JOE Society for Endocrinology Archive
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2007) 193, 183-194       DOI: 10.1677/JOE-06-0228
© 2007 Society for Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kato, Y.
Right arrow Articles by Iguchi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kato, Y.
Right arrow Articles by Iguchi, T.

Cloning and characterization of the ecdysone receptor and ultraspiracle protein from the water flea Daphnia magna

Yasuhiko Kato, Kaoru Kobayashi, Shigeto Oda1, Norihisa Tatarazako1, Hajime Watanabe and Taisen Iguchi

Okazaki Institute for Integrative Bioscience, National Institutes of Natural Sciences, 5-1 Higashiyama, Okazaki, Aichi 444-8787, Japan
1 National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba City, Ibaraki 305-8506, Japan

(Requests for offprints should be addressed to H Watanabe; Email: watanabe{at}nibb.ac.jp)


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
cDNAs encoding the ecdysone receptor (EcR) and ultra spiracle (USP) protein were cloned from the water flea Daphnia magna (Crustacea: Cladocera). The deduced EcR and USP amino acid sequences showed a high degree of homology to those of other crustaceans as well as insects. We isolated three isoforms of EcR that differ in the A/B domain. Quantitative PCR analysis indicated differing temporal expression patterns of the EcR isoforms during the molting period and demonstrated that the expression of one subtype correlated well with the timing of molt. Using cDNAs encoding EcR and USP, we constructed a Daphnia EcR/USP reporter based on a two-hybrid system. The gene fusions encoded the EcR ligand-binding domain (LBD) fused to the Gal4 DNA-binding domain, and the USP–LBD fused to the Vp16 activation domain. These chimeric genes were transfected with a luciferase reporter gene. Dose-dependent activation of the reporter gene could be observed when transfectants were exposed to Ec and other chemicals known to have Ec-like activities. This two-hybrid system may represent a useful reporter system for further examination of hormonal and chemical effects on Daphnia at the molecular level.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ecdysone (20-hydroxyecdysone; Ec) is known to play a pivotal role in the growth of arthropods. It has been reported that Ec is responsible forembryo development, larval molts, pupation, and metamorphosis in Drosophila, Bombyx mori and other arthropods (Riddiford 1993, Subramoniam 2000, Sekimoto et al. 2006). The Ec is known to regulate a number of biological processes by coordinating with juvenile hormone (JH; Dubrovsky 2005) and cross talk between them has been reported in Daphnia and other arthropods (Mu & LeBlanc 2004).

Molecular target of Ec is known as an ecdysone receptor (EcR), which belongs to the nuclear receptor family. EcR is a ligand-dependent transcription factor and it activates transcription of target genes by forming a heterodimer with another nuclear receptor, the ultraspiracle (USP) protein. This heterodimer formation is essential for gene activation in Drosophila and other arthropods (Yao et al. 1992, 1993, Hall & Thummel 1998).

As in the case in other arthropods, Ec and JH play important roles in cladocerans (Baldwin et al. 2001, Mu & LeBlanc 2002). The Ec affects male progeny production and chemicals related to JH increase male production in Daphnia magna and other daphnids (Peterson et al. 2001, Tatarazako et al. 2003, Oda et al. 2005). These findings suggest that sex determination in Daphnia is closely tied to hormonal systems. Thus, the investigation of hormonal systems in Daphnia will improve our understanding of reproduction, development, and growth. Therefore, it is important to clarify the genetic structure and expression profile of EcR in Daphnia for understanding the hormonal effect on Daphnia.

Understanding of EcR and USP of Daphnia is also important from the ecotoxicological point of view. Small crustaceans such as water fleas play important roles in ecosystems, providing an essential component of fish diets and contributing to water clarity by grazing algae. In light of the importance of small crustaceans to the ecosystem, there has been a considerable effort to evaluate the ecotoxicity of various chemicals on daphnids and to quantify their effects on growth, reproduction, and behavior. In contrast, our understanding of Daphnia hormonal system at the molecular level remains limited.

Understanding of EcR and USP may also be important for the development of insecticides. Some insecticides have been developed to target the growth of pests by disturbing hormonal systems (Dhadialla et al. 1998); however, their effects on non-target arthropods have not been evaluated fully. In order to develop insecticides that are safe for the environment, it would be desirable to have molecular discrimination between the hormone receptors of pests and non-target arthropods. Cloning of hormone receptors and development of reporter systems may be helpful in understanding the similarities and differences between Daphnia and other arthropods.

In this study, we cloned cDNAs encoding EcR and USP from Daphnia. We identified EcR subtypes and showed that these subtypes are differentially regulated. In addition, using a reporter system, we analyzed their responses to several chemicals.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemicals

Ponasterone A, Muristerone A, Tebufenozide, Pyriproxyfen, and Fenoxycarb were purchased from Wako Pure Chemical Industries Ltd, Osaka, Japan. JH and 20-hydroxy Ec were purchased from ICN (Costa Mesa, CA, USA). All chemicals were dissolved in ethanol.

Daphnia strain and culture conditions

The D. magna strain (NIES clone) was obtained from the National Institute for Environmental Studies (NIES; Tsukuba, Japan; Tatarazako et al. 2003). The strain originated at the Environmental Protection Agency USA and was maintained for more than 10 years at NIES. Culture medium was prepared using charcoal-filtered tap water maintained at room temperature overnight prior to use. Cultures of 20 individuals per liter were incubated at 24 ± 1 °C under a 14 h light:10 h darkness photoperiod.A0.01 mlsuspensionof 4.3 x 108 cells/mlChlorella was added daily to each culture. Water quality (pH and dissolved oxygen concentration) was measured every 2 days by the Environmental Research Center KK (Tsukuba, Japan). Water hardness was between 72 and 83 mg/l, pH between 7.0 and 7.5, and dissolved oxygen concentrations between 80 and 99%.

Cloning of EcR and USP

A Daphnia cDNA library (Watanabe et al. 2005) was screened with digoxigenin-labeled DNA probes of Drosophila EcR or USP (Dr S Kato, Tokyo University, Japan) and partial cDNA clones were obtained. The cDNAs encoding full-length EcR B1 and USP of Drosophila were excised from the expression vectors of the genes (Maki et al. 2004). The excised DNA fragments were labeled with digoxigenin-11 dUTP using DIG Labeling Kit (Roche Diagnostics). Daphnia cDNA libraries were screened with the DIG-labeled probes. Hybridization was performed using DIG Easy Hyb (Roche Diagnostics) and detected by DIG Nucleic Acid Detection Kit (Roche Diagnostics). From 2 x 106 independent clones, 10 and 14 clones were isolated as EcR and USP cDNA respectively. Based on the sequences of the cDNAs, we performed 5' rapid amplification of cDNA ends (RACE; Cap Fishing, SeeGene, Seoul, South Korea), followed by PCR. These products were purified by agarose gel electrophoresis, cloned into pGEM-T easy (Promega), and sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems Japan Ltd, Tokyo, Japan). The presence of specific mRNAs was confirmed using PCR with oligonucleotides containing the translational start and stop codons. These nucleotide sequences were submitted to the DNA Data Bank of Japan (DDBJ) web site (Accession number: AB274819 [GenBank] -24).

Ligand-binding domain (LBD) amino acid sequences were aligned and analyzed using CLUSTAL W from the DDBJ web site (http://www.ddbj.nig.ac.jp/search/clustalw-j.html; Thompson et al. 1994), to construct a phylogenetic tree using the neighbor-joining method (Saitou & Nei 1987). The CLUSTAL W analysis was performed using default settings and relative branch support was evaluated by bootstrap analysis.

Quantitative PCR

For gene expression analysis, Daphnia at 2 weeks of age were used. The time of molting was assigned as 0 h and samples were collected every 6 h for the following 72 h. In general, the next molting was observed at 66 h. For embryos, the time of ovulation was assigned as 0 h. The embryos were collected every 6 h for the following 72 h. After collection, Daphnia were washed briefly, and then treated with TRIZOL (Invitrogen Corp.) to extract total RNA, according to the manufacturer’s protocol. Homogenization was performed using the NS-310E physcotron (Nichion, Tokyo, Japan), after which cDNA was synthesized from total RNA using Superscript II RT (–; Invitrogen Corp.) with random primers at 42 °C for 60 min. The PCR were performed in an ABI Prism 7000 (Applied Biosystems Japan Ltd) using the SYBR-Green PCR core reagents kit (Applied Biosystems Japan Ltd), in the presence of appropriate primers. PCR amplifications were performed in triplicate using the following conditions: 2 min at 50 °C and 10 min at 95 °C, followed by a total of 40 two-temperature cycles (15 s at 95 °C and 1 min at 60 °C). In order to avoid the unexpected degradation of RNA, we did not treat RNA with DNase. Instead, we confirmed that contamination of genomic DNA was negligible by PCR using intron containing primers (data not shown). Gel electrophoresis and melting curve analyses were performed to confirm correct amplicon size and the absence of non-specific bands. The primers were chosen to amplify short PCR products of < 150 bp; primer sequences are listed in Table 1Go.


View this table:
[in this window]
[in a new window]

 
Table 1 Primer sequences for quantitative real-time PCR
 
Construction of the reporter system

We used a two-hybrid system to detect chemicals that activate Daphnia EcR. DNA encoding the LBDs of EcR and USP were amplified using the following oligonucleotides: Daphnia EcR, Forward (F) 5'- GGATCCTCAC-GGTCGGCATGCGGCC -3' and Reverse (R) 5'-TTCTAGATGGCGTTCACGAATGGAC–3'; Daphnia USP, F 5'- AGGATCCTGCAGATGGGCATGAAGCG–3' and R 5'- TTCTAGACCAGTTCTAAGTTTCTGC–3'. The amplified DNA fragments were digested with BamHI and XbaI and cloned into pBIND and pACT (Promega) respectively. They were designated as pBIND-EcR (LBD) and pACT-USP (LBD) respectively. As a control, we also constructed Drosophila EcR/USP two-hybrid system. The -corresponding Drosophila domains were amplified using the following oligonucleotides: Drosophila EcR, F 5'- GG ATCCTCACGGTCGGCATGCGGCC -3' and R 5'-GCTCTAGACTATGCAGTCGTCGAGTGCTCC -3'; and Drosophila USP, F 5'- GTCGACTAACCTGCGGCAT GAAGCG-3' and R 5'- TCTAGACTACTCCAGTTTCAT CGCC-3'. The amplified DNA fragments were digested with SalI and XbaI and cloned into pBIND and pACT (Promega) respectively. The cDNA encoding the LxxLL domain of Drosophila Taiman protein (1028–1235 amino acid (aa)) was amplified using total RNA prepared from Schneider cells and the primers 5'-GGATCCGTGGCGGTCTGGG AGGACTG-3' and 5'- TCTAGATCAGGCTAGCGTGCT GCTCAC-3'. The amplified DNA fragment was cloned into pGEM-T easy, digested with BamHI and NotI, then subcloned into pACT using the BamHI and NotI sites. This construct was designated as pact-taiman (LXXLL). All of the inserted sequences were confirmed as being cloned in-frame without any amino acid substitutions or deletions.

For transfections, Chinese hamster ovary (CHO) cells were grown in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum and incubated at 37 °C in a 5% CO2 atmosphere. The day before transfection, cells were transferred to a 24-well plate. The transfection was performed using FuGENE6 (Roche Diagnostics), according to the manufacturer’s protocols. Each well received 0.03 µg pBIND-EcR (LBD), 0.03 µg pACT-USP (LBD), 0.1 µg pACT-taiman (LXXLL), and 0.3 µg pG5luc, which has luciferase gene under the control of GAL4-binding site. Ligand was added to the medium after 24 h and cells were harvested after 48 h. Reporter activities were measured using the Dual-Luciferase Assay kit (Promega), according to the manufacturer’s protocols. The experiment was repeated thrice and the average values were calculated.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
EcR structure

By screening the Daphnia cDNA library (Watanabe et al. 2005) and combination of 5' RACE, five types of full-length cDNAs were obtained as schematically indicated in Fig. 1Go. The deduced amino acid sequences indicated that all five cDNAs encoded identical 39 aa at the C-terminus of the A/B domain, 73 aa of C domain, 102 aa of D domain, and 221 aa of E/F domain (Fig. 2Go). The five cDNAs differ in most part of A/B domain and 5' untranslated region (UTR). According to their coding sequences, there were three types of A/B domain. Two of them have identical amino acid sequence except for N-terminal region. The shorter subtype (597 aa) lacks 124 aa at the N-terminus of the longer subtype (721 aa). These two subtypes have two common types of UTRsas indicated in Figs 1Go and 3Go. As BLAST searches indicated similarity between the common amino acid sequence of the two subtypes and those of EcR-A of other species, these two proteins were designated as A1 (597 aa) and A2 (721 aa) subtypes. Characteristic amino acids conserved in the A box of many species could be identified in the two subtypes (Cruz et al. 2006).


Figure 1
View larger version (24K):
[in this window]
[in a new window]

 
Figure 1 Schematic representation of D. magna EcR (DapEcR) structures. Three protein subtypes were encoded by the five cDNAs isolated. Both EcR-A1 and A2 have two types of UTRs, which are indicated as {alpha} and ß. Open reading frames of the subtypes are indicated in boxes. Different nucleotide sequences are indicated in different patterns.

 

Figure 2
View larger version (79K):
[in this window]
[in a new window]

 
Figure 2 Nucleotide sequence of the D. magna EcR common region. Nucleotide sequence of the D. magna EcR cDNA common to all subtypes is indicated. Deduced amino acid sequence is also indicated. Dark and light shaded amino acids indicate DNA-binding domain (DBD) and ligand-binding domain (LBD) respectively. Nucleotide sequences that were used for 5'-RACE are indicated in boxes.

 

Figure 3
View larger version (73K):
[in this window]
[in a new window]

 
Figure 3 Nucleotide sequence of the D. magna EcR-A specific region. Nucleotide sequences of subtype A specific region is indicated with deduced amino acid sequence. As schematically indicated in Fig. 1Go, four types of cDNAs were identified, which correspond to a + c + d (EcR-A2{alpha}), b + c + d (EcR-A2ß), a + d (EcR-A1{alpha}), and b + d (EcR-A1ß). The first methionine of EcR-A1 is indicated by circle. Amino acid sequence conserved as A box of EcR in many species is underlined.

 
The other subtype shared no common amino acid sequences with EcR-A in the A/B domain except for 39 aa mentioned above. It had a characteristic 195 aa in the A/B domain and the full-length protein was 629 aa. Nucleotide sequence specific for this subtype is indicated in Fig. 4Go. The 629 aa subtype showed similarity to EcR-B from other species and EcR-B subtype-specific amino acids were conserved in the Daphnia EcR as shown in Fig. 5Go. Thus, this subtype was designated as EcR-B.


Figure 4
View larger version (52K):
[in this window]
[in a new window]

 
Figure 4 Nucleotide sequence of the D. magna EcR-B specific region. Nucleotide sequences of subtype A specific region is indicated with deduced amino acid sequence. Amino acid sequence conserved as B box of EcR in many species is underlined.

 

Figure 5
View larger version (24K):
[in this window]
[in a new window]

 
Figure 5 Aligned amino acid sequence of EcR-B conserved region. Amino acid sequence of D. magna EcR-B was compared with other EcR-Bs and the conserved region is indicated. Identical amino acids are indicated.

 
The deduced sequences of Daphnia EcR exhibited > 87% amino acid identity to the DBD and > 60% identity to the LBD of Drosophila EcR. Within the DBD domain, the P- and D-boxes showed 100% identity with those of Drosophila EcR. Daphnia EcR also exhibited 67% amino acid identity to the DBD of human LXR{alpha} (Table 2Go).


View this table:
[in this window]
[in a new window]

 
Table 2 Conserved amino acids of Daphnia ecdysone receptor and ultraspiracle
 
Based on the amino acid sequences of LBD, phylogenetic analysis was performed. Amino acid sequences of LBD of 18 different EcR-related genes (Table 3Go) were obtained from database (National Center for Biotechnology Information: http://www.ncbi.nlm.nih.gov/) and analyzed. Daphnia EcR showed highest similarity to the fiddler crab Uca (Chung et al. 1998). As indicated by previous study of the fiddler crab, LBD of this group showed similarity to LBD of human LXR (Fig. 6Go).


View this table:
[in this window]
[in a new window]

 
Table 3 Ligand-binding domain sequences of EcR-related genes obtained from the National Center for Biotechnology Information database
 

Figure 6
View larger version (14K):
[in this window]
[in a new window]

 
Figure 6 Phylogenic tree of EcRs and related nuclear receptors. Amino acid sequence of Daphnia EcR LBD was compared with other EcR LBDs. Bootstrap values for 1000 replicate analyses are shown at the branching points. The bar at the bottom indicates branch length, corresponding to the mean number of differences (0.1) per residue along each branch.

 
USP structure

By screening the Daphnia cDNA library (Watanabe et al. 2005) with the Drosophila USP probe, we isolated clones exhibiting a high degree of sequence similarity to genes encoding other USPs and retinoid x receptors (RXRs). Using the clone sequences, we performed 5' RACE to obtain full-length USP cDNA and obtained two DNA fragments. The deduced amino acid sequences of these fragments were identical and the only differences observed were in the 5' flanking sequences and the amino acid sequence was identical to the previous study (Wang et al. 2007; Supplemental Figure; see supplementary data in the online version of the Journal of Endocrinology at http://joe.endocrinology-journals.org/content/vol193/issue1).

USP comprises A/B, C, D, and E/F domains (81, 66, 31, and 222 aa respectively), and as with other nuclear receptors, the DNA-binding domain exhibits a high level of conservation with other USP/RXRs (Table 2Go). We also obtained a variant containing a 6 aa deletion in the A/B domain (deleted between amino acids 49 and 54). Different from the fiddler crab that showed highest similarity to Daphnia EcR, deletion variant of LBD could not be isolated in this study. The LBD phylogenic tree indicates a similarity between Daphnia USP and USPs in other crustaceans, as well as insects. A dendrogram calculated from alignments of these LBDs is presented in Fig. 7Go, although the DBD of Daphnia USP shows a greater similarity to that of Drosophila USP than to human RXR, the LBD shows a greater similarity to the latter than to the former. Overall, these data indicate that Daphnia EcR is most similar to EcRs from other crustaceans and that Daphnia USP is most similar to mammalian RXRs, rather than to USPs from insects such as the Diptera or Lepidoptera.


Figure 7
View larger version (15K):
[in this window]
[in a new window]

 
Figure 7 Phylogenic tree of USP and related nuclear receptors. Amino acid sequence of Daphnia EcR LBD was compared with other EcR LBD. Bootstrap values for 1000 replicate analyses are shown at the branching points. The bar at the bottom indicates branch length, corresponding to the mean number of differences (0.1) per residue along each branch.

 
Temporal expression patterns

The fact that there were five types of mRNA coding EcR raised a possibility that expression of EcR subtypes are differentially regulated in a spatio-temporal manner. Thus, we examined expression of the different EcR subtypes between molts in adulthood ( > 2 weeks old). We designed primers to discriminate between expression of EcR-A and EcR-B (Table 1Go), and observed differences in their temporal expression (Fig. 8Go). Changes in mRNA expression levels of these subtypes were different from each other. During the molting period, gene expression changes of EcR-B were prominent. Gene expression levels of EcR-B were activated more than 20-fold just before molting, whereas EcR-A was activated only fivefold. Similar to EcR-A, gene expression changes of USP were not drastically changed but it was notable that temporal gene expression profile of USP was similar to that of EcR-A. Both USP and EcR-A were activated around 60 h, which is 6 h before molting. Although clarification of tissue-specific expression patterns of these subtypes is necessary, this result suggests that EcR-A and EcR-B play a distinct role in molting.


Figure 8
View larger version (13K):
[in this window]
[in a new window]

 
Figure 8 Expression of EcR (A and B) and USP in adult Daphnia. Expression levels were examined in Daphnia adults (2-week-old) during a molting period. Time at molting was assigned as 0 h and the nextmoltingwasobservedat66 h(indicated by arrows).The minimum expression levels were designated as one and the magnitude of changes in expression are indicated for each time point. Bars indicate S.D. expression (Fig. 9Go). We detected a decrease of USP mRNA at the beginning of embryogenesis that was similar to the result of the previous study (Wang et al. 2007).

 
As it is known that EcR and USP play an important role not only in molting but also in development, we examined EcR and USP expression during embryogenesis. It was notable that the expression of EcR-B was activated in two phases. One was at the beginning of embryogenesis (6 h) and the other was at mid-maturation (45 h) that corresponds to rupture of embryonic membrane, whereas that of EcR-A increased only about threefold, 6 h before molting. The increase in EcR-B expression correlated closely with molting, suggesting that it relates to molting control. In contrast, we observed small changes in USP

Response to Ecs and construction of a reporter system

In order to confirm the response of EcR to Ec and related chemicals, we constructed a two-hybrid system as a reporter for ligand-dependent transcription alactivation of EcR from Daphnia and Drosophila. For both organisms, we prepared fusions of DNA encoding the LBD of EcR and the DBD of Gal4, as well as the LBD of USP and the transcriptional activation domain of VP16. When these chimeric genes were transfected into CHO cells, ligand-dependent transcriptional activation could be detected. This activation was enhanced further by cotransfection of DNA encoding the Drosophila Taiman LxxLL motif (Bai et al. 2000), a known coactivator of EcR in Drosophila. The enhancement of the reporter gene was evident when it was transfected with Drosophila EcR and USP (data not shown).

Ligand-dependent transcriptional activation was observed for both Daphnia and Drosophila EcR reporters only when Ec analogs such as Ponasterone A, Muristerone A, and Tebufenozide were added to the culture medium (Fig. 10Go). Non-ecdysteroidal chemicals such as JH, Pyriproxyfen, and Fenoxycarb did not activate the reporter. These results suggest that the recombinant EcR and USP can interact in a ligand-dependent manner that is specific to Ec.


Figure 10
View larger version (19K):
[in this window]
[in a new window]

 
Figure 10 Effects of chemicals on EcR/USP interaction. Ecdysone-like activities of chemicals were estimated using a two-hybrid system containing recombinant EcR and USP. Cells were transfected with plasmids, pBIND-EcR (LBD), pACT-USP (LBD), pACT-taiman (LXXLL), and pG5luc and exposed to a chemical for 24 h. As a control, the same system using Drosophila EcR and Drosophila USP was examined (see Materials and Methods). Concentration of each chemical was 1 µM. Ec, Ecdysone; Pona, Ponasterone A; Muri, Muristerone A; Teb, Tebufenozide; JH3, Juvenile hormone; Pyri, Pyriproxyfen; Feno, Fenoxycarb. Bars indicate S.D.

 
Using this system, we examined dose-dependent protein–protein interactions of EcR and USP. We observed similar responses to Ec from both the Daphnia and Drosophila EcR/USP systems (Fig. 11Go). In contrast, Daphnia EcR/USP responded to lower doses of Ponasterone A than Drosophila EcR/USP (Fig. 11Go). Interestingly, the effects of Tebufenozide were different to Ponasterone A with Drosophila EcR/USP exhibiting higher expression levels than Daphnia EcR/USP at equivalent dosages. Given that these responded similarly to Ec, the different responses to Ponasterone A and Tebufeno-zide may reflect differences in ligand specificity.


Figure 11
View larger version (11K):
[in this window]
[in a new window]

 
Figure 11 Dose-dependent responses of the EcR reporter systems in response to chemicals with ecdysone-like activity. Cells were transfected with plasmids, pBIND-EcR (LBD), pACT-USP (LBD), pACT-taiman (LXXLL), and pG5luc. As a control, the same system using Drosophila EcR and Drosophila USP was also examined. Several doses of chemicals were used to evaluate dose-dependent gene activation. X-axis indicates concentration of chemical and Y-axis indicates fold changes. Bars indicate S.D.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Daphnia EcR and USP

In this study, we cloned and characterized EcR and USP from D. magna. We found three isoforms of EcR: two subtypes exhibited similarity to Drosophila EcR-A and the third showed similarity to Drosophila EcR-B. This is the first report showing A/B isoforms in crustceans. The presence of multiple EcR subtypes has been observed for other species. Three subtypes are also found in Drosophila: one EcR-A isoform and two EcR-B isoforms (EcR-B1 and the truncated form EcR-B2; Talbot et al. 1993). Characteristic tissue and temporal expression patterns of these isoforms have been reported in Drosophila and other arthropods such as silk worms (Kamimura et al. 1997) and tobacco hornworms (Jindra et al. 1996). These isoforms share common DNA and LBDs, but differ in their N-terminal A/B domains.

We examined temporal changes in the expression of these EcR subtypes, although differences in tissue distribution remain to be determined. Our observation of differential isoform expression in Daphnia suggests that, as with other species, these subtypes play distinct roles in daphnids. As the changes in EcR-B expression corresponded closely to molting, this isoform may be responsible for the initiation of this process. Although it was difficult to precisely estimate the copy number of mRNA of each subtype, mRNAs of EcR-A and USP could be easily detected by PCR rather than EcR-B in adult. As EcR functions by forming heterodimer with USP, major EcR heterodimer may be composed of EcR-A and USP and this component may be changed to EcR-B and USP at critical stages such as molting and early development. Precise spatio-temporal analyses may elucidate the role of other EcR subtypes and indicate how their functional differences affect hormonal systems in Daphnia.

At the beginning of embryogenesis, transcription status changes drastically and it is difficult to normalize using genes that are stably expressed. Thus, in this study, we showed gene expression changes based on the number of embryos in Fig. 9Go. Although we examined gene expression changes of several ribosomal proteins and elongation factors that have been used for the control gene, we indicated only the expression change of ribosomal protein L32 in Fig. 9Go, because gene expression changes were minimum. It was notable that the changes of total RNA, ribosomal protein L32, and USP were less than ninefold, expression levels of EcR-A and EcR-B were changed more than 30- and 140-fold respectively. Thus, the characteristic changes of EcR expression are not essentially affected by normalization.


Figure 9
View larger version (16K):
[in this window]
[in a new window]

 
Figure 9 Expression of EcR and USP in Daphnia embryos. Expression levels were examined during embryogenesis. Ovulation was assigned as 0 h. Gene expression levels at each time point were divided by the minimum expression levels during the period and its value was indicated. Bars indicate S.D.

 
Daphnia EcR reporter system

In order to confirm that recombinant Daphnia EcR could respond to Ec, we expressed these receptors in cell culture and examined their responses. Certain combinations of EcR and USP cannot efficiently activate ligand-dependent transcription in cell culture. When we transfected DNA encoding the full-length receptors fused to reporter genes, weak activation (less than twofold) was detected. However, activation could not be detected in the absence of USP. In order to enhance ligand-dependent activation, we constructed a two-hybrid system for the detection of ligand-dependent protein–protein interactions. Although the doses required for the detection of gene activation were high (µM concentrations), even for Ec, they were consistent with previously reported dosages (Hu et al. 2003).

We cotransfected DNA encoding the Drosophila Taiman LxxLL motif with our EcR/USP reporter system. In the absence of Tai (LxxLL) expression, transcriptional activation of Drosophila EcR/USP could not be detected, although DaphEcR/USP responded to Ec and other Ec analogs (data not shown). Although the molecular interactions of these chimeric genes remain unclear, it has been suggested that Drosophila USP exerts an allosteric effect on EcR (Hu et al. 2003) and our study indicates that binding of the Taiman LxxLL motif may contribute to EcR conformational stability.

Daphnia EcR response to chemicals

Using our reporter system, we were able to compare the effects of Ec and other chemicals on EcR/USP activity in Daphnia and Drosophila. We found that Daphnia and Drosophila responded similarly to Ec, but exhibited different responses to Ponasterone A and Tebufenozide. Ponasterone A activated Daphnia EcR/USP at a lower concentration than that required to activate Drosophila EcR/USP. In addition, Ponasterone A is known to cause molting in D. magna at a 10-fold lower concentration than Ec. These results support the suggestion that differences in the affinity of EcR for its ligands are responsible for the different concentrations of EC and Ponasterone A required to affect molting (Baldwin et al. 2001). Recently, the structure of Heliothis virescens EcR/USP was elucidated using X-ray crystallography, and investigation of Ponasterone A and BYI06830 (a non-steroidal, lepidopteran-specific agonist) binding indicated the presence of different ligand-binding pockets for steroidal and non-steroidal ligands (Billas et al. 2003). Thus, a possible reason for differences in ligand-binding activity may be differences in the amino acids responsible for non-steroidal ligand binding. As the amino acids responsible for binding BYI06830 in Heliothis virescens are conserved in Daphnia, the ligand-binding activity of Daphnia EcR cannot be explained completely by the composition of amino acid residues responsible for direct ligand binding.

In this study, we cloned EcR and USP from Daphnia magna and confirmed that these nuclear receptors interact in a ligand-dependent manner. As interest in the development of environmentally safe insecticides increases, we consider that the in vitro reporter system developed in this study may be useful not only for understanding the role of hormones at the molecular level in Daphnia, but also for the screening and evaluation of Ec-like chemicals for the purposes of pest control.


    Acknowledgements
 
We thank Dr Shigeaki Kato (University of Tokyo) for providing Drosophila EcR and USP cDNAs. This work was supported by grants from the Ministry of the Environment, Japan. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bai J, Uehara Y & Montell DJ 2000 Regulation of invasive cell behavior by taiman, a Drosophila protein related to AIB1, a steroid receptor coactivator amplified in breast cancer. Cell 103 1047–1058.[CrossRef][Web of Science][Medline]

Baldwin WS, Bailey R, Long KE & Klaine S 2001 Incomplete ecdysis is an indicator of ecdysteroid exposure in Daphnia magna. Environmental Toxicology and Chemistry 20 1564–1569.[CrossRef][Web of Science][Medline]

Billas IM, Iwema T, Garnier JM, Mitschler A, Rochel N & Moras D 2003 Structural adaptability in the ligand-binding pocket of the ecdysone hormone receptor. Nature 426 91–96.[CrossRef][Medline]

Chung AC, Durica DS, Clifton SW, Roe BA & Hopkins PM 1998 Cloning of crustacean ecdysteroid receptor and retinoid-X receptor gene homologs and elevation of retinoid-X receptor mRNA by retinoic acid. Molecular and Cellular Endocrinology 139 209–227.[CrossRef][Web of Science][Medline]

Cruz J, Mane-Padros D, Belles X & Martin D 2006 Functions of the ecdysone receptor isoform-A in the hemimetabolous insect Blattella germanica revealed by systemic RNAi in vivo. Developmental Biology 297 158–171.[CrossRef][Web of Science][Medline]

Dhadialla TS, Carlson GR & Le DP 1998 New insecticides with ecdysteroidal and juvenile hormone activity. Annual Review of Entomology 43 545–569.[CrossRef][Web of Science][Medline]

Dubrovsky EB 2005 Hormonal cross talk in insect development. Trends in Endocrinology and Metabolism 16 6–11.[CrossRef][Web of Science][Medline]

Hall BL & Thummel CS 1998 The RXR homolog ultraspiracle is an essential component of the Drosophila ecdysone receptor. Development 125 4709–4717.[Abstract]

Hu X, Cherbas L & Cherbas P 2003 Transcription activation by the ecdysone receptor (EcR/USP): identification of activation functions. Molecular Endocrinology 17 716–731.[Abstract/Free Full Text]

Jindra M, Malone F, Hiruma K & Riddiford LM 1996 Developmental profiles and ecdysteroid regulation of the mRNAs for two ecdysone receptor isoforms in the epidermis and wings of the tobacco hornworm, Manduca sexta. Developmental Biology 180 258–272.[CrossRef][Web of Science][Medline]

Kamimura M, Tomita S, Kiuchi M & Fujiwara H 1997 Tissue-specific and stage-specific expression of two silkworm ecdysone receptor isoforms –ecdysteroid-dependent transcription in cultured anterior silk glands. European Journal of Biochemistry 248 786–793.[Web of Science][Medline]

Maki A, Sawatsubashi S, Ito S, Shirode Y, Suzuki E, Zhao Y, Yamagata K, Kouzmenko A, Takeyama K & Kato S 2004 Juvenile hormones antagonize ecdysone actions through co-repressor recruitment to EcR/USP heterodimers. Biochemical and Biophysical Research Communications 320 262–267.[CrossRef][Web of Science][Medline]

Mu X & LeBlanc GA 2002 Environmental antiecdysteroids alter embryo development in the crustacean Daphnia magna. Journal of Experimental Zoology 292 287–292.[CrossRef][Web of Science][Medline]

Mu X & LeBlanc GA 2004 Cross communication between signaling pathways: juvenoid hormones modulate ecdysteroid activity in a crustacean. Journal of Experimental Zoology. Part A, Comparative Experimental Biology 301 793–801.

Oda S, Tatarazako N, Watanabe H, Morita M & Iguchi T 2005 Production of male neonates in four cladoceran species exposed to a juvenile hormone analog, fenoxycarb. Chemosphere 60 74–78.[Medline]

Peterson JK, Kashian DR & Dodson SI 2001 Methoprene and 20-OH-ecdysone affect male production in Daphnia pulex. Environmental Toxicology and Chemistry 20 582–588.[CrossRef][Web of Science][Medline]

Riddiford LM 1993 Hormones and Drosophila development. In The Development of Drosophila Melanogaster, pp 899–939. Eds N Bate & A Martinez-Arias. New York: Cold Spring Harbor Laboratory Press.

Saitou N & Nei M 1987 The neighbor-joining method: a new method for reconstructingphylogenetic trees.Molecular Biologyand Evolution 4 406–425.

Sekimoto T, Iwami M & Sakurai S 2006 Coordinate responses of transcription factors to ecdysone during programmed cell death in the anterior silk gland of the silkworm, Bombyx mori. Insect Molecular Biology 15 281–292.[CrossRef][Web of Science][Medline]

Subramoniam T 2000 Crustacean ecdysteriods in reproduction and embryogenesis. Comparative Biochemistry and Physiology. Toxicology and Pharmacology 125 135–156.[CrossRef]

Talbot WS, Swyryd EA & Hogness DS 1993 Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell 73 1323–1337.[CrossRef][Web of Science][Medline]

Tatarazako N, Oda S, Watanabe H, Morita M & Iguchi T 2003 Juvenile hormone agonists affect the occurrence of male Daphnia. Chemosphere 53 827–833.[Medline]

Thompson JD, Higgins DG & Gibson TJ 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22 4673–4680.[Abstract/Free Full Text]

Wang YH, Wang G & LeBlanc GA 2007 Cloning and characterization of the retinoid X receptor from a primitive crustacean Daphnia magna. General and Comparative Endocrinology 150 309–318.[CrossRef][Web of Science][Medline]

Watanabe H, Tatarazako N, Oda S, Nishide H, Uchiyama I, Morita M & Iguchi T 2005 Analysis of expressed sequence tags of the water flea Daphnia magna. Genome 48 606–609.[Medline]

Yao TP, Segraves WA, Oro AE, McKeown M & Evans RM 1992 Drosophila ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell 71 63–72.[CrossRef][Web of Science][Medline]

Yao TP, Forman BM, Jiang Z, Cherbas L, Chen JD, McKeown M, Cherbas P & Evans RM 1993 Functional ecdysone receptor is the product of EcR and Ultraspiracle genes. Nature 366 476–479.[CrossRef][Medline]

Received in final form 25 January 2007
Accepted 26 January 2007
Made available online as an Accepted Preprint 2 February 2007





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kato, Y.
Right arrow Articles by Iguchi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kato, Y.
Right arrow Articles by Iguchi, T.


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS