JOE Society for Endocrinology Archive
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2007) 195, 385-392       DOI: 10.1677/JOE-07-0042
© 2007 Society for Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Figure
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mittag, J.
Right arrow Articles by Bauer, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mittag, J.
Right arrow Articles by Bauer, K.

Expression and thyroid hormone regulation of annexins in the anterior pituitary

Jens Mittag1,2,*, Wiebke Oehr1,*,, Heike Heuer3, Tuula Hämäläinen4, Bent Brachvogel5, Ernst Pöschl6 and Karl Bauer1,3

1 Max Planck Institute for Experimental Endocrinology, Feodor-Lynen-Str. 7, D-30625 Hannover, Germany 2 Department of Cell and Molecular Biology, Karolinska Institutet, von Eulers väg 3, SE-17177 Stockholm, Sweden 3 Fritz-Lipmann-Institut, Beutenbergstr. 11, D-07745 Jena, Germany 4 Institute of Biomedicine, University of Turku, FI-25020 Turku, Finland 5 Institute for Biochemistry, University of Cologne, Otto-Fischer-Straße 12-14, D-50674 Cologne, Germany 6 University of East Anglia, Norwich NR4 7TJ, UK

(Correspondence should be addressed to J Mittag; Email: jens.mittag{at}ki.se)

* ( J Mittag and W Oehr contributed equally to this work) Back


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Due to their property to bind to phospholipids in a Ca2+-dependent manner, proteins of the annexin superfamily are involved in many membrane-related events and thus in various forms of physiological and pathological processes. We were therefore interested in analyzing the mRNA expression of the annexins in the severely disorganized pituitaries of the athyroid Pax8–/– mice in comparison with that of control animals. In neither condition was mRNA expression of the annexins A3, A7, A8, A9, A11, and A13 detectable. The annexins A2, A4, and A6 were equally expressed in wild-type and Pax8–/– mice. Transcript levels of A1 and A10 were highly increased and those of A5 were significantly decreased in the athyroid mutants compared with controls. Treatment of Pax8–/– mice with physiological doses of thyroxine for 3 days normalized the mRNA expression of A1, A5, and A10 indicating that the expression of these annexins is directly regulated by thyroid hormone (TH). Since A5 exhibits by far the highest transcript levels of all annexins in the pituitary and its regulation by TH could be also confirmed at the protein level, we analyzed the mRNA expression of pituitary hormones in A5–/– mice. In these mutants, only the ß-FSH mRNA expression was found to be significantly reduced, while the mRNA expression levels of the other pituitary hormones were not altered. These results support the concept that annexins might serve important albeit redundant functions as modulators of pituitary hormone secretion.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The annexins represent an ancient superfamily of structurally related proteins with the common property to bind to phospholipids in the presence of Ca2+. The N-terminal sequence of each annexin is unique and appears to represent the specificity of the individual protein, whereas the highly conserved C-terminal domain, termed the core, comprises four (in annexin 6 eight) repeated sequences of 70 amino acids representing the Ca2+-binding sites (Gerke & Moss 2002). In the Ca2+-bound conformation, the unique architecture of the core enables the proteins to dock onto negatively charged membrane surfaces. This property links annexins to many membrane-related events such as the organization of membrane domains, membrane cytoskeleton linkages, the regulation of ion fluxes across membrane and certain exo- and endocytotic transport steps (Hayes et al. 2004, Rescher & Gerke 2004, Gerke et al. 2005).

The precise function of the individual annexins in physiological processes, however, remains widely enigmatic, although the biochemical and structural features of the different annexins have been studied extensively and a plethora of effects has been assigned to these proteins. Several annexins, such as A1, A2, A3, A6, A7, and A11, have been linked to exocytotic processes such as chromaffin granule exocytosis of adrenergic cells, and many annexins have also been identified in endocrine organs (Creutz 1992, Hayes et al. 2004, Gerke et al. 2005), including annexins A1 and A5 in the anterior pituitary (Traverso et al. 1999, Kawaminami et al. 2002), the master gland of the endocrine system.

We were therefore interested in studying the expression of the annexins in the anterior pituitary not only in wild-type animals but also in the pituitary of the athyroid Pax8–/– mouse. These mice lack the thyroid hormone (TH) producing follicular cells of the thyroid gland and are thus completely athyroid in postnatal life (Mansouri et al. 1998). These mutants can therefore be considered as an ideal animal model to study the consequences of congenital hypothyroidism (CH) which is a common disorder mostly caused by thyroid dysgenesis or agenesis affecting 1 in 3600 newborns (Kopp 2002, De Felice & Di Lauro 2004). If not treated immediately after birth by TH replacement therapy, severe forms of CH lead to cretinism, a syndrome characterized by many metabolic disturbances, growth and mental retardation as well as many neurological deficits (Larsen et al. 2003, Roberts & Ladenson 2004, Bernal 2005). Consequently, untreated Pax8-deficient animals exhibit deafness, ataxia, early death around weaning and a completely distorted appearance of the anterior pituitary such as hypertrophy and hyperplasia of thyrotropes and an almost complete absence of lactotropes (Friedrichsen et al. 2004). Due to the properties of the annexins mentioned above and the findings that in the thyroid several members of the annexin family are regulated by TH (el Btaouri et al. 1996), we also expected major changes in annexin metabolism in the pituitaries of the athyroid Pax8–/– mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

Animal procedures were approved by the Animal Welfare Committee of the Medizinische Hochschule Hannover. Mice were kept at a constant temperature (22 °C) and light cycle (12 h light:12 h darkness) and were provided with standard laboratory chow and tap water ad libitum. Male mice were used for the experiments and wild-type controls were littermates of Pax8–/– and annexin A5–/– mice respectively. If required, Pax8–/– animals were injected for 3 days with physiological doses of thyroxine (T4; P18–P21, 18 ng/g body weight (BW) subcutaneously) to restore a euthyroid status in these mice (Friedrichsen et al. 2004). Genotyping of Pax8 and annexin A5 was performed as described elsewhere (Flamant et al. 2002, Brachvogel et al. 2003). Animals were killed by decapitation at postnatal day 21 (P21), tissues were isolated quickly, frozen on dry ice, and stored at –80 °C until further processing.

Real-time PCR

Total RNA was isolated from pooled mouse pituitaries (n≥4 per gender and genotype, at least three pools) using the Absolutely RNA Microprep Kit (Stratagene, La Jolla, CA, USA). cDNA was generated with the Invitrogen Thermoscript RT-PCR System (Invitrogen) and digested with RNase as suggested by the supplier. Samples without reverse transcriptase were used as negative controls to confirm the absence of genomic DNA. Quantitative real-time PCR was performed using the iCycler iQ Multi-Color Real-time PCR Detection System and the iQ SYBR Green Supermix (Bio-Rad). Cyclophilin was used as housekeeping gene for normalization. Samples were analyzed in triplicate and a dilution series was used in each run to determine the PCR efficiency for each pair of primers. Student's t-test was applied to test for significance. P values below 0.05 were considered as significant and marked as indicated in the figure legends. The following primers were chosen to generate the PCR-fragments:

Cyclophilin: GCAAGGATGGCAAGGATTGA and AGCAATTCTGCCTGGATAGC
Thyroid-stimulating hormone-ß (TSH-ß): CCGCACCATGTTACTCCTTA and GTTCTGACAGCCTCGTGTAT
Prolactin (PRL): GCAGTCACCATGACCATGAA and AGATTGGCAGAGGCTGAACA
Growth hormone (GH): CGCTTCTCGCTGCTGCTCAT and GTCCGAGGTGCCGAACATCA
Follicle-stimulating hormone-ß (FSH-ß): CGCACACCAAGTGGTATTGA and AGAGCAATCTGCTGCCATAG
Luteinizing hormone-ß (LH-ß): AGTACTCGGACCATGCTAGG and CAACTCTGGCCGCAGAGAAT
Annexin A1 (ANXA1): TTCCTCAAGCAGGCCCGTTT and TAAGTACGCGGCCTTGATCT
ANXA2: GTCTACTGTCCACGAAATCC and TCTCCAGGTGGCCAGATAAG
ANXA3: TCACCTTCGGCTGAGCTTCTG and CCTGTTCATACGCTGCTTGG
ANXA4: TCTCCGCACCAGAGGAACTT and TTGCTGCTCAGCTCCGACTT
ANXA5: TTGGCGTGTGCATCGGTCCT and TGGCGCTGAGCATTGCTTCG
ANXA6: TCTGCTGCAGAACCTGAGAC and TCACTATCAGCCGCTCGAAC
ANXA7: CTGCAGGTCAGGAGTCATCT and TGTGCAGGTGGCTGTGGATA
ANXA8: CACTGAGCAGAGGCCAACTA and CCTCTTGGTGAGCACGTCTA
ANXA9: GTGCTTCACGACGCTGAACC and CCACACCTTGGCCTGCGATA
ANXA10: TACCCTGGTTACTTCCTCTC and GGCCATACATGCTCTGATAG
ANXA11: GCTGGATAACGTAGCCAACT and GGCGGATACATTCCATAAGG
ANXA13: GTCTTATCCAGCAGGACATC and TGTTGCTTCGTGTGCATAGG

In vitro transcription

Radioactive- or digoxigenin-labeled RNA probes were generated from cDNA subclones in Bluescript SKII+ plasmids or pGEM plasmids (Promega). In vitro transcription was carried out according to the standard protocols with [35S]UTP and [35S]CTP as labeled nucleotides or using a DIG RNA Labeling Kit (Roche). Probes were generated from cDNA fragments corresponding to nt 632–962 of annexin A1 (accession no. NM010730), nt 529–958 of annexin A5 (accession no. D63423 [GenBank] ), and nt 575–1023 of annexin A10 (accession no. NM011922). Probe generation from cDNAs of pituitary hormones was carried out as described previously (Friedrichsen et al. 2004, Mittag et al. 2005). cRNA probes were diluted in hybridization buffer (50% formamide, 10% dextran sulfate, 0.05% tRNA, 0.6 M NaCl, 10 mM Tris–HCl (pH 7.4), 1x Denhardt's solution, 100 µg/ml sonicated salmon sperm DNA, 1 mM EDTA, and 10 mM dithiothreitol) to a final concentration of 5x104 c.p.m./µl for radioactive-labeled probes and 5 ng/µl for digoxigenin-labeled probes.

In situ hybridization (ISH)

After the animals were decapitated, pituitaries were removed rapidly, embedded in Tissue-Tek medium (Sakura Finetek, Torrance, CA, USA) and frozen on dry ice. Sections (16 µm) were cut on a cryostat (Leica, Bentheim, Germany), thaw-mounted on silane-treated slides, and stored at –80 °C until further processing. ISH was carried out as described previously (Schäfer & Day 1995, Friedrichsen et al. 2003). Briefly, frozen sections were fixed in a 4% phosphate-buffered paraformaldehyde solution (pH 7.4) for 1 h at room temperature (RT), rinsed with PBS, and treated with 0.4% phosphate-buffered Triton X-100 solution for 10 min. After washing with PBS and water, tissue sections were incubated in 0.1 M triethanolamine (pH 8) containing 0.25% (v/v) acetic anhydride for 10 min. Following acetylation, sections were rinsed several times with PBS, dehydrated by successive washing with increasing ethanol concentrations, and air-dried.

Following application of the labeled cRNA probes, sections were coverslipped and incubated in a humid chamber at 58 °C for 16 h. Thereafter, cover slips were removed in 2x SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0). The sections were then treated with RNase A (20 µg/ml) and RNase T1 (1 U/ml) at 37 °C for 30 min. Successive washes followed at RT in 1x, 0.5x, and 0.2x SSC for 20 min each and in 0.2x SSC at 65 °C for 1 h. For digoxigenin-labeled probes, sections were rinsed with P1 (100 mM Tris–HCl, 150 mM NaCl, pH 7.5) and then incubated for 2 h in blocking solution provided by the manufacturer of the kit. After incubation overnight with an anti-digoxigenin antibody conjugated with alkaline phosphatase (1:1000 dilution; Roche), the tissue sections were washed with P1. Staining proceeded for 2–6 h in substrate solution containing nitroblue tetrazolium chloride (340 µg/ml NBT; Biomol, Hamburg, Germany), X-phosphate (175 µg/ml 5-bromo-4-chloro-3-indolyl phosphate; Biomol), 100 mM Tris–HCl, 100 mM NaCl, and 50 mM MgCl2 (pH 9.5). For radioactive probes, the tissue was dehydrated and exposed to Biomax MR Film (Kodak, Sigma–Aldrich) for 48 h. For microscopic analysis, the sections were dipped in NTB2 (Kodak, Integra Biosciences) nuclear emulsion and stored at 4 °C. After exposure for 14 days, autoradiograms were developed in D19 (Kodak, Sigma–Aldrich) for 4 min and fixed in Rapid Fix (Kodak, Sigma–Aldrich) for 4 min. If required, sections were counterstained with Cresyl violet and then photographed under dark- or brightfield illumination. Sense probes that were used to confirm the specificity of the hybridization reaction did not show any signal (data not shown).

Western blot of annexin A5

Three pituitaries of each genotype were pooled and homogenized in 50 µl of 100 mM HEPES (pH 7.0). After centrifugation for 3 min at 8000 g, 10 µl supernatant were applied on a 7% SDS-polyacrylamide gel. Proteins were subsequently transferred to a nitrocellulose membrane (Optitran BA-S 83; Schleicher and Schuell, Dassel, Germany) which was blocked by 3% BSA in PBS. Annexin A5 was detected with a polyclonal rabbit anti-annexin A5 antibody (1:3000; Hyphen, Biomed, Neuville, France) and a rabbit polyclonal anti-ß-actin antibody (1:5000; Abcam, Cambridge, UK) was used for normalization. Primary antibodies were visualized using a horseradish peroxidase-coupled secondary antibody (1:30 000; Promega) and the ECL detection system (Pierce, Rockford, IL, USA).

Determination of serum LH/FSH

Serum levels of FSH and LH were determined as described elsewhere (Haavisto et al. 1993, van Casteren et al. 2000).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of annexin mRNA in pituitaries of wild-type and Pax8–/– animals

Quantitative real-time PCR was used to analyze in wild-type and athyroid Pax8–/– mice the transcript levels of all 12 annexins (Fig. 1). mRNA expression of annexins A3, A7, A8, A9, A11, and A13 was in all analyzed pituitaries below detection limits; and annexins A2, A4, and A6 were found to be equally expressed in the pituitaries of wild-type and Pax8–/– mice. The mRNA levels of annexins A1 and A10 were significantly upregulated under athyroid conditions by a factor of 5 and 30 respectively. In comparison, annexin A5 transcript levels were found to be decreased by half.


Figure 1
View larger version (9K):
[in this window]
[in a new window]

 
Figure 1 mRNA expression of all 12 annexins in the pituitaries of wild-type and Pax8–/– mice at 3 weeks of age as analyzed by real-time PCR. Values (mean±S.E.M.) were normalized against cyclophilin (*P<0.05; **P<0.005).

 
Analysis of annexins A1, A5, and A10 mRNA expression in the pituitary

In order to validate the quantitative real-time PCR data, we determined the mRNA expression pattern of annexins A1, A5, and A10 in pituitary sections of wild-type and Pax8–/– by ISH histochemistry. In agreement with the real-time PCR results, A1-specific labeling in wild-type pituitary sections was close to background, whereas in Pax8–/– mice a scattered expression pattern was observed throughout the anterior lobe (Fig. 2). In contrast, A5 was found to be ubiquitously expressed throughout the anterior pituitary of wild-type mice. These signal intensities were visibly reduced in Pax8–/– animals; however, higher mRNA expression was still found in areas bordering the intermediate lobe. The downregulation of A5 expression in pituitaries of Pax8–/– mice was not only restricted to the mRNA levels, but could also be reproduced by western blot analysis (Fig. 3). With an antibody against A5 (Brachvogel et al. 2003), a prominent band of 36 was clearly visible in pituitary homogenates of wild-type animals, whereas in Pax8–/– pituitaries the A5-specific band was very faint. Finally, in agreement with our real-time PCR data, ISH analysis also revealed that A10 transcripts are not detectable in the pituitaries of wild-type mice, whereas in the pituitaries of Pax8–/– animals very intense and highly clustered signals of A10 mRNA expression were observed (Fig. 2). These signals colocalized with TSH mRNA indicating that A10 is mainly expressed in thyrotropic cells (Supplementary Fig. 1, which can be viewed online at http://joe.endocrinology-journals.org/content/vol195/issue3/).


Figure 2
View larger version (114K):
[in this window]
[in a new window]

 
Figure 2 mRNA expression of annexins A1, A5, and A10 in the pituitaries of 3-week-old wild-type and Pax8–/– mice as analyzed by in situ hybridization histochemistry. Slides were viewed under darkfield illumination. Hybridization signals were not observed with the corresponding sense probes (not shown). Scale bar, 500 µm.

 

Figure 3
View larger version (30K):
[in this window]
[in a new window]

 
Figure 3 Analysis of annexin A5 protein in pituitaries of wild-type and Pax8–/– mice at 3 weeks of age by western blot analysis. Antibodies against ß-actin were used to confirm adequate protein loading.

 
Regulation of Adenohypophyseal annexins A1, A5, and A10 mRNA expression by TH

Changes in transcript levels of A1, A5, and A10 as observed by real-time PCR and ISH could be either due to a direct regulation of these annexins by TH or indirectly due to the altered cellular composition of the pituitary in Pax8–/– mice. In order to differentiate between these two options, we treated Pax8–/– mice with physiological doses of T4 for 3 days, a time period too short to restore normal cell composition. Quantitative real-time PCR revealed that this treatment rapidly normalized the mRNA expression of all three annexins (Fig. 4), strongly indicating that the transcript levels of these annexins are directly regulated by TH.


Figure 4
View larger version (10K):
[in this window]
[in a new window]

 
Figure 4 mRNA expression of annexins A1, A5, and A10 in the pituitaries of 3-week-old wild-type, untreated Pax8–/–, and thyroxine (T4)-treated Pax8–/– mice as assessed by real-time PCR (**P<0.005; ***P<0.001).

 
Pituitary hormone expression in annexin A5-deficient mice

The high expression of annexin A5 in pituitaries of euthyroid control animals prompted us to analyze whether deletion of A5 would affect pituitary hormone expression. Our ISH analysis of hypophyseal hormone expression in A5-deficient mice revealed that compared with controls, the number of FSH-ß expressing cells was reduced and, for LH, a tendency of lower expression was noted. The mRNA expression patterns of TSH-ß, GH, and PRL were not changed (Fig. 5). These results were validated by quantitative real-time PCR (Fig. 6). Compared with wild-type controls, only the ß-FSH mRNA levels were significantly reduced by half in pituitaries of A5–/– mice. ß-LH mRNA levels also showed a tendency towards a decrease in A5-deficient animals, but the difference did not reach statistical significance. When the serum levels of the gonadotropins were analyzed by RIA, we also did not find significant differences between the two genotypes (LH: wt 0.18±0.08 ng/ml versus A5–/– 0.26±0.12 ng/ml; FSH: wt 39.61±2.51 ng/ml versus A5–/– 43.63±2.48 ng/ml; values in mean±S.E.M., P>0.5). The mRNA transcript levels of all other hormones were found to be unaltered.


Figure 5
View larger version (65K):
[in this window]
[in a new window]

 
Figure 5 In situ hybridization analysis of pituitary hormone expression in typical sections of wild-type and annexin A5-deficient mice at 3 weeks of age. TSH, ß-thyroid-stimulating hormone; GH, growth hormone; PRL, prolactin; LH, ß-luteinizing hormone; FSH, ß-follicle-stimulating hormone; POMC, proopiomelanocortin. Scale bar, 500 µm.

 

Figure 6
View larger version (10K):
[in this window]
[in a new window]

 
Figure 6 Analysis of pituitary hormone mRNA expression in wild-type and annexin A5-deficient animals using quantitative real-time PCR. Values (mean+S.E.M.) were normalized against cyclophilin. Wild-type mRNA levels were set to 1 for all hormones. For the abbreviations used, please see legend to Fig. 5 (*P<0.05).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
As in athyroid Pax8–/– mice, the cellular composition of the anterior pituitary is dramatically distorted and various forms of pathological processes alter the expression of most annexins (Gerke & Moss 2002). We were interested in analyzing the expression of the annexins in pituitaries of athyroid Pax8–/– mice and control animals. Of the 12 annexins known, expression of only six members of the annexin family could be reliably detected using real-time PCR. Using this method, mRNA expression of the annexins A3, A7, A8, A9, A11, and A13 was neither detected in the pituitaries of Pax8–/– mice nor in those of control animals. While transcripts of the annexins A2, A4, and A6 were clearly detectable but not significantly different in the mutants compared with wild-type mice, mRNA expression of A1 and A10 was found to be highly upregulated and A5 expression significantly downregulated in the athyroid animals compared with controls. The reciprocal regulation of A1 and A5 corresponds nicely with their opposite roles in the PKC-dependent release of pituitary peptides after glucocorticoid stimulation of rat pituitary cells (John et al. 2002). Interestingly, the expression levels of A1, A5, and A10 rapidly normalized when the athyroid mutants were treated for 3 days with physiological doses of T4 (18 ng/g body weight daily), thus indicating that the gene transcription of these annexins is directly regulated by TH. Our finding fits well with the data of a previous study describing a direct action of TH on the expression of the annexins A1, A2, and A5 in the thyroid gland of rats and thyroid cells in culture (el Btaouri et al. 1996).

In the pituitary, our studies complement previous reports describing the influence of peripheral hormones on A1 expression such as an augmentation by glucocorticoids and an inhibition by estrogen (Philip et al. 1997, Morris et al. 2002, John et al. 2004). Together with the fact that annexin A1 protein is found abundantly in folliculo-stellate cells (Traverso et al. 1999) but not in the endocrine cells of the pituitary, these data fit well with the concept that annexin A1 acts as a paracrine or juxtacrine mediator of pituitary hormone secretion (John et al. 2004). This interpretation is further supported by an apparently low turnover of the A1 protein. As shown here, A1 mRNA in the pituitary is expressed at very low levels while A1 protein is known to be present in large amounts and easy to detect immunohistochemically in folliculo-stellate cells (Traverso et al. 1999). Via the intrapituitary communication system established by these cells (Fauquier et al. 2001, 2002), the multihormonal regulation of annexin A1 expression might thus provide an integrative mechanism to balance pituitary hormone secretion according to the overall hormonal condition of the organism. This hypothesis fits well with the observation that annexin 1 is required for glucocorticoids to exert an inhibitory effect on the release of TSH (Taylor et al. 1995).

Annexin A5 exhibits the highest transcript levels of all annexins expressed in the anterior pituitary and our analysis by in situ hybridization histochemistry revealed a rather ubiquitous distribution of A5 transcripts among all cells of the anterior pituitary. Compared with control animals, the athyroid Pax8–/– mice exhibited significantly decreased A5 mRNA levels which rapidly normalized after treatment with physiological doses of T4. Together with the fact that ovariectomy increases the expression of A5 in rat pituitary gonadotropes (Kawaminami et al. 1998b), this demonstrates again that the expression of annexin A5 is also controlled by more than one peripheral hormone and thereby indicates that A5 might also serve modulatory functions.

Immunohistochemical studies previously suggested that A5 is expressed preferentially but not exclusively in pituitary gonadotropes (Kawaminami et al. 1998a, 2004) and in vitro studies indicated that A5 not only enhances gonadotropin secretion following stimulation by gonadotrophin-releasing hormone (GnRH; Kawaminami et al. 2002), but also stimulates basal PRL secretion while counteracting thyrotrophin-releasing hormone (TRH) induced PRL release albeit at exceedingly high concentrations (Kawaminami et al. 2004). However, in vivo studies deciphering a biological function of A5 in the pituitary or other tissues are still missing and mice with a targeted disruption of the A5 gene have not revealed any obvious abnormalities (Brachvogel et al. 2003), presumably due to the redundant function of other family members. In agreement with the inconspicuous phenotype of the A5-deficient animals, our analysis of the pituitaries from A5-deficient mice revealed only some reduction in the expression of ß-FSH mRNA, while the transcript levels of the other pituitary hormones were not significantly altered. As ß-FSH and ß-LH are both produced in the gonadotropes, one would also expect the levels of ß-LH to be lowered. Although such a tendency could be observed in A5-deficient mice, this difference did not reach statistical significance. This could be either due to the high biological variance in LH levels or to a greater influence of A5 on ß-FSH than on ß-LH expression. The predominant regulation of one gonadotropin is remarkable, but not unusual as it also occurs for other modulating factors such as steroidogenic factor 1 (Brown & McNeilly 1999). Although we cannot exclude at present the possibility that A5 may be also involved in secretory processes, the difference in ß-FSH mRNA expression does not seem to be of major biological relevance, since the gonadotropin serum levels are not altered and the reproductive capacity of A5-deficient mice is not impaired (Brachvogel et al. 2003).

Among all annexins expressed in the pituitary, A10 mRNA expression, almost undetectable in control animals and T4-treated Pax8-deficient mice, is most strongly influenced by the athyroidism of the mutants. Unfortunately, very little is known about the role of annexins A10 and A10 knockout mice have not been generated to date to elucidate the biological function of this annexin; therefore, there is no basis for any speculation.

In agreement with previous studies in the field of annexin research, our analysis of TH regulated annexin expression in the pituitary supports the concept that these molecules might function as modulators rather than as essential factors of different endocrine processes. In the belief that the functions of specific annexins are concealed by possible redundancies in the family, there is hope that the generation of animals deficient in multiple annexins might provide a clue as to the biological role of these intriguing molecules in pituitary physiology.


    Acknowledgements
 
We thank Melanie Kraus and Petra Affeldt for excellent technical assistance, Ahmed Mansouri and Peter Gruss for kindly providing Pax8+–/– animals, and Valerie Ashe for linguistic help. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bernal J 2005 Thyroid hormones and brain development. Vitamins and Hormones 71 95–122.[CrossRef][Web of Science][Medline]

Brachvogel B, Dikschas J, Moch H, Welzel H, von der Mark K, Hofmann C & Poschl E 2003 Annexin A5 is not essential for skeletal development. Molecular and Cellular Biology 23 2907–2913.[Abstract/Free Full Text]

Brown P & McNeilly AS 1999 Transcriptional regulation of pituitary gonadotrophin subunit genes. Reviews of Reproduction 4 117–124.[Abstract]

el Btaouri H, Claisse D, Bellon G, Antonicelli F & Haye B 1996 In vivo modulation of annexins I, II and V expression by thyroxine and methylthiouracil. European Journal of Biochemistry 242 506–511.[Web of Science][Medline]

van Casteren JI, Schoonen WG & Kloosterboer HJ 2000 Development of time-resolved immunofluorometric assays for rat follicle-stimulating hormone and luteinizing hormone and application on sera of cycling rats. Biology of Reproduction 62 886–894.[Abstract/Free Full Text]

Creutz CE 1992 The annexins and exocytosis. Science 258 924–931.[Abstract/Free Full Text]

Fauquier T, Guerineau NC, McKinney RA, Bauer K & Mollard P 2001 Folliculostellate cell network: a route for long-distance communication in the anterior pituitary. PNAS 98 8891–8896.[Abstract/Free Full Text]

Fauquier T, Lacampagne A, Travo P, Bauer K & Mollard P 2002 Hidden face of the anterior pituitary. Trends in Endocrinology and Metabolism 13 304–309.[CrossRef][Web of Science][Medline]

De Felice M & Di Lauro R 2004 Thyroid development and its disorders: genetics and molecular mechanisms. Endocrine Reviews 25 722–746.[Abstract/Free Full Text]

Flamant F, Poguet AL, Plateroti M, Chassande O, Gauthier K, Streichenberger N, Mansouri A & Samarut J 2002 Congenital hypothyroid Pax8(–/–) mutant mice can be rescued by inactivating the TR{alpha} gene. Molecular Endocrinology 16 24–32.[Abstract/Free Full Text]

Friedrichsen S, Christ S, Heuer H, Schäfer MKH, Mansouri A, Bauer K & Visser TJ 2003 Regulation of iodothyronine deiodinases in the Pax8–/– mouse model of congenital hypothyroidism. Endocrinology 144 777–784.[Abstract/Free Full Text]

Friedrichsen S, Christ S, Heuer H, Schäfer MKH, Parlow AF, Visser TJ & Bauer K 2004 Expression of pituitary hormones in the Pax8–/– mouse model of congenital hypothyroidism. Endocrinology 145 1276–1283.[Abstract/Free Full Text]

Gerke V & Moss SE 2002 Annexins: from structure to function. Physiological Reviews 82 331–371.[Abstract/Free Full Text]

Gerke V, Creutz CE & Moss SE 2005 Annexins: linking Ca2+ signalling to membrane dynamics. Nature Reviews. Molecular Cell Biology 6 449–461.[CrossRef][Web of Science][Medline]

Haavisto AM, Pettersson K, Bergendahl M, Perheentupa A, Roser JF & Huhtaniemi I 1993 A supersensitive immunofluorometric assay for rat luteinizing hormone. Endocrinology 132 1687–1691.[Abstract/Free Full Text]

Hayes MJ, Rescher U, Gerke V & Moss SE 2004 Annexin–actin interactions. Traffic 5 571–576.[CrossRef][Web of Science][Medline]

John C, Cover P, Solito E, Morris J, Christian H, Flower R & Buckingham J 2002 Annexin 1-dependent actions of glucocorticoids in the anterior pituitary gland: roles of the N-terminal domain and protein kinase C. Endocrinology 143 3060–3070.[Abstract/Free Full Text]

John C, Christian H, Morris J, Flower R, Solito E & Buckingham J 2004 Annexin 1 and the regulation of endocrine function. Trends in Endocrinology and Metabolism 15 103–109.[CrossRef][Web of Science][Medline]

Kawaminami M, Kawamoto T, Tanabe T, Yamaguchi K, Mutoh K, Kurusu S & Hashimoto I 1998a Immunocytochemical localization of annexin 5, a calcium-dependent phospholipid-binding protein, in rat endocrine organs. Cell and Tissue Research 292 85–89.[CrossRef][Web of Science][Medline]

Kawaminami M, Yamaguchi K, Miyagawa S, Numazawa S, Ioka H, Kurusu S & Hashimoto I 1998b Ovariectomy enhances the expression and nuclear translocation of annexin 5 in rat anterior pituitary gonadotrophs. Molecular and Cellular Endocrinology 141 73–78.[CrossRef][Web of Science][Medline]

Kawaminami M, Etoh S, Miyaoka H, Sakai M, Nishida M, Kurusu S & Hashimoto I 2002 Annexin 5 messenger ribonucleic acid expression in pituitary gonadotropes is induced by gonadotropin-releasing hormone (GnRH) and modulates GnRH stimulation of gonadotropin release. Neuroendocrinology 75 2–11.[CrossRef][Web of Science][Medline]

Kawaminami M, Senda A, Etoh S, Miyaoka H, Kurusu S & Hashimoto I 2004 Annexin 5 inhibits thyrotropin releasing hormone (TRH) stimulated prolactin release in the primary culture of rat anterior pituitary cells. Endocrine Journal 51 349–354.[CrossRef][Web of Science][Medline]

Kopp P 2002 Perspective: genetic defects in the etiology of congenital hypothyroidism. Endocrinology 143 2019–2024.[Abstract/Free Full Text]

Larsen PR, Davies TF, Schlumberger H & Hay ID 2003 Thyroid physiology and diagnostic evaluation of patients with thyroid disorders. In Williams Textbook of Endrocrinology , pp 331–456. Eds PR Larsen, S Melmed & KS Polonsky. Philadelphia: Saunders.

Mansouri A, Chowdhury K & Gruss P 1998 Follicular cells of the thyroid gland require Pax8 gene function. Nature Genetics 19 87–90.[CrossRef][Web of Science][Medline]

Mittag J, Friedrichsen S, Heuer H, Polsfuss S, Visser TJ & Bauer K 2005 Athyroid Pax8–/– mice cannot be rescued by the inactivation of thyroid hormone receptor alpha1. Endocrinology 146 3179–3184.[Abstract/Free Full Text]

Morris JF, Christian HC, Chapman LP, Epton MJ, Buckingham JC, Ozawa H, Nishi M & Kawata M 2002 Steroid effects on secretion from subsets of lactotrophs: role of folliculo-stellate cells and annexin 1. Archives of Physiology and Biochemistry 110 54–61.[CrossRef][Medline]

Philip JG, Flower RJ & Buckingham JC 1997 Glucocorticoids modulate the cellular disposition of lipocortin 1 in the rat brain in vivo and in vitro. Neuroreport 8 1871–1876.[Web of Science][Medline]

Rescher U & Gerke V 2004 Annexins – unique membrane binding proteins with diverse functions. Journal of Cell Science 117 2631–2639.[Abstract/Free Full Text]

Roberts CG & Ladenson PW 2004 Hypothyroidism. Lancet 363 793–803.[CrossRef][Web of Science][Medline]

Schäfer MKH & Day R 1995 In situ hybridization techniques to study processing enzyme expression at the cellular level. Journal of Neuroscience Methods 23 16–44.[CrossRef]

Taylor AD, Flower RJ & Buckingham JC 1995 Dexamethasone inhibits the release of TSH from the rat anterior pituitary gland in vitro by mechanisms dependent on de novo protein synthesis and lipocortin 1. Journal of Endocrinology 147 533–544.[Abstract/Free Full Text]

Traverso V, Christian HC, Morris JF & Buckingham JC 1999 Lipocortin 1 (annexin 1): a candidate paracrine agent localized in pituitary folliculo-stellate cells. Endocrinology 140 4311–4319.[Abstract/Free Full Text]

Received in final form 11 September 2007
Accepted 13 September 2007
Made available online as an Accepted Preprint 13 September 2007





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Figure
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mittag, J.
Right arrow Articles by Bauer, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mittag, J.
Right arrow Articles by Bauer, K.


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS