JOE
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2007) 195, 113-123       DOI: 10.1677/JOE-07-0306
© 2007 Society for Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kiely, A.
Right arrow Articles by Newsholme, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kiely, A.
Right arrow Articles by Newsholme, P.

Pro-inflammatory cytokines increase glucose, alanine and triacylglycerol utilization but inhibit insulin secretion in a clonal pancreatic ß-cell line

Aoife Kiely, Neville H McClenaghan1, Peter R Flatt1 and Philip Newsholme

School of Biomolecular and Biomedical Sciences, Conway Institute, University College Dublin, Belfield, Dublin 4, Ireland
1 School of Biomedical Sciences, University of Ulster, Coleraine, Northern Ireland

(Correspondence should be addresses to P Newsholme; Email: philip.newsholme{at}ucd.ie)


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have investigated the effects of prolonged exposure (24 h) to pro-inflammatory cytokines on ß-cell metabolism and insulin secretion using clonal BRIN-BD11 ß cells. Addition of IL-1ß, tumour necrosis factor-{alpha} and IFN-{gamma} (at concentrations that did not induce apoptosis) inhibited chronic (24 h) and acute stimulated levels of insulin release (by 59 and 93% respectively), increased cellular glucose and alanine consumption, and also elevated lactate and glutamate release. However, ATP levels and cellular triacylglycerol were decreased while glutathione was increased. We conclude that sub-lethal concentrations of pro-inflammatory cytokines appear to shift ß-cell metabolism away from a key role in energy generation and stimulus–secretion coupling and towards a catabolic state which may be related to cell defence.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nutrient metabolism is tightly coupled to insulin secretion in the pancreatic ß cell (McClenaghan 2007). Mitochondrial metabolism is crucial for the coupling of glucose and amino acid recognition to exocytosis of insulin granules. This is illustrated by in vitro and in vivo observations that mitochondrial dysfunction severely impairs insulin secretion. Mitochondria generate ATP which, in addition to Ca2+, is the main coupling messenger in insulin secretion. Mitochondria generate additional coupling factors, which serve as sensors for the control of the exocytotic process (Wollheim 2000, Maechler 2002). Numerous studies have sought to identify the factors that mediate the key amplifying pathway over the Ca2+ signal in nutrient-stimulated insulin secretion. Predominantly, these factors are nucleotides (ATP, GTP, cAMP and NADPH), although metabolites have also been proposed, such as long-chain acyl-CoA derivatives and glutamate (Maechler & Wollheim 1999). Glucose, alanine and glutamine metabolism in the ß cell may generate many, if not all, of the mitochondrial factors described above (Brennan et al. 2002, 2003, Dixon et al. 2003, Newsholme et al. 2003, Corless et al. 2006). Glucose has been reported to protect ß cells from apoptosis (Hoorens et al. 1996), while glutamine has been reported to afford protection from apoptosis in a wide variety of cells (Curi et al. 2005).

We have previously presented 13C NMR data which provided novel evidence for substantial intracellular pancreatic ß-cell metabolism of L-glutamine resulting in the formation of L-glutamate, L-aspartate and glutathione (GSH; Brennan et al. 2003). We proposed that L-glutamate production is important to the ß cell as an intermediate of the {gamma}-glutamyl cycle, which regulates cellular GSH concentration. We have also reported that L-alanine or L-glutamine can chronically regulate gene expression in the clonal ß-cell line BRIN-BD11 (Cunningham et al. 2005, Corless et al. 2006). Differentially regulated genes included the anti-oxidant enzyme catalase and the key regulatory fatty acid synthesis enzyme acetyl-CoA carboxylase (ACC). As both the cell redox status and acyl-CoA derivatives are important for optimal regulation of insulin secretion, chronic amino acid exposure may alter chronic levels of insulin secretion.

Glucose-stimulated insulin secretion was reduced after exposure to the pro-inflammatory cytokines IL-1ß, tumour necrosis factor-{alpha} (TNF-{alpha}) and IFN-{gamma} in human, mouse and rat islets (Cunningham & Green 1994). Primary pancreatic islets from rats or mice demonstrated reduced glucose oxidation and pyruvate dehydrogenase (PDH) activity after incubation in relatively high concentrations of IL-1ß or TNF-{alpha} respectively (Eizirik et al. 1988, Park et al. 1999). High concentrations of pro-inflammatory cytokines (IL-1ß, TNF-{alpha} and IFN-{gamma}) are also known to increase apoptosis in both pancreatic ß-cell lines and primary islet cells (Rabinovitch et al. 1996). The mechanism by which these pro-inflammatory cytokines induce ß-cell apoptosis may be partially dependent on increased inducible nitric oxide (iNOS) expression and nitric oxide (NO) generation. In a recent paper, it was reported that 46% of the genes modified by cytokines after 8–24 h exposure were NO dependent (Kutlu et al. 2003), but inhibition of NO production did not protect INS-1E cells from apoptosis. Similarly in iNOS knockout mice, the rate of apoptosis in primary islets was delayed but not prevented (Liu et al. 2000).

Reactive oxygen species (ROS) may contribute to ß-cell dysfunction and apoptosis. The source of ROS may be mitochondrial or the plasma membrane associated NADPH oxidase. Expression of a functional NADPH oxidase in islet cells was recently reported, as was up-regulation by IL-1ß or a cocktail of IL-1ß, TNF-{alpha} and IFN-{gamma} (Oliveira et al. 2003, Morgan et al. 2007). Up-regulation of O2 generation in the ß cell may lead to ROS-dependent damage and also peroxynitrite formation (following the reaction of O2 with NO) resulting in subsequent induction of apoptosis. The generation of NO and ROS requires metabolic input, firstly to provide L-arginine, a substrate for NO synthesis, and secondly to provide NADPH, required for both NO and ROS production from iNOS and NADPH oxidase respectively. Indeed, the largest cluster of genes altered on addition of IL-1ß and IFN-{gamma} in primary rat ß cells was associated with metabolism (Cardozo et al. 2001).

We hypothesized that exposure of ß cells to low, non-lethal concentrations of cytokines would initiate a change in metabolism that would favour cell defence at the expense of insulin secretion. Indeed, we now report that chronic (24 h) exposure of clonal BRIN-BD11 ß cells to sub-lethal concentrations of IL-1ß, TNF-{alpha} and IFN-{gamma} inhibited chronic and acute levels of insulin secretion (by 59 and 93% respectively) but induced significant increases in glucose, alanine and triacylglycerol utilization and glutamate release. The clonal ß-cell line BRIN-BD11 was chosen for this work as metabolic, signalling, insulin secretory and cell viability responses to glucose, amino acids as well as other stimuli have been well characterized (McClenaghan et al. 1996a, Chapman et al. 1999, McClenaghan & Flatt 1999, Brennan et al. 2002, 2003).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Culture of BRIN-BD11 pancreatic ß cells

Clonal insulin-secreting BRIN-BD11 cells were maintained in RPMI-1640 tissue culture medium supplemented with 10% (v/v) fetal calf serum (FCS), 0.1% antibiotics (100 U/ml penicillin and 0.1 mg/ml streptomycin) and 11.1 mmol/l D-glucose, pH 7.4. The origin of BRIN-BD11 cells are described elsewhere (McClenaghan et al. 1996a,b). These cells provide an appropriate ß-cell model as evidenced by studies of insulin secretion (McClenaghan et al. 1996a,b, McClenaghan & Flatt 1999), ß-cell metabolism (Brennan et al. 2002, 2003, McClenaghan 2007), electrophysiology (Chapman et al. 1999), Ca2+ handling (Van Eylen et al. 2002) and cellular defence (Conroy et al. 2002).

The cells were maintained at 37 °C in a humidified atmosphere of 5% CO2 and 95% air using a Forma Scientific incubator (Marietta, OH, USA). The cells were cultured in 50–70 ml RPMI-1640 tissue culture medium in T175 sterile tissue culture flasks. Cells were subsequently seeded into six-well plates (1.5 x 106 cells per well) and allowed to adhere overnight. Cells were then washed with PBS after which they were incubated in fresh media, containing 11.1 mM D-glucose, 2 mM L-glutamine or other as described below, in the absence or presence of a pro-inflammatory cytokine cocktail (IL-1ß 0.3125 U/ml, TNF{alpha} 31.25 U/ml, IFN{gamma} 15.625 U/ml). After 24-h incubation, an aliquot of the media was removed and centrifuged at 200 g for 5 min and used for quantitation of insulin and metabolites (D-glucose, L-glutamine, L-alanine, L-glutamate, TAG and GSH).

Enzymatic determination of metabolites

Glucose  The standard glucose concentration in RPMI 1640 medium at the beginning of incubation (11.1 mmol/l in the presence of 2 mmol/l glutamine) and 24 h after culture was determined using a commercially available kit (Sigma). The glucose utilized over the 24-h period was calculated by subtracting the concentration at 24 h from that at 0 h.

L-Alanine  The alanine concentration at the beginning of incubation (10 mmol/l added to standard RPMI 1640 containing 11.1 mmol/l glucose and 2 mmol/l glutamine) and 24 h after culture was determined by a spectrophotometric assay based on the oxidation of L-alanine to pyruvic acid and ammonia in the presence of NAD+ and alanine dehydrogenase. The increase in absorbance at 339 nm due to formation of NADH was used to quantify the amount of L-alanine consumed (Dixon et al. 2003).

L-Glutamine and L-glutamate  The glutamine concentration at the beginning (2 mmol/l in the presence of 11.1 mmol/l glucose) and 24 h after culture was determined based on its hydrolysis to glutamic acid and ammonium ions (NH4+) in a reaction catalysed by asparaginase. NH4+ generated combined with 2-oxoglutarate in the presence of NADH to form glutamic acid, NAD+ and water. The concentration of glutamine in the sample was quantified indirectly by measuring the decrease in absorbance at 340 nm due to the conversion of NADH into NAD+. (Dixon et al. 2003). The L-glutamate concentration in the culture media was measured using a glutamate dehydrogenase (GDH)-based diagnostic kit (Roche Diagnostics). The L-glutamine is hydrolysed to L-glutamate spontaneously at 37 °C at a rate of approximately 5%/24 h over a concentration range of 1–20 mM. This spontaneous rate of hydrolysis was taken into account when calculating rates of glutamate or NH4+ production.

Triacylglycerol (triglyceride)  Cellular triacylglycerol content was measured as outlined by Dixon et al.(2003). Following 24-h culture in the presence or absence of the cytokine cocktail, cells were washed with PBS, trypsinized and resuspended in 2 mM NaCl, 20 mM EDTA, and 50 mM sodium phosphate (pH 7.4) and sonicated for 1–2 min. Homogenate measuring 10 µl was mixed with 10 µl tert-butyl alcohol and 5 µl triton-X-100/methyl alcohol (1:1, v/v) for the extraction of the lipids. Triacylglyerol was determined using a commercial kit (Human, Wiesbaden, Germany) and expressed as µg/mg protein.

Oxidized and total GSH  Oxidized glutathione (GSSG) was quantified in a microtitre plate according to the technique of Baker et al.(1990) using the method originally described by Tietze (1969). Cell lysate or GSSG standards (0–500 pmol of GSx/microlitre) were transferred into a microtitre plate and diluted with water. After addition of reaction mixture (0.1 M sodium phosphate buffer (pH 7.5) containing 1 mM EDTA, 0.3 mM DTNB, 0.4 mM NADPH and 1 U/ml GSH reductase, the increase in absorbance at 405 nm was detected at 15-s intervals over a range of 2.5 min using a microtitre plate reader. GSH contents were evaluated using a calibration curve. Intracellular reduced GSH) was measured using the membrane-permeant monochlorobimane (Kamencic et al. 2000). Monochlorobimane readily enters the cell where it forms a fluorescent GSH-monochlorobimane adduct that can be measured fluorometrically. This reaction is catalysed by intracellular GSH-S-transferase. This method was used to semi-quantitatively measure the increase or decrease in intracellular GSH after treatment with the cytokine cocktail.

ATP  ATP was determined using the luciferase assay (Biovision, Cambs, UK). After 24-h incubation in the presence or absence of the cytokine cocktail, cells were lysed and ATP quantified using the luciferase assay and extrapolated from a standard curve.

Protein determination

Cellular protein was determined using a BCA protein assay kit (Pierce, Rockford, IL, USA kit no. 23225), which utilizes a modification of the biuret reaction.

Western blot analysis

Using RIPA lysis buffer (Upstate Biochemicals, Lake Placid, NY, USA), 20 µg BRIN-BD11 cell protein extracts were prepared. Samples were subsequently subjected to 6% SDS-PAGE and electrophoretically transferred onto a nitrocellulose sheet. The sheet was blocked in 5% milk protein and incubated with polyclonal anti-ACC, AMPK (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or 3% BSA and incubated with polyclonal AMPK-P (adenosine 5'-monophosphate activated kinase-phosphorylated). The blots were washed and probed with horseradish peroxidase and visualized with Supersignal West Pico chemiluminescent substrate (Pierce).

RT-PCR

Total RNA was extracted from BRIN-BD11 cells using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol applying 50–100 mg of cell extract per 1 mL TRIzol reagent. DNase-treated RNA samples were then used as templates for cDNA synthesis using appropriate primers for LDH (forward primer CCGTTACCTGATGGGAGAAA, reverse primer TTATGCTCTCGGCCAAGTCT) or GAPDH as control. The PCR products were resolved on a 1% agarose gel and the intensity of ethidium bromide staining was quantified using the GeneGenius gel documentation and analysis system. Lactate dehydrogenase (LDH) expression changes were calculated relative to the GAPDH expression as a control.

Chronic (24 h) and acute levels of insulin secretion

BRIN-BD11 cells were seeded in 24-well plates (1 x 105 cells/well) in RPMI-1640 medium containing 11.1 mM D-glucose in the absence or presence of the cytokine cocktail (IL-1ß 0.3125 U/ml, TNF{alpha} 31.25 U/ml, IFN{gamma} 15.625 U/ml). After 24-h incubation, an aliquot of the media was removed and centrifuged at 200 g for 5 min and analysed for insulin content using the Mercodia Ultrasenstive Rat Insulin ELISA kit (Uppsala, Sweden). Additionally, some cells were further incubated for 40 min in the presence of 1.1 mmol/l glucose followed by 20 min in the presence of 16.7 mM glucose and 10 mM alanine (a stimulus that results in a robust and reproducible secretory response in normal conditions, McClenaghan et al. 1996a,b, Brennan et al. 2002), when an aliquot of the incubation medium was removed, centrifuged at 200 g for 5 min and analysed for insulin using the Mercodia Ultrasenstive Rat Insulin ELISA kit. The insulin content of cells was not significantly different in any of the incubation conditions described in this paper.

Statistical analysis

The results are presented as mean ± S.D. Groups of data were compared using a Student’s unpaired t-test or ANOVA where appropriate. Differences were considered significant at a P value of <0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pro-inflammatory cytokine-induced changes in cellular integrity

Cell integrity was investigated by use of three different methods. LDH release can be determined after loss of plasma membrane integrity. This assay demonstrated that there was no significant change in % cell death after 24-h treatment with the pro-inflammatory cytokine cocktail up to and including a concentration of 1/16 x (1 x consisted of IL-1ß 5 U/ml, TNF{alpha} 500 U/ml, IFN{gamma} 250 U/ml). At 1/8 x there was an increase from 9.9 ± 4.7 to 16.3 ± 4.2% P = 0.057. At higher concentrations of 1/4 x and 1/2 x , there were further losses in cellular plasma membrane integrity (Fig. 1AGo). Examination of mitochondrial viability using the MTT assay demonstrated that there was no significant change in activity after treatment with the pro-inflammatory cytokine cocktail up to and including 1/2 x (with respect to IL-1ß 5 U/ml, TNF{alpha} 500 U/ml, IFN{gamma} 250 U/ml). This result would indicate that BRIN-BD11 cell mitochondria are relatively resistant to cytokine-induced damage.


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
Figure 1 Determination of BRIN-BD11 cellular integrity after 24-h treatment with various concentrations of a pro-inflammatory cytokine cocktail. BRIN-BD11 cells were incubated in RPMI-1640 media supplemented with 10% (v/v) FCS and 2 mmol/l glutamine. Cell integrity (%) was measured by either LDH release compared with total LDH concentrations (A), determination of mitochondrial viability using the MTT assay (B) or determining the level of apoptosis and necrosis (C) using a DNA fragmentation assay (Roche Diagnostics). Cytokine levels used in cell incubations were dilutions from a stock of concentration; 1 x = IL-1ß (10 ng/ml), TNF-{alpha} (7.5 ng/ml), IFN-{gamma} (500 ng/ml), which is equivalent to IL-1ß (5 U/ml), TNF-{alpha} (500 U/ml), IFN-{gamma} (250 U/ml). Results are expressed as mean ± S.D. *P<0.05, **P<0.01.

 
Assessment of apoptotic cell death by determination of DNA fragmentation, based on an ELISA, demonstrated that there was no significant change in apoptotic cell death after 24-h treatment with the pro-inflammatory cytokine cocktail, up to and including 1/16 x (where 1 x = IL-1ß 5 U/ml, TNF{alpha} 500 U/ml, IFN{gamma} 250 U/ml). A fourfold increase in fragmentation was seen after treatment with 1/8 x which further increased to a sevenfold increase after treatment with 1/2 x (Fig. 1CGo). Examination of necrotic cell death using the DNA ELISA revealed that there was no significant increase in necrotic death until a cocktail concentration of 1/4 x was used, which resulted in a fourfold increase in necrosis which further increased to a fivefold increase after treatment with a concentration of 1/2 x (Fig. 1CGo).

Pro-inflammatory cytokine induced-changes in glucose, alanine and glutamine consumption

The concentration of the cytokine cocktail chosen for further experiments was 1/16 x (corresponding to final incubation concentrations of IL-1ß 0.3125 U/ml, TNF{alpha} 31.25 U/ml and IFN{gamma} 15.625 U/ml) as this concentration did not result in significant changes in cellular integrity. There was a twofold significant increase in glucose consumption after treatment with the pro-inflammatory cytokine cocktail (20.47 ± 5.31 to 44.61 ± 6.67 µmol glucose/mg protein/24 h, P<0.001; Fig. 2AGo).


Figure 2
View larger version (13K):
[in this window]
[in a new window]

 
Figure 2 The effect of pro-inflammatory cytokines on glucose, glutamine and alanine consumption and lactate, glutamate and glutathione production in BRIN-BD11 cells. Cells were incubated in RPMI-1640 media supplemented with 10% (v/v) FCS and 2 mmol/l glutamine and 10 mmol/l alanine where indicated. Glucose (A), alanine (B) and glutamine (C) consumption after 24-h treatment of BRIN-BD11 cells with the pro-inflammatory cytokine cocktail. Lactate (D), glutamate (E) and glutathione (F) production after 24-h treatment of BRIN-BD11 cells with the pro-inflammatory cytokine cocktail. Results are n = 6 in duplicate (A, C–E), n = 3 in duplicate (B), n = 3 (F). *P<0.05, **P<0.01, ***P<0.001.

 
Alanine consumption was also significantly increased after treatment with the pro-inflammatory cytokine cocktail (4.38 ± 2.31 to 10.92 ± 1.90 µmol alanine/mg protein/24 h, P<0.01), corresponding to a 150% increase in alanine consumption over the 24-h period (Fig. 2BGo). In contrast, glutamine consumption was significantly decreased by the pro-inflammatory cytokine cocktail (9.90 ± 0.49 to 7.00 ± 0.21 µmol glutamine/mg protein/24 h, P<0.01), corresponding to a 29% reduction in glutamine consumption over the 24-h period (Fig. 2CGo).

Pro-inflammatory cytokine-induced changes in lactate, glutamate and GSH production

A 271% increase in lactate production was observed after treatment with the pro-inflammatory cytokine cocktail. After 24-h incubation, lactate production had increased from 15.87 ± 6.09 to 58.81 ± 13.11 µmol lactate/mg protein, P<0.001 (Fig. 2DGo). LDH expression and activity were determined after 24-h incubation in the absence or presence of the pro-inflammatory cytokine cocktail. The LDH expression was not altered after exposure to the pro-inflammatory cytokine cocktail (Fig. 3A and BGo) and neither was Vmax activity determined via kinetic plot (Vmax after incubation in the absence or presence of the pro-inflammatory cytokines for 24 h was 453 ± 52 or 579 ± 124 nmol/mg protein/min respectively). Glutamate release significantly increased from 0.87 ± 0.28 to 1.30 ± 0.28 µmol glutamate/mg protein after 24 h, a 49% increase in glutamate release, P<0.05 (Fig. 2EGo). Intracellular levels of reduced GSH, significantly increased by 1.6-fold after 24 h, P<0.001 (Fig. 2FGo). Similarly intracellular levels of GSSG, were increased by 1.4-fold after treatment with the pro-inflammatory cytokine cocktail for 24 h, P = 0.07.


Figure 3
View larger version (8K):
[in this window]
[in a new window]

 
Figure 3 The effect of pro-inflammatory cytokines on BRIN-BD11 ß-cell lactate dehydrogenase expression. RT-PCR analysis of LDH expression levels in BRIN-BD11 cells incubated for 24 h in the absence or presence of the pro-inflammatory cytokine cocktail. RNA extraction and analysis was as described in the Materials and Methods section. The PCR products were resolved on a 1% agarose gel (A) and the intensity of ethidium bromide staining was quantified using the GeneGenius gel documentation and analysis system before displaying relative to GAPDH (B).

 
Pro-inflammatory cytokine-induced changes in ATP concentration and insulin secretion

ATP concentration was determined by luciferase assay after treatment for 24 h in the presence of various concentrations of the pro-inflammatory cytokine cocktail. There was a 20% reduction in intracellular ATP concentration (from 47.56 ± 9.20 to 38.04 ± 4.14 pmol ATP per mg protein, P<0.01, Fig. 4AGo). The fall in ATP content after 24 h may reflect increased rates of consumption of ATP relative to generation.


Figure 4
View larger version (14K):
[in this window]
[in a new window]

 
Figure 4 The effect of pro-inflammatory cytokines on ATP levels and insulin secretion in BRIN-BD11 cells. Exposure to a pro-inflammatory cytokine cocktail for 24 h changed intracellular ATP concentration (A), chronic levels of insulin secretion (B) and acute stimulation of insulin secretion using a stimulus of 16.7 mM glucose plus 10 mM alanine (C) from BRIN-BD11 cells. Results are expressed as mean ± S.D. *P<0.05, **P<01, ***P<0.001 compared with incubation in the absence of cytokines.

 
A 59% reduction in chronic insulin secretion was observed after 24-h treatment of BRIN-BD11 cells with the pro-inflammatory cytokine cocktail. Total insulin secreted over the 24-h period was reduced from 39 ± 7 to 16 ± 3 µg insulin/mg protein/24 h, P<0.001 (Fig. 4BGo). A more dramatic inhibition of an acute (40 min) nutrient stimulus (16.7 mM glucose plus 10 mM alanine) of insulin secretion was observed after 24-h treatment of BRIN-BD11 cells with the pro-inflammatory cytokine cocktail. A 93% reduction in stimulated insulin secretion (over basal) was observed (Fig. 4CGo).

Pro-inflammatory cytokine-induced changes in ACC AMPK, AMPK-P protein expression and triacylglycerol levels

Fatty acid synthesis is essential for acute and chronic stimulation of insulin secretion (see Newsholme et al. 2007 for review). Fatty acid synthesis is regulated by the enzyme ACC which itself is covalently modified by phosphorylation by the AMP-regulated kinase (AMPK). Phosphorylation of ACC by AMPK will reduce activity. No change in the expression of the key fatty acid synthesis enzyme ACC was observed after 24-h incubation in the presence of the pro-inflammatory cytokine cocktail, P = 0.63 (Fig. 5AGo).


Figure 5
View larger version (26K):
[in this window]
[in a new window]

 
Figure 5 The effect of pro-inflammatory cytokines on ACC, AMPK and intracellular triacylglycerol levels in BRIN-BD11 cells. Protein expression of ACC1, AMPK and phosphorylated AMPK in BRIN-BD11 cells were determined by western blot analysis (Panels A, B, C respectively) after 24-h treatment with the pro-inflammatory cytokine cocktail. Results are expressed as mean ± S.D. using GAPDH as an expression control (Panel D) *P<0.05. Intracellular triglyceride concentration of BRIN-BD11 cells after 24-h treatment with the pro-inflammatory cytokine cocktail (Panel E). Results are expressed as mean ± S.D. for n = 3 in duplicate. **P<0.01.

 
ACC activity is negatively regulated by phosphorylation by the key signal-transducing kinase, AMPK. A slight decrease in AMPK levels was observed after 24-h exposure to the pro-inflammatory cytokine cocktail, but this was not significant. Results were normalized and expression of AMPK was reduced from an arbitrary value of 1 to 0.73 ± 0.32 units, P = 0.23 (Fig. 5BGo).

However, a significant increase in phosphorylated AMPK (therefore activated AMPK) levels was observed after 24-h treatment with the cytokine cocktail. Results were normalized and expression of AMPK-P increased from 1 ± 0.59 to 1.75 ± 0.45 units, P = 0.03 (Fig. 5CGo), which may indicate higher levels of phosphorylated ACC, resulting in inhibition of fatty acid synthesis and promotion of FA oxidation.

In support of the latter finding, intracellular triacylglycerol levels were reduced from 0.12 ± 0.02 to 0.06 ± 0.04 mg triglyceride per mg of protein after 24-h incubation in the presence of cytokines, a reduction of 49%, P<0.01 (Fig. 5DGo). Triacylglycerol synthesis is thought to be cytoprotective in the context of lipotoxicity, but hydrolysis may contribute to stimulation of insulin secretion under appropriate conditions (see Newsholme et al. 2007 for review).

Stimulation of glutamate release by cytochalasin D (CCD)

There was a significant increase in glutamate export after treatment with the actin microfilament disruptor CCD (1 µM). Glutamate export increased from 1.026 ± 0.23 to 2.92 ± 1.72 µmol glutamate/mg protein/24 h, P = 0.04, a 185% increase after treatment with 1 µM CCD (Fig. 6AGo). There was a significant reduction in chronic insulin secretion after 24-h treatment with 1 µM CCD. Insulin secretion was reduced from 39.64 ± 6.85 to 14.17 ± 6.33 µg insulin/mg protein/24 h treatment in the presence of 1 µM CCD, a 64% reduction in chronic insulin secretion P<0.001 (Fig. 6BGo).


Figure 6
View larger version (9K):
[in this window]
[in a new window]

 
Figure 6 The effect of cytochalasin D on chronic glutamate release from BRIN BD11 cells. Glutamate production (A) and chronic insulin secretion (B) after 24-h treatment of BRIN BD11 cells in RPMI-1640 media supplemented with 10% (v/v) FCS and 2 mmol/l glutamine in the absence or presence of 1 mM cytochalasin D. Results are expressed as mean ± S.D. *P<0.05, **P<0.01.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous studies have reported that exposure of rat or mouse pancreatic islets to relatively high concentrations of the pro-inflammatory cytokines IL-1ß or TNF-{alpha} or a mixture of IL-1ß, TNF-{alpha} and IFN-{gamma} resulted in decreased glucose oxidation, decreased activityof glycolytic enzymes and inhibition of insulin secretion (Eizirik et al. 1988, Park et al. 1999, Wallstrom et al. 2003). However, relatively high concentrations of cytokines were previously used (for example, 25 U/ml IL-1ß 1000 U/ml TNF-{alpha} and 1000 U/ml IFN-{gamma}, Wallstrom et al. 2003), which resulted in rapid stimulation of apoptosis. The study described here employed considerably lower concentrations of pro-inflammatory cytokines (80-fold, 32-fold and 64-fold for IL-1ß, TNF-{alpha} and IFN-{gamma} respectively, IL-1ß 0.3125 U/ml, TNF{alpha} 31.25 U/ml, IFN{gamma} 15.625 U/ml) and found enhanced glucose, alanine and triacylglycerol utilization together with concomitant increases in lactate, glutamate and GSH production. The effect of low concentrations of pro-inflammatory cytokines (equivalent to those used in this study) in primary islets has not been addressed. With respect to enzyme activity measurement, we found that maximal LDH activity was not altered after incubation in the presence of pro-inflammatory cytokines. However, both chronic and acute levels of insulin secretion were substantially reduced in agreement with previous reports using higher concentrations of cytokines (Cunningham & Green 1994, Cunningham et al. 2005). At the cytokine concentrations used in this study, no change was observed in LDH release, MTT reduction or DNA fragmentation after 24 h thus indicating cellular integrity was maintained under these conditions. Thus, a major question concerns the role of increased fuel utilization in ß cells exposed to sub-lethal concentrations of pro-inflammatory cytokines. The additional glucose consumed appeared to be mainly converted to lactate, thus suggesting a shift to anaerobic glycolysis and a shift away from glucose-dependent stimulation–secretion coupling. Partial similarity thus exists with in vivo studies demonstrating partial pancreatectomy-induced hyperglycaemia resulted in up-regulation of rat islet cell LDH and monocarboxylate (lactate) transporter gene expression (Laybutt et al. 2002) and thus desensitization to glucose. Cytokines have been shown to increase NO production, NADPH oxidase expression and ROS production ((Eizirik & Darville 2001, Cunningham et al. 2005, Morgan et al. 2007). The NADPH oxidase complex uses molecular oxygen and NADPH (as a source of reducing equivalents) to generate O2 . The source of NADPH is critically important to the ß cell, which has a relatively low pentose phosphate pathway activity (Papaccio et al. 2005). Interestingly, the ß cell also contains malic enzyme (NADP+ - dependent malate dehydrogenase), capable of converting malate to pyruvate with the concomitant production of NADPH from NADP+ (MacDonald 1995). The function of NADPH in the ß cell, although positively correlated with insulin secretion, has never been fully clarified but it may contribute to anti-oxidant mechanisms including the GSH reductase/GSH peroxidase system. We would suggest that NADPH may additionally contribute to ROS generation via its role as substrate in the NADPH-oxidase-catalysed reduction of molecular oxygen. While the full role of ROS in the ß cell is uncertain, it may influence redox-sensitive enzymes, signal transduction components or transcription factors, which determine insulin gene transcription or insulin secretion or both. At the low concentration of pro-inflammatory cytokines used in the present study, we did not find a change in expression of the NADPH oxidase subunit p47phox (results not shown). However, under adverse conditions such as sustained exposure to higher concentrations of pro-inflammatory cytokines, the resulting up-regulation and activity of NADPH oxidase may result in excessive ROS initially causing oxidative stress, increased glucose consumption and lactate production but reduced ATP production. However, enhanced ATP consumption resultant from initiation of cell defence mechanisms including activation of ion pumps and transporters will result in a critical fall in ATP levels, insulin secretion and finally apoptosis (Brownlee 2003). That the pro-inflammatory cytokine cocktail decreased ß-cell triacylglycerol level was unexpected, indicating a shift towards fatty acid oxidation or export (Martins et al. 2004). One possibility that might explain the functional impact of TAG hydrolysis in ß cells is enhanced TAG/FA cycling stimulated by pro-inflammatory cytokine exposure. This can be expected to consume considerable amounts of glucose (as a supplier of glycerol 3-phosphate for esterification) and ATP. The diversion of ATP to TAG/FA cycling and release of potentially high intracellular concentrations of NEFA may negatively impact on ß-cell function and viability (Nolan et al. 2006). The observed increase in phosphorylated AMPK would be expected to enhance ACC phosphorylation and inhibition, correlating well with the cytokine-induced shift towards fatty acid oxidation. The loss of fatty acid synthesis and associated lipid signalling molecule generation via this pathway (Haber et al. 2006, Newsholme et al. 2007) could also contribute to the observed decrease in insulin secretion.

Chronic glutamate release from the ß cell has been reported (Corless et al. 2006) and suggested to play a role in autocrine/paracrine inhibition of insulin secretion via activation of metabotropic or ionotropic glutamate receptors described in pancreatic ß cells and islets (Molnar et al. 1995). The present results demonstrate that pro-inflammatory cytokines increase glutamate release, which might be relevant in the observed inhibition of secretion via glutamate receptor activation. Furthermore, cytochalasin D, an actin microfilament disruptor (Head et al. 2006) enhanced glutamate release from BRIN-BD11 cells. Since microfilaments play an important role in the movement of insulin granules to the plasma membrane, glutamate may be important for vesicle transport towards exocytotic sites. Disruption of granule movement and fusion might also decrease the requirement for glutamate which was subsequently exported. Interestingly, pro-inflammatory cytokines might also enhance glutamate formation from precursors such as glucose (Brennan et al. 2003, Broca et al. 2003) or alanine (Dixon et al. 2003). This might explain the observed inhibition of glutamine utilization by cytokines.

From the above considerations, pro-inflammatory cytokines appear to shift ß-cell metabolism away from stimulus–secretion coupling and towards a catabolic state related to cell defence (see Fig. 7Go). The endoplasmic reticulum is essential for normal protein synthesis and folding and is crucial for cellular integrity and responses to stress. Cytokines provoke alterations in normal ER function and environment leading to accumulation of unfolded proteins and activation of a specific ER stress response, also known as the unfolded protein response (Cardozo et al. 2005). Three ER signal transduction pathways appear to be important for this stress response. Subsequent downstream events associated with ER-directed transcriptional activation and protein synthesis will place a considerable energy burden on the ß cell.


Figure 7
View larger version (16K):
[in this window]
[in a new window]

 
Figure 7 Glucose and amino acid metabolism in cytokine challenged clonal pancreatic ß-cells. Metabolic scheme outlining the increase (+) or decrease (–) in utilization or production of various metabolites in the ß-cell line BRIN BD11 in response to exposure to a sub-lethal concentration of IL-1ß, TNF-{alpha} and IFN-{gamma}.

 
In contrast to the reduction in glucose transport and metabolism in muscle and adipose tissues, inflammatory cytokines have been reported to stimulate glucose uptake and metabolism in both T and B lymphocytes (Frauwirth & Thompson 2004, Doughty et al. 2006). Of course, cytokine stimulation of lymphocyte growth, maturation and proliferation is well defined and is required for an appropriate immune response. We conclude that enhanced glucose metabolism in response to non-lethal concentrations of cytokines appears to be related to enhanced NADPH production, enhanced metabolic intermediate generation for biosynthetic pathways and enhanced energy requirements. Pro-inflammatory cytokines do not appear to stimulate ß-cell proliferation in vitro or in vivo. However, enhanced metabolic intermediate generation may be required for ß-cell protection and survival. The elevation in GSH levels in ß cells observed in this study would be consistent with activation in cellular protective mechanisms. Further studies are required to explore these possibilities and ultimately their application to primary human ß cells.


    Acknowledgements
 
We thank the European Union Coordination Action TONECA, Health Research Board of Ireland and UCD School of Biomolecular and Biomedical Science for support of this work.


   Funding

This work was supported by the European Union Coordination Action TONECA, The Health Research Board of Ireland and UCD Dublin. There is no conflict of interest in relation to any of the authors of this paper and publication in the Journal of Endocrinology.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Baker MA, Cerniglia GJ & Zaman A 1990 Microtiter plate assay for the measurement of gluthione and glutathione disul in large numbers of biological samples. Annals of Biochemistry 190 360–365.[CrossRef]

Brennan L, Shine A, Hewage C, Malthouse JPG, Brindle K, McClenaghan N, Flatt PR & Newsholme P 2002 A NMR based demonstration of substantial oxidative L-alanine metabolism and L-alanine enhanced glucose metabolism in a clonal pancreatic ß-cell line – metabolism of L-alanine is important to the regulation of insulin secretion. Diabetes 51 1714–1721.[Abstract/Free Full Text]

Brennan L, Corless M, Hewage C, Malthouse JPG, McClenaghan NH, Flatt PR & Newsholme P 2003 13C NMR analysis reveals a link between L-glutamine metabolism, D-glucose metabolism and gamma-glutamyl cycle activity in a clonal pancreatic beta-cell line. Diabetologia 46 1512–1521.[CrossRef][Web of Science][Medline]

Broca C, Brennan L, Petit P, Newsholme P & Maechler P 2003 Mitochondria-derived glutamate at the interplay between branched-chain amino acid and glucose-induced insulin secretion. FEBS Letters 545 167–172.[CrossRef][Web of Science][Medline]

Brownlee M 2003 A radical explanation for glucose induced pancreatic beta-cell dysfunction. Journal of Clinical Investigation 112 1788–1790.[CrossRef][Web of Science][Medline]

Cardozo AK, Kruhoffer M, Leeman R, Orntoft T & Eizirik DL 2001 Identification of novel cytokine-induced genes in pancreatic beta-cells by high-density oligonucleotide arrays. Diabetes 50 909–920.[Abstract/Free Full Text]

Cardozo AK, Ortis F, Storling J, Feng YM, Rasschaert J, Tonnesen M, Van Eylen F, Mandrup-Poulsen T, Herchuelz A & Eizirik DL 2005 Cytokines downregulate the sarcoendoplasmic reticulum pump Ca2+ ATPase 2b and deplete endoplasmic reticulum Ca2+, leading to induction of endoplasmic reticulum stress in pancreatic beta-cells. Diabetes 54 452–461.[Abstract/Free Full Text]

Chapman JC, McClenaghan NH, Cosgrove KE, Hashmi MN, Shepherd R, Giesberts AN, White S, Ammala C, Flatt PR & Dunne MJ 1999 ATP-sensitive potassium channels and efaroxan-induced insulin release in the elctrofusion-derived BRIN-BD11 beta-cell line. Diabetes 48 2349–2357.[Abstract]

Conroy SJ, Green I, Dixon G, Byrne PM, Nolan J, Abdel-Wahab YH, McClenaghan NH, Flatt PR & Newsholme P 2002 Evidence for a sustained increase in clonal b-cell basal intracellular Ca2+ levels after incubation in the presence of newly diagnosed Type-1 diabetic patient sera. Journal of Endocrinology 173 53–62.[Abstract]

Corless M, Kiely A, McClenaghan NH, Flatt PR & Newsholme P 2006 Glutamine regulates expression of key transcription factor, signal transduction, metabolic gene and protein expression in a clonal pancreatic beta cell line. Journal of Endocrinology 190 719–727.[Abstract/Free Full Text]

Cunningham JM & Green CI 1994 Cytokines, nitric oxide and insulin secreting cells. Growth Regulation 4 173–180.[Web of Science][Medline]

Cunningham G, McClenaghan NH, Flatt PR & Newsholme P 2005 L-alanine induces changes in metabolic and signal transduction gene expression in a clonal pancreatic beta cell line and protects from pro-inflammatory cytokine induced apoptosis. Clinical Science 109 447–455.[CrossRef][Web of Science][Medline]

Curi R, Lagranha CJ, Doi SQ, Sellitti F, Procopio J, Pithon-Curi TC, Corless M & Newsholme P 2005 Molecular mechanisms of glutamine Action. Journal of Cell Physiology 204 392–401.[CrossRef][Web of Science][Medline]

Dixon G, Nolan J, McClenaghan NH, Flatt PR & Newsholme P 2003 A comparative study of amino acid consumption by rat islet cells and the clonal beta-cell line BRIN-BD11 – the functional significance of L-alanine. Journal of Endocrinology 179 447–454.[Abstract]

Doughty CA, Bleiman BF, Wagner DJ, Dufort FJ, Mataraza JM, Roberts MF & Chiles TC 2006 Antigen receptor-mediated changes in glucose metabolism in B lymphocytes: role of phosphatidylinositol 3-kinase signaling in the glycolytic control of growth. Blood 107 4458–4465.[Abstract/Free Full Text]

Eizirik DL & Darville MI 2001 ß-Cell apoptosis and defense mechanisms. Diabetes 1 S64–S69.

Eizirik DL, Strandell E, Bendtzen K & Sandler S 1988 Functional characteristics of rat pancreatic islets maintained in culture after exposure to human interleukin 1. Diabetes 37 916–919.[Abstract]

Van Eylen F, Horta OD, Barez A, Kamagate A, Flatt PR, Macianskiene R, Mubagwa K & Herchuelz A 2002 Overexpression of the Na/Ca exchanger shapes stimulus-induced cytosolic Ca2+ oscillations in insulin producing BRIN BD11 cells. Diabetes 51 366–375.[Abstract/Free Full Text]

Frauwirth KA & Thompson CB 2004 Regulation of T lymphocyte metabolism. Journal of Immunology 172 4661–4665.[Abstract/Free Full Text]

Haber EP, Procópio J, Carvalho CRO, Carpinelli AR, Newsholme P & Curi R 2006 New insights into fatty acid modulation of pancreatic beta cell function. International Reviews of Cytology 248 1–41.

Head BP, Patel HH, Roth DM, Murray F, Swaney JS, Niesman IR, Farquhar MG & Insel PA 2006 Microtubules and actin microfilaments regulate lipid raft/caveolae localization of adenylyl cyclase signalling components. Journal of Biological Chemistry 281 26391–26399.[Abstract/Free Full Text]

Hoorens A, Van de CM, Kloppel G & Pipeleers D 1996 Glucose promotes survival of rat pancreatic beta cells by activating synthesis of proteins which suppress a constitutive apoptotic program. Journal of Clinical Investigation 98 1568–1574.[Web of Science][Medline]

Kamencic H, Lyon A, Paterson PG & Juurlink BH 2000 Monochlorobimane fluorometric method to measure tissue glutathione. Analytical Biochemistry 286 35–37.[CrossRef][Web of Science][Medline]

Kutlu B, Cardozo AK, Darville MI, Kruhoffer M, Magnusson N, Orntoft T & Eizirik DL 2003 Discovery of gene networks regulating cytokine-induced dysfunction and apoptosis in insulin-producing INS-1 cells. Diabetes 52 2701–2719.[Abstract/Free Full Text]

Laybutt DR, Sharma A, Sgroi DC, Gaudet J, Bonner-Weir S & Weir GC 2002 Genetic regulation of metabolic pathways in b-cells disrupted by hyperglycemia. Journal of Biological Chemistry 277 10912–10921.[Abstract/Free Full Text]

Liu D, Pavlovic D, Chen MC, Flodstrom M, Sandler S & Eizirik DL 2000 Cytokines induce apoptosis in ß-cells isolated from mice lacking the inducible isoform of nitric oxide synthase (iNOS). Diabetes 49 1116–1122.[Abstract]

MacDonald MJ 1995 Feasibility of a mitochondrial pyruvate malate shuttle in pancreatic islets. Further implication of cytosolic NADPH in insulin secretion. Journal of Biological Chemistry 270 20051–20058.[Abstract/Free Full Text]

Maechler P 2002 Mitochondria as the conductor of metabolic signals for insulin exocytosis in pancreatic beta-cells. Cellular and Molecular Life Sciences 59 1803–1818.[CrossRef][Web of Science][Medline]

Maechler P & Wollheim CB 1999 Mitochondrial glutamate acts as a messenger in glucose-induced insulin exocytosis. Nature 402 595–596.[CrossRef][Medline]

Martins EF, Miyasaka CK, Newsholme P, Curi R & Carpinelli AR 2004 Changes of fatty acid composition in incubated rat pancreatic islets. Diabetes and Metabolism 30 21–27.[CrossRef]

McClenaghan NH 2007 Functional insights for understanding and therapy of diabetes. Physiological regulation of the pancreatic beta-cell. Experimental Physiology 92 481–496.[Abstract/Free Full Text]

McClenaghan NH & Flatt PR 1999 Engineering cultured insulin-secreting pancreatic ß-cell lines. Journal of Molecular Medicine 77 235–243.[CrossRef][Web of Science][Medline]

McClenaghan NH, Barnett CR, Ah-Sing E, Abdel-Wahab YHA, O’Harte FPM, Yoon T-W, Swanston-Flatt SK & Flatt PR 1996a Characterization of a novel glucose-responsive insulin-secreting cell line, BRIN-DB11, produced by electrofusion. Diabetes 45 1132–1140.[Abstract]

McClenaghan NH, Barnett CR, O’Harte FPM & Flatt PR 1996b Mechanisms of amino acid-induced insulin secretion from the glucose-responsive BRIN-BD11 pancreatic ß-cell line. Journal of Endocrinology 15 349–357.

Molnar E, Varadi A, McIlhinney RAJ & Ashcroft SJH 1995 Identification of functional ionotropic glutamate receptor proteins in pancreatic beta cells and in islets of Langerhans. FEBS Letters 371 253–257.[CrossRef][Web of Science][Medline]

Morgan D, Oliveira-Emilio HR, Keane D, Hirata AE, Santos da Rocha M, Bordin S, Curi R, Newsholme P & Carpinelli AR 2007 Glucose, palmitate and pro-inflammatory cytokines modulate expression and activity of a phagocyte-like NADPH oxidase in rat pancreatic islets and a clonal ß-cell line. Diabetologia 50 359–369.[CrossRef][Web of Science][Medline]

Newsholme P, Procopio J, Ramos Lima MM, Pithon-Curi TC & Curi R 2003 Glutamine and glutamate – their central role in cell metabolism and function. Cell Biochemistry and Function 21 1–9.[CrossRef][Web of Science][Medline]

Newsholme P, Keane D, Welters H & Morgan N 2007 Life and death decisions for the pancreatic beta cell – the role of fatty acids. Clinical Science 112 27–42.[CrossRef][Web of Science][Medline]

Nolan CJ, Madiraju MS, Delghingaro-Augusto V, Peyot ML & Prentki M 2006 Fatty acid signaling in the beta-cell and insulin secretion. Diabetes 55 S16–S23.[Abstract/Free Full Text]

Oliveira HR, Verlengia R, Carvalho CR, Britto LR, Curi R & Carpinelli AR 2003 Pancreatic ß-cells express phagocyte-like NAD(P)H oxidase. Diabetes 52 1457–1463.[Abstract/Free Full Text]

Papaccio G, Graziano A, Valiante S, D’Aquino R, Travali S & Nicoletti F 2005 Interleukin (IL)-1beta toxicity to islet beta cells: Efaroxan exerts a complete protection. Journal of Cell Physiology 203 94–102.[CrossRef][Web of Science][Medline]

Park C, Kim JR, Shim JK, Kang BS, Park YG, Nam KS, Lee YC & Kim CH 1999 Inhibitory effects of streptozotocin, TNF{alpha} and IL-1ß on glucokinase activity in pancreatic islets and gene expression of GLUT2 and glucokinase. Archives of Biochemistry and Biophysics 362 217–224.[CrossRef][Web of Science][Medline]

Rabinovitch A, Suarez-Pinzon WL, Strynadka K, Lakey JR & Rajotte RV 1996 Human pancreatic islet ß-cell destruction by cytokines involves oxygen free radicals and aldehyde production. Journal of Clinical Endocrinology and Metabolism 81 3197–3202.[Abstract]

Tietze F 1969 Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissues . Annals of Biochemistry 27 502–522.[CrossRef]

Wallstrom J, Andersson AK & Sandler S 2003 Effects of IL-15 on suppression of rat pancreatic islets in vitro induced by pro-inflammatory cytokines. Immunology Letters 88 141–145.[CrossRef][Web of Science][Medline]

Wollheim CB 2000 Beta-cell mitochondria in the regulation of insulin secretion: a new culprit in type II diabetes. Diabetologia 43 265–277.[CrossRef][Web of Science][Medline]

Received in final form 6 July 2007
Accepted 19 July 2007
Made available online as an Accepted Preprint 19 July 2007





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kiely, A.
Right arrow Articles by Newsholme, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kiely, A.
Right arrow Articles by Newsholme, P.


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS