|
|
||||||||
Department of Internal Medicine, Sahlgrenska University Hospital, Gröna Stråket 8, SE-413 45 Göteborg, Sweden
1 Department of Clinical Physiology, Göteborg University, Göteborg, Sweden
2 Musculoskeletal Disease Center, Jerry L Pettis Memorial VA Medical Center, Loma Linda, California, USA
3 Department of Pathology, Sahlgrenska University Hospital, Göteborg, Sweden
(Requests for offprints should be addressed to J Svensson; Email: johan.svensson{at}medic.gu.se)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The expression pattern of GH and IGF-I receptors in the kidney is complex. This is partly due to the complex structure of the kidney itself, which includes a vascular network, tubules, and an interstitial component (Rabkin & Schaefer 2004). In the rat kidney, GH and IGF-I receptors colocalize in the thick ascending loop of Henle, whereas GH and IGF-I receptors otherwise are expressed separately (Rabkin & Schaefer 2004). The effect of GH/IGF-I on kidney function may mainly be an IGF-I-mediated effect since the effect after GH administration is slower than that after IGF-I administration and not seen until the circulating IGF-I has been increased (Feld et al. 1995, Hirschberg & Adler 1998). However, it has been suggested that GH can increase renal sodium reabsorption by a direct effect on the proximal tubuli (Rabkin & Schaefer 2004).
The major part of serum IGF-I is liver derived (Sjögren et al. 1999, Yakar et al. 1999). In addition to being regulated by GH (Bengtsson et al. 1993), serum IGF-I levels are also affected by factors, such as food intake, exercise, and age (Landin-Wilhelmsen et al. 1994, Kaklamani et al. 1999, Ehrnborg et al. 2003). A mouse model with liver-specific inducible inactivation of the IGF-I gene, using the CreLoxP conditional knockout system, has been developed (LI-IGF-I/ mice; Sjögren et al. 1999, 2001, 2002, Wallenius et al. 2001, Tivesten et al. 2002). The selective inactivation of the IGF-I gene in the liver results in an 8085% reduction in serum IGF-I, whereas the renal expression of IGF-I is unaffected (Sjögren et al. 1999). These mice have increased GH secretion secondary to the decrease in serum IGF-I (geometric mean plasma GH 3.1 times higher in LI-IGF-I/ than in control mice (Sjögren et al. 1999, Wallenius et al. 2001)). In addition, as previously shown using western ligand blotting (Sjögren et al. 2002), the LI-IGF-I/ mice have unchanged serum insulin-like growth factor-binding protein-1 (IGFBP-I) level, whereas IGFBP-2 and -3 in serum were decreased by 74 and 86% respectively, when compared with control mice.
The LI-IGF-I/ mice do not have any major disturbance in postnatal longitudinal bone growth, whereas they have increased blood pressure (BP) due to increased peripheral resistance without any detectable effect on the reninaldosterone system (Tivesten et al. 2002). Blood glucose is normal, but circulating insulin levels are increased (Sjögren et al. 2001). Finally, kidney size is decreased (Sjögren et al. 1999). Here, we assess the role of adult expression of liver-derived IGF-I for renal function, morphology, and sodium handling and investigate to what extent changes in these factors are associated with alterations in renal global gene expression.
| Materials and Methods |
|---|
|
|
|---|
The LI-IGF-I/ mice were generated as previously described by Sjögren et al.(1999). Mice homozygous for LoxP (Liu et al. 1998), and heterozygous for Mx-Cre (Kuhn et al. 1995), were given polyinosinicpolycytidylic acid (PiPc; 6.25 µg/g body weight; SigmaAldrich Corp.) in three i.p. injections at 4 weeks of age to induce expression of the Cre protein in the liver (Kuhn et al. 1995). PiPc-treated littermates, homozygous for LoxP but lacking Mx-Cre, were used as controls. Seven days after the PiPc injections, blood was collected, and serum was assayed for IGF-I by a double-antibody IGF-binding protein-blocked RIA using a commercial kit (Mediagnost, Tubingen, Germany). In addition, in the 24-month-old mice, serum IGF-I (Mediagnost) was measured from serum collected when the mice were killed. In mice aged 9 months, serum IGF-II was measured by RIA after separation of IGFs from IGFBPs as described previously (Mohan & Baylink 1995, Miyakoshi et al. 2001). The animals had free access to fresh water and food pellets (B&K Universal AB, Sollentuna, Sweden). The study was approved by the ethical committee at the University of Göteborg.
Study design
In 6-month-old control (n = 7) and LI-IGF-I (n = 7) mice, serum creatinine and 24-h urine excretion of creatinine, sodium, and potassium were determined when the animals were placed in metabolic cages. Creatinine clearance was then calculated. One month later, at 7 months of age, basal tail-cuff systolic BP was assessed in these mice. Other 7-month-old mice (seven control and nine LI-IGF-I/ mice) were anesthetized with a combination of fentanyl and fluanisone (0.55 and 17.5 mg/kg; Hypnorm, Janssen Pharmaceuticals, Beerse, Belgium) and midazolam (8.75 mg/kg; Dormicum, Hoffman-La-Roche Inc., Basel, Switzerland) and were killed by rapid excision of the heart. Kidney weights were assessed and microarray analyses (kidney, liver, muscle, heart, fat, and bone) were performed. In additional experiments, 24-month-old mice (eight control and five LI-IGF-I/ mice) were killed in a similar way as the 7-month-old mice, kidney weights were determined and then examinations of kidney morphology were performed. Finally, serum IGF-II levels were determined in 9-month-old mice (nine control and seven LI-IGF-I/ mice).
Systolic BP measurements
Systolic BP was measured using a computerized noninvasive tail-cuff system (RTBP Monitor; Harvard Apparatus, Inc., South Natick, MA, USA). Unanesthetized animals were kept in a restrainer, with a standardized acclimatization time of 10 min and gentle heating of the tail before the recordings. Basal systolic BP measurements were performed on three separate days, with at least three recordings for each time point. Final systolic BP was obtained by averaging the mean values from the different time points.
Measurements of sodium, potassium, creatinine, and creatinine clearance
Urine was collected from LI-IGF-I/ and control mice placed in metabolic cages during 24 h, with free access to tap water and food pellets. Concentrations of sodium and potassium in urine were analyzed using flame photometry (FLM3, Radiometer, Copenhagen, Denmark). Creatinine in serum and urine was determined by a colorimetric method (SigmaAldrich Corp.). Creatinine clearance was then calculated and used as a measure of GFR (creatinine clearance = (urinary creatinine)/(serum creatinine) x (urinary flow)). GFR values are given as absolute values or values corrected for body weight.
Kidney morphology
Specimens were processed from formaldehyde-fixed paraffin-embedded tissue and sectioned at 34 µm. The sections were stained with either hematoxylin and eosin or periodic acid-Schiff and light microscopic examination was performed. All determinations of kidney morphology were performed in a blinded fashion by the same pathologist.
DNA microarray analysis
Total RNA from kidneys was extracted by Tri Reagent (Sigma) and further purified using spin columns from Rneasy Total RNA Isolation Kit (Qiagen) according to the manufacturers instructions. RNA from 7-month-old mice (six control and seven LI-IGF-I/ mice) was prepared. For microarray analysis, the RNA samples were pooled into two or three, resulting in three pools per group. The pooled RNA was reverse transcribed into cDNA, labeled, and analyzed by DNA microarray (MG-U74Av2 Array; Affymetrix, Santa Clara, CA, USA). The array represents 7000 mouse genes and 5000 uncharacterized expressed sequence tag clones. Preparation of labeled cRNA and hybridization were done according to the Affymetrix Gene Chip Expression Analysis manual.
The gene expression of IGF-II was also determined in microarray analyses of liver, muscle, heart, fat (retroperitoneal fat), and bone (vertebrae). These microarray analyses were performed using similar methodology as described above.
Bioinformatics
Scanned output files were analyzed using Affymetrix Micro Array Suite version 4.0.1 software (Affymetrix). To allow comparison of gene expression, the gene chips were globally scaled to an average intensity of 500. Each of the three LI-IGF-I/ chips was compared with the three control chips, generating nine comparison files in total. Only the genes that were regarded as changed, according to the Affymetrix algorithm, in five to nine of the comparisons were selected for further analysis. An average-fold change for the nine comparisons of the selected genes was then calculated. For a gene to be regarded as regulated in the LI-IGF-I/ mice, the average-fold increase or decrease of the nine comparisons was set to be at least threefold. These relatively strict criteria ensured that only genes that were strongly regulated by the circulating IGF-I were detected.
Real-time PCR (RT-PCR) analysis
In order to confirm the microarray findings, RT-PCR analyses were performed (ABI Prism 7700 Sequence Detection System (PE Applied Biosystems, Stockholm, Sweden)). The RT-PCR analyses were performed on renal tissue samples from individual mice (no pooling; control mice (n = 6) and LI-IGF-I/ mice (n = 7)). An FAM-labeled probe specific for IGF-II was used (Accession no. NM_010514 [GenBank] , forward primer: CCGTACTTCCGGAC-GACTTC, reverse primer: CGTCCCGCGGACTGTCT, probe: CGTGGGCAAGTTCTTCCAATATGACACC; PE Applied Biosystems). Predesigned primers (PE Applied Biosystems) and a VIC-labeled probe for 18S rRNA were included in the reactions as an internal standard. The cDNA was amplified at the following conditions: one cycle at 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. The mRNA amount of each gene was calculated using the standard curve method (multiplex reaction, following the instructions in User Bulletin no. 2, PE Applied Biosystems) and adjusted for the expression of 18S rRNA.
Statistical analyses
All the descriptive statistical results are presented as the mean ± S.E.M. Between-group differences were calculated using unpaired t-tests. Furthermore, for body weight, kidney weight, and kidney weight/body weight, a two-way ANOVA with age and study group as the independent variables was performed followed by StudentNeuman-Keuls multiple range test. A two-tailed P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
Liver-specific inactivation of the IGF-I gene was induced at 4 weeks of age, resulting in a reduction of serum IGF-I level by 8085% in the LI-IGF-I/ mice when compared with the control mice (data not shown). This reduction in serum IGF-I level was sustained until 24 months of age (24-month-old LI-IGF-I/ mice, 24 ± 7 ng/ml; 24-month-old controls, 149 ± 21 ng/ml; P < 0.001).
Body weight increased with increasing age, but there was no significant difference in body weight between the LI-IGF-I/ and the control mice (Table 1
). Kidney weight and kidney weight per body weight were not affected by age, but both absolute and relative kidney weight were reduced in the LI-IGF-I/ mice (Table 1
).
|
In mice aged 6 months, serum and 24-h urine concentrations of creatinine were similar in the two study groups (Table 2
). There was no between-group difference in GFR, as assessed using creatinine clearance or creatinine clearance corrected for body weight (Table 2
). At 7 months of age, systolic BP was increased in the LI-IGF-I/ mice (LI-IGF-I/ mice (n = 7), 141 ± 5 mm Hg; control mice (n = 7), 126 ± 3 mm Hg; P < 0.05).
|
|
|
DNA microarray analyses were performed to investigate if there were alterations in the global gene expression pattern in kidneys from LI-IGF-I/ mice. The analyses revealed that only three probe sets, representing FK506-binding protein 5 (FKBP51; GB U16959
[GenBank]
), Mouse A12 mRNA (GB L22977
[GenBank]
), and IGF-II (X71922
[GenBank]
), were strongly regulated (all down-regulated) in LI-IGF-I/ mice when compared with control mice (Table 3
). IGF-II was, however, the only regulated gene that had a high renal expression using the Affymetrix arbitrary scale (Table 3
). Furthermore, the microarray analyses showed no change in any of the members of the IGF-I family except for IGF-II (Table 3
).
|
|
IGF-II in serum
The microarray and RT-PCR analyses showed a strong down regulation of the renal IGF-II mRNA levels. We therefore determined IGF-II levels in serum of 9-month-old mice. Serum IGF-II concentration was found to be similar in the two study groups as measured using RIA (mean serum IGF-II was 14.4 ± 1.2 ng/ml in the LI-IGF-I/ mice (n = 7) and 13.9 ± 2.3 ng/ml in the control mice (n = 9); P = 0.6).
| Discussion |
|---|
|
|
|---|
Transgenic mice with global overexpression of GH and/or IGF-I have selective renal enlargement and glomerular hypertrophy, whereas only the mice with global over-expression of GH have mesangial proliferation followed by progressive glomerulosclerosis (Doi et al. 1988, 1990, Mathews et al. 1988, Cingel-Ristic et al. 2004). Mice with global inactivation of the IGF-I gene that survive the postnatal period have reduced body weight, proportionally reduced kidney size, reduced glomerular size, and decreased number of nephrons (Rogers et al. 1999, Cingel-Ristic et al. 2004). However, these studies cannot evaluate the role of IGF-I in adult or aging animals, as they are confounded by affected IGF-I activity during development. The LI-IGF-I/ mice do not have decreased IGF-I expression in the kidney at 3 (Sjögren et al. 1999) and 7 months of age (the present study). The inactivation of liver-derived IGF-I at 4 weeks of age resulted in a marked reduction in serum IGF-I that was maintained at 24 months of age. Therefore, although renal IGF-I expression were not determined at 24 months of age, the observed alterations were likely not, or only to a relatively small extent, due to the developmental changes in the kidney.
The histological analyses in the 24-month-old LI-IGF-I/ mice showed a global and symmetrical decrease in kidney size. There were no relative changes in the size, number, or distribution of renal structures, and there was no between-group difference in inflammation or fibrosis. Somewhat surprisingly, since the LI-IGF-I/ mice have increased BP (Tivesten et al. 2002) and compensated hyperinsulinemia (Sjögren et al. 2001), we did not find any increase in glomerulopathy or nephrosclerosis in the 24-month-old LI-IGF-I/ mice. However, it has previously been shown that the LI-IGF-I/ mice have decreased total body fat (Sjögren et al. 2001), which may possibly counteract the impact of the increased BP and the hyperinsulinemia.
Creatinine clearance and creatinine clearance corrected for body weight was similar in the LI-IGF-I/ and the control mice. Previous studies have shown that both systemic GH and IGF-I treatment can increase GFR (Feld et al. 1995, Hirschberg & Adler 1998, Cingel-Ristic et al. 2004, Rabkin & Schaefer 2004). In the present study, it was not possible to correct GFR for kidney weight since it was not determined at the time when GFR was measured. However, in the LI-IGF-I/ mice, unchanged GFR combined with reduced kidney weight suggest that the smaller kidneys were functioning at similar or even increased rate when compared with that in the control mice.
GH treatment increases both serum IGF-I concentration and sodium reabsorption, resulting in fluid retention (Feld et al. 1995, Hirschberg & Adler 1998, Cingel-Ristic et al. 2004, Rabkin & Schaefer 2004). The LI-IGF-I/ mice have high circulating GH secondary to their low circulating IGF-I (Sjögren et al. 1999, Wallenius et al. 2001). Therefore, the present results, with increased urinary loss of sodium over 24 h in the LI-IGF-I/ mice, indicate that GH cannot increase the renal reabsorption of sodium without a concomitant increase in serum IGF-I level, and that the combination of high circulating GH and low IGF-I even result in increased urinary loss of sodium. It is not clear to what extent the increased BP in the LI-IGF-I/ mice ((Tivesten et al. 2002) and the present study) affected renal sodium handling. The increased BP in the LI-IGF-I/ mice is due to increased peripheral vascular resistance without any detectable effect on the reninaldosterone system (Tivesten et al. 2002). It cannot be fully excluded that the increased sodium excretion in the LI-IGF-I/ mice is a compensatory mechanism in order to counteract the BP elevation via a pressurenatriuretic action (Guyton 1991). However, GH treatment in humans generally increased serum IGF-I level, sodium reabsorption, and fluid retention without affecting BP (Svensson et al. 2005), thus suggesting that the effect of GH/IGF-I on renal sodium handling is independent of the BP changes. Therefore, we propose that the increased sodium reabsorption seen during GH treatment is mediated by the concomitant increase in circulating IGF-I.
The LI-IGF-I/ mice did not only have increased urinary loss of sodium but also increased urinary loss of potassium. Although the effect of GH/IGF-I on urinary potassium excretion is less well characterized than that on urinary sodium handling, decreased urinary excretion of potassium has previously been described during IGF-I treatment (Giordano & DeFronzo 1995), and GH treatment increases total body potassium content (Bengtsson et al. 1993). In addition, increased renal IGF-I expression has been observed in potassium-depleted rats (Flyvberg et al. 1992). Potassium excretion is, to a large extent, driven by urinary flow rates (Wright 1982). The similar flow rates in the experimental groups suggest that endocrine liver-derived IGF-I interferes with specific tubular mechanisms for potassium transport. Therefore, the present and other studies suggest that IGF-I not only regulates urinary sodium handling but also urinary potassium handling.
IGF-II is of major importance for body and tissue growth in fetal life. Also in adult rodents, IGF-II mRNA and protein are abundantly expressed in the kidney (Wolf et al. 1994, Hirschberg & Adler 1998), and transgenic mice over-expressing IGF-II have increased kidney weight (Wolf et al. 1994, Blackburn et al. 1997). In transgenic mice with global deficiency of IGF-I, global overexpression of IGF-II has no effect on body weight gain or the weight of organs except for an increase in absolute and relative kidney weight (Moerth et al. 2007). Furthermore, in vitro studies have indicated that IGF-II can increase sodium uptake in proximal tubule brush border membrane vesicles (Yanagawa et al. 1991, Feld & Hirschberg 1996, Hirschberg & Adler 1998). In line with these previous results, the control mice in the present study had a high renal expression of IGF-II, whereas IGF-II expression was much lower in the other organs studied (liver, muscle, heart, fat, and bone). The LI-IGF-I/ mice had unchanged serum IGF-II level and the kidney was the only organ studied in which the IGF-II gene was downregulated. Thus, our results demonstrate that IGF-II is highly expressed in the adult kidney where it is regulated by endocrine liver-derived IGF-I in a tissue-specific manner. Therefore, one could speculate that affected IGF-II expression in the kidney could be important for the effects of circulating IGF-I on kidney size and sodium handling. This is supported by our observation of a positive correlation between renal IGF-II mRNA levels, as determined using RT-PCR, and relative kidney weight (kidney weight/body weight).
In the LI-IGF-I/ mice (Sjögren et al. 1999, Wallenius et al. 2001), as well as in humans with DM type I (Carroll et al. 1998, Jain et al. 1998, Cingel-Ristic et al. 2004, Rabkin & Schaefer 2004), circulating IGF-I levels are low and circulating GH levels are high. Furthermore, in animal models of type 1 DM, the discordance between circulating GH and IGF-I levels is often due to elevated glucocorticoids (Unterman et al. 1993, Rodgers et al. 1995). In the LI-IGF-I/ mice, serum corticosterone levels are increased at 1 month of age and still tend to be increased at 13 months of age (Sjögren et al. 2001). The absence of renal structural, vascular, and/or glomerular complications in the LI-IGF-I/ mice might suggest that high circulating GH and low circulating IGF-I in itself do not cause renal failure. However, the present results do not exclude the possibility that high circulating GH levels combined with low circulating IGF-I levels can accelerate the renal disease in diabetic patients with already existing renal complications.
In conclusion, the LI-IGF/ mice have a global and symmetrical decrease in kidney size and increased 24-h urinary sodium and potassium excretion. Since the LI-IGF-I/ mice have compensatory high circulating GH levels, the present results suggest that the well-known stimulatory effects by GH treatment on kidney size and sodium reabsorption are mediated by circulating liver-derived IGF-I. There were no signs of glomerulopathy or nephrosclerosis in the old LI-IGF-I/ mice, suggesting that the constellation of high circulating GH and low serum IGF-I is not a primary cause of diabetic or nondiabetic renal failure. The microarray analyses, confirmed by RT-PCR analyses, showed a marked decrease in the renal IGF-II mRNA levels, suggesting that the effects of circulating IGF-I on kidney size could be mediated by renal IGF-II.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Blackburn A, Schmitt A, Schmidt P, Wanke R, Hermanns W, Brem B & Wolf E 1997 Actions and interactions of growth hormone and insulin-like growth factor-II: body and organ growth of transgenic mice. Transgenic Research 6 213222.[CrossRef][Web of Science][Medline]
Carroll P, Umpleby M, Alexander E, Egel V, Callison K, Sönksen P & Russell-Jones D 1998 Recombinant human insulin-like growth factor-I (rhIGF-I) therapy in adults with type 1 diabetes mellitus: effects on IGFs, IGF-binding proteins, glucose levels and insulin treatment. Clinical Endocrinology 49 739746.[CrossRef][Medline]
Cingel-Ristic V, Flyvberg A & Drop S 2004 The physiological and pathophysiological role of the GH/IGF-axis in the kidney: lessons from experimental rodent models. Growth hormone and IGF Research 14 418430.
Doi T, Striker L, Quaife C, Conti F, Palmiter R, Behringer R, Brinster R & Striker G 1988 Progressive glomerulisclerosis develops in transgenic mice chronically expressing growth hormone and growth hormone releasing factor but not in those expressing insulinlike growth factor-1. American Journal of Pathology 131 398403.[Abstract]
Doi T, Striker L, Gibson C, Agodoa L, Brinster R & Striker G 1990 Glomerular lesions in mice transgenic for growth hormone and insulin-like growth factor I.I. Relationship between increased glomerular size and mesangial sclerosis. American Journal of Pathology 137 541552.[Abstract]
Ehrnborg C, Lange K, Dall R, Christiansen J, Lundberg P, Baxter R, Boroujerdi M, Bengtsson B-Å, Healey M, Pentecost C et al. 2003 The growth hormone/insulin-like growth factor-I axis hormones and bone markers in elite athletes in response to a maximum exercise test. Journal of Clinical Endocrinology and Metabolism 88 394401.
Feld S & Hirschberg R 1996 Growth hormone, the insulin-like growth factor system, and the kidney. Endocrine Reviews 17 423480.
Feld S, Hirschberg R, Artishevsky A, Nast C & Adler S 1995 Insulin-like growth factor I induces mesangial proliferation and increases mRNA and secretion of collagen. Kidney International 48 4551.[Web of Science][Medline]
Flyvberg A, Marshall S, Frystyk J, Rasch R, Bornfeldt K, Arnqvist H, Jensen P, Pallesen G & Orskov H 1992 Insulin-like growth factor I in initial renal hypertrophy in potassium-depleted rats. American Journal of Physiology 262 F1023F1031.[Web of Science][Medline]
Giordano M & DeFronzo R 1995 Acute effect of human recombinant insulin-like growth factor I on renal function in humans. Nephron 71 1015.[Web of Science][Medline]
Guler H, Zapf J, Scheiwiller E & Froesch E 1988 Recombinant human insulin-like growth factor I stimulates growth and has distinct effects on organ size in hypophysectomized rats. PNAS 85 48894893.
Guyton A 1991 Blood pressure control special role of the kidneys and body fluids. Science 252 18131816.
Hirschberg R & Adler S 1998 Insulin-like growth factor system and the kidney: physiology, pathophysiology, and therapeutic implications. American Journal of Kidney Diseases 31 901919.[Web of Science][Medline]
Jain S, Golde D, Bailey R & Geffner M 1998 Insulin-like growth factor-I resistance. Endocrine Reviews 19 625646.
Kaklamani V, Linos A, Kaklamani E, Markaki I, Koumataki Y & Mantzoros C 1999 Dietary fat and carbohydrates are independently associated with circulating insulin-like growth factor 1 and insulin-like growth factor-binding protein 3 concentrations in healthy adults. Journal of Clinical Oncology 17 32913298.
Kuhn R, Schwenk F, Aguet M & Rajewsky K 1995 Inducible gene targeting in mice. Science 269 14271429.
Landin-Wilhelmsen K, Wilhelmsen L, Lappas G, Rosén T, Lindstedt G, Lundberg P-A & Bengtsson B-Å 1994 Serum insulin-like growth factor I in a random population sample of men and women: relation to age, sex, smoking habits, coffee consumption and physical activity, blood pressure and concentrations of plasma lipids, fibrinogen, parathyroid hormone and osteocalcin. Clinical Endocrinology 41 351357.[Medline]
Liu J, Grinberg A, Westphal H, Sauer B, Accili D, Karas M & LeRoith D 1998 Insulin-like growth factor-I affects perinatal lethality and postnatal development in a gene dosage-dependent manner: manipulation using the Cre/loxP system in transgenic mice. Molecular Endocrinology 12 14521462.
Mathews L, Hammer R, Behringer R, DErcole A, Bell G, Brinster R & Palmiter R 1988 Growth enhancement of transgenic mice expressing human insulin-like growth factor I. Endocrinology 123 28272833.
Miyakoshi N, Richman C, Kasukawa Y, Linkhart T, Baylink D & Mohan S 2001 Evidence that IGF-binding protein-5 functions as a growth factor. Journal of Clinical Investigation 107 7378.[CrossRef][Web of Science][Medline]
Moerth C, Schneider M, Renner-Mueller I, Blutke A, Elmlinger M, Erben R, Camacho-Hubner C, Hoeflich A & Wolf E 2007 Postnatally elevated levels of insulin-like growth factor-II (IGF-II) fail to rescue the dwarfism of IGF-I deficient mice except kidney weight. Endocrinology 148 441451.
Mohan S & Baylink D 1995 Development of a simple valid method for the complete removal of insulin-like growth factor (IGF)-binding proteins from IGFs in human serum and other biological fluids: comparison with acidethanol treatment and C18 Sep-Pak separation. Journal of Clinical Endocrinology and Metabolism 80 637647.[Abstract]
Rabkin R & Schaefer F 2004 New concepts: growth hormone, insulin-like growth factor-I and the kidney. Growth hormone and IGF Research 14 270276.[CrossRef]
Rodgers BD, Strack AM, Dallman MF, Hwa L & Nicoll CS 1995 Corticosterone regulation of insulin-like growth factor I, IGF-binding proteins, and growth in streptozotocin-induced diabetic rats. Diabetes 44 14201425.[Abstract]
Rogers S, Powell-Braxton L & Hammerman M 1999 Insulin-like growth factor I regulates renal development in rodents. Developmental Genetics 24 293298.[CrossRef][Web of Science][Medline]
Sjögren K, Liu J, Blad K, Skrtic S, Vidal O, Wallenius V, LeRoith D, Törnell J, Isaksson OG, Jansson J-O et al. 1999 Liver-derived insulin-like growth factor I (IGF-I) is the principle source of IGF-I in blood but is not required for postnatal body growth in mice. PNAS 96 70887092.
Sjögren K, Wallenius K, Liu J, Bohlooly YM, Pacini G, Svensson L, Törnell J, Isaksson OG, Ahren B, Jansson J-O et al. 2001 Liver-derived IGF-I is of importance for normal carbohydrate and lipid metabolism. Diabetes 50 15391545.
Sjögren K, Sheng M, Moverare S, Liu J, Wallenius K, Törnell J, Isaksson OG, Jansson J-O, Mohan S & Ohlsson C 2002 Effects of liver-derived insulin-like growth factor I on bone metabolism in mice. Journal of Bone and Mineral Research 17 19771987.[CrossRef][Web of Science][Medline]
Svensson J, Tivesten A & Isgaard J 2005 Growth hormone and the cardiovascular function. Minerva Endocrinologica 30 113.[Medline]
Tivesten A, Bollano E, Andersson I, Fitzgerald S, Caidahl K, Sjögren K, Skott O, Liu J, Mobini R, Isaksson OG et al. 2002 Liver-derived insulin-like growth factor-I is involved in the regulation of blood pressure in mice. Endocrinology 143 42354242.
Unterman TG, Jentel JJ, Oehler DT, Lacson RG & Hofert JF 1993 Effects of glucocorticoids on circulating levels and hepatic expression of insulin-like growth factor (IGF)-binding proteins and IGF-I in the adrenalectomized streptozotocin-diabetic rat. Endocrinology 133 25312539.
Wallenius K, Sjögren K, Peng X, Park S, Wallenius V, Liu J, Umaerus M, Wennbo H, Isaksson OG, Frohman L et al. 2001 Liver-derived IGF-I regulates GH secretion at the pituitary level in mice. Endocrinology 142 47624770.
Wolf E, Kramer R, Blum W, Föll J & Brem G 1994 Consequences of postnatally elevated insulin-like growth factor-II in transgenic mice: endocrine changes and effects on body and organ growth. Endocrinology 135 18771886.[Abstract]
Wright F 1982 Flow-dependent transport processes: filtration, absorption, secretion. American Journal of Physiology Renal Physiology 243 F1F11.
Yakar S, Liu J, Stannard B, Butler A, Accili D, Sauer B & LeRoith D 1999 Normal growth and development in the absence of hepatic insulin-like growth factor I. PNAS 96 73247329.
Yanagawa N, Sheikh-Hamad D & Jo O 1991 Insulin-like growth factor II directly increased renal brush border membrane sodium transport. Journal of the American Society of Nephrology 2 447 (Abstract).
Received in final form 12 March 2007
Accepted 28 March 2007
Made available online as an Accepted Preprint 30 March 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |