Text]

Nareika A, He L, Game BA, Slate EH, Sanders JJ, London SD, Lopes-Virella MF & Huang Y 2005 Sodium lactate increases LPS-stimulated MMP and cytokine expression in U937 histiocytes by enhancing AP-1 and NF{kappa}B transcriptional activities. American Journal of Physiology. Endocrinology and Metabolism 289 E534–E542.[Abstract/Free Full Text]

Nareika A, Maldonado A, He L, Game BA, Slate EH, Sanders JJ, London SD, Lopes-Virella MF & Huang Y 2006 High glucose-boosted inflammatory responses to lipopolysaccharide are suppressed by statin. Journal of Periodontal Research 42 31–38.[CrossRef][Web of Science]

Nockher WA, Wigand R, Schoeppe W & Scherberich JE 1994 Elevated levels of soluble CD14 in serum of patients with systemic lupus erythematosus. Clinical and Experimental Immunology 96 15–19.[Web of Science][Medline]

Oesterreicher C, Pfeffel F, Petermann D & Muller C 1995 Increased in vitro production and serum levels of the soluble lipopolysaccharide receptor sCD14 in liver disease. Journal of Hepatology 23 396–402.[CrossRef][Web of Science][Medline]

Ooi ST, Frazee LA & Gardner WG 2004 Management of asymptomatic bacteriuria in patients with diabetes mellitus. Annals of Pharmacotherapy 38 490–493.[Abstract/Free Full Text]

Patino R, Ibarra J, Rodriguez A, Ruiz-Yague M, Pintor E, Fernandez-Cruz A & Figueredo A 2000 Circulating monocytes in patients with diabetes mellitus, arterial disease, and increased CD14 expression. American Journal of Cardiology 85 1288–1291.[CrossRef][Web of Science][Medline]

Position paper Diabetes and periodontal diseases Journal of Periodontology 70 1999 935–949.[CrossRef][Web of Science][Medline]

Pugin J, Schurer-Maly CC, Leturcq D, Moriarty A, Ulevitch RJ & Tobias PS 1993 Lipopolysaccharide activation of human endothelial and epithelial cells is mediated by lipopolysaccharide-binding protein and soluble CD14. PNAS 90 2744–2748.[Abstract/Free Full Text]

Pugin J, Heumann ID, Tomasz A, Kravcheno VV, Akamatsu Y, Nishijima M, Glauser MP, Tobias PS & Ulevitch RJ 1994 CD14 is a pattern recognition receptor. Immunity 1 509–516.[CrossRef][Web of Science][Medline]

Pyorala K, Laakso M & Unsitupa M 1987 Diabetes and atherosclerosis: an epidemiologic view. Diabetes/Metabolism Reviews 3 463–524.[Medline]

Schmitz G & Orso E 2002 CD14 signaling in lipid rafts: new ligands and co-receptors. Current Opinion in Lipidology 13 513–521.[CrossRef][Web of Science][Medline]

Sundstrom C & Nilsson K 1976 Establishment and characterization of a human histiocytic lymphoma cell line (U937). International Journal of Cancer 17 565–577.[Web of Science][Medline]

Takeshita S, Nakatani K, Tsujimoto H, Kawamura Y, Kawase H & Sekine I 2000 Increased levels of circulating soluble CD14 in Kawasaki disease. Clinical and Experimental Immunology 119 376–381.[CrossRef][Web of Science][Medline]

Urbich C, Heeschen C, Aicher A, Dernbach E, Zeiher AM & Dimmeler S 2003 Relevance of monocytic features for neovascularization capacity of circulating endothelial progenitor cells. Circulation 108 2511–2516.[Abstract/Free Full Text]

Viriyakosol S & Kirkland TN 1996 The N-terminal half of membrane CD14 is a functional cellular lipopolysaccharide receptor. Infection and Immunity 64 653–656.[Abstract]

Vogel SN, Perera PY, Detore GR, Bhat N, Carboni JM, Haziot A & Goyert SM 1998 CD14 dependent and independent signaling pathways in murine macrophages from normal and CD14 ‘knockout’ (CD14KO) mice stimulated with LPS or taxol. Progress in Clinical and Biological Research 397 137–146.[Web of Science][Medline]

Wong PM, Chugn SW & Sultzer BM 2000 Genes, receptors, signals and responses to lipoolysaccharide endotoxin. Scandinavian Journal of Immunology 51 123–127.[CrossRef][Web of Science][Medline]

Wuthrich B, Kagi MK & Joller-Jemelka H 1992 Soluble CD14 but not interleukin-6 is a new marker for clinical activity in atopic dermatitis. Archives of Dermatological Research 284 339–342.[CrossRef][Web of Science][Medline]

Yu S, Nakashima N, Xu BH, Matsuda T, Izumihara A, Sunahara N, Nakamura T, Tsukano M & Matsuyama T 1998 Pathological significance of elevated soluble CD14 production in rheumatoid arthritis: in the presence of soluble CD14, lipopolysaccharides at low concentrations activate RA synovial fibroblasts. Rheumatology International 17 237–243.[CrossRef][Web of Science][Medline]

Received in final form 7 September 2007
Accepted 9 October 2007
Made available online as an Accepted Preprint 10 October 2007




This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. P. Sundararaj, D. J. Samuvel, Y. Li, J. J. Sanders, M. F. Lopes-Virella, and Y. Huang
Interleukin-6 Released from Fibroblasts Is Essential for Up-regulation of Matrix Metalloproteinase-1 Expression by U937 Macrophages in Coculture: CROSS-TALKING BETWEEN FIBROBLASTS AND U937 MACROPHAGES EXPOSED TO HIGH GLUCOSE
J. Biol. Chem., May 15, 2009; 284(20): 13714 - 13724.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nareika, A.
Right arrow Articles by Huang, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nareika, A.
Right arrow Articles by Huang, Y.


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS