JOE
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2007) 192, 83-86       DOI: 10.1677/JOE-06-0009
© 2007 Society for Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rocha, A. S.
Right arrow Articles by Soares, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rocha, A. S.
Right arrow Articles by Soares, P.

Thyroid hormone receptor ß mutations in the ‘hot-spot region’ are rare events in thyroid carcinomas

Ana Sofia Rocha1, Ricardo Marques1, Inês Bento1, Ricardo Soares1, João Magalhães2, Inês Vieira de Castro3 and Paula Soares1,4

1 IPATIMUP, Institute of Molecular Pathology and Immunology of the University of Porto, Rua Roberto Frias s/n, 4200-065 Porto, Portugal
2 Department of Pathology, Hospital São João, Porto, Portugal
3 Department of Pathology, Medical Faculty, University of São Paulo, São Paulo, Brazil
4 Department of Pathology, Medical Faculty, University of Porto, Porto, Portugal

(Requests for offprints should be addressed to A S Rocha; Email: arocha{at}ipatimup.pt)


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Thyroid cancer constitutes the most frequent endocrine neoplasia. Targeted expression of rearranged during transfection (RET)/papillary thyroid carcinoma (PTC) and V600E V-raf murine sarcoma viral oncogene homolog B1 (BRAF) to the thyroid glands of transgenic mice results in tumours similar to those of human PTC, providing evidence for the involvement of these oncogenes in PTC. Kato et al. developed a mouse model that mimics the full spectrum of the human follicular form of thyroid cancer (FTC). FTC rapidly develops in these mice through introduction of the thyroid hormone receptor ß (THRB)PV mutant on the background of the inactivated THRB wt locus. Our aim was to verify if, in the context of human follicular thyroid carcinogenesis, THRB acted as a tumour suppressor gene. We screened for mutations of the THRB gene in the hot-spot region, spanning exons 7–10, in 51 thyroid tumours and six thyroid cancer cell lines by PCR and direct sequencing. We did not find mutations in any of the tumours or cell lines analysed. Our findings suggest that, in contrast to the findings on the THRB-mutant transgenic mice, THRB gene mutations are not a relevant mechanism for human thyroid carcinogenesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Well-differentiated thyroid carcinoma (WDTC) includes papillary and follicular types. Most WDTC behave in an indolent manner and carry an excellent prognosis (Kondo et al. 2006).

Several genes have been found to be involved in the development of papillary thyroid carcinoma (PTC). Rearrangements of the RET tyrosine kinase receptor gene (RET/PTC) are found in 13–43% and the V600E BRAF in 29–69% of sporadic PTC (Kondo et al. 2006). Targeted expression of RET/ PTC and V600E BRAF to the thyroid glands of transgenic mice results in tumours, similar to human PTC, providing evidence for the involvement of these oncogenes in the initiation of PTC (Jhiang et al. 1996, Knauf et al. 2005). These two oncogenes are thought to exert their effect through activation of the mitogen activated protein kinase (MAPK) pathway (Kondo et al. 2006)

Accumulated evidence indicates that follicular thyroid carcinoma (FTC) arise through an oncogenic pathway distinct from that of PTC. At the molecular genetic level, both histological types share the presence of rat sarcoma viral oncogene (RAS) mutations, although at different frequencies: 0–21% for PTC and 40–53% for FTC (Kondo et al. 2006). Paired box 8 (PAX-8)/peroxisome proliferators-activated receptor {gamma} (PPAR-{gamma}) rearrangement, present in 25–63% of FTC (Kondo et al. 2006) is only found at similar frequencies in the so-called follicular variant of PTC, being absent from the conventional PTC (Castro et al. 2006).

At variance with PTC, a mouse model for FTC was lacking until Kaneshige et al.(2000) described a mutant mouse with a mutation (PV) targeted to the thyroid hormone receptor ß (THRB) locus. In a heterozygous condition, these mice develop a phenotype similar to thyroid hormone resistance syndrome, whereas double-mutant mice spontaneously develop FTC which progress towards undifferentiated carcinoma. The authors proposed that the THRB gene could function as a tumour suppressor gene in FTC (Kato et al. 2004).

In humans, germline inactivating mutations in THRB have been associated with thyroid hormone resistance syndrome which is not associated with any type of thyroid carcinomas; however, in this condition, most of the patients are heterozygous for the mutated allele (Cheng 2005). Somatic THR mutations have been described in human malignancies, such as liver (Lin et al. 1997, 1999) and renal carcinomas (Puzianowska-Kuznicka et al. 2000). Low levels of expression have also been detected in a wide range of neoplasias (Gonzalez-Sancho et al. 2003). The absence of function of both THRB alleles seems to play a role in carcinoma progression. This hypothesis is supported by the finding that the transgenic mice of THRB-mutated gene only develop tumours when both alleles are inactivated (Kato et al. 2004).

Two reports describe a totally different situation regarding THRB mutations in sporadic thyroid tumours: Puzianowska-Kuznicka et al.(2002) claimed a high frequency of mutations in PTC, and Takano et al.(2003) claimed the absence of mutations in the same group of tumours but, as far as we know, nobody has searched for THRB mutations in FTC. In the present study, we attempted to clarify this controversy and to establish whether or not THRB mutations contribute to thyroid carcinoma development/progression, with a particular interest on the FTC pathway. We studied by PCR and direct sequencing the THRB exons 7–10, which are the hot-spot regions for the thyroid hormone resistance syndrome (Cheng 2005).


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Fifty-one paraffin-embedded thyroid tumours were retrieved from the files of Hospital S João/Medical Faculty of Porto and the University Hospital of the State University of São Paulo, Brazil. The analysed lesions were classified according to the criteria advanced by Rosai et al. 2003 into the following categories: FTC (n = 28), classical PTC (n = 16) and benign lesions (n = 7), including three nodular goitres and four follicular adenomas. The histological evaluation was performed independently by two pathologists (I V C, J M).

Six thyroid cell lines (kindly provided by Professors Jacques Dumont and Marc Mareel) were also included in the present study. Two were PTC-derived cell lines (B-CPAP and TPC-1); four were derived from undifferentiated carcinomas (8505C, C643, NPA and Hth74).

Genomic DNA was obtained from microdissected areas of the tumour samples and from cell lines using the Puregene DNA isolation kit (GENTRA Systems, Minneapolis, MN, USA) following the manufacturer protocol.

One hundred samples of DNA from blood donors were used as control population for the variants/mutations.

Primers were designed to the intronic regions of exons 7–10, in order to analyse coding regions and exon/intron boundaries, the sequences are as follows: Exon 7F: gcatctgtgtgccttgtctc; Exon 7R: tgaggtagaaaacactggcata; Exon 8F: caacttcttcatttaaatctttctttt; Exon 8R:attcctggaaactgatgaaactat; Exon 9F: tgttgttcctgactggcatt; Exon 9R: agcgctagacaagcaaaagc; Exon 10F: taaaggcctggaattggaca and Exon 10R: ggcaatggaatgaaatgaca.

PCR was performed for 35 cycles, with the appropriate annealing temperatures. The bands were excised from agarose gels and purified with GFX Amersham Kit following the manufacturer’s protocol.

The DNA obtained was subjected to automated sequencing using the ABI Prism Big Dye Terminator Ready Reaction Kit (Perkin-Elmer, Foster City, CA, USA) and an ABI Prism 3100 Genetic Analyser. Sequencing was performed on both strands using the primers described earlier. Whenever a sequence variant was found, both PCR and sequencing were repeated, in order to rule out possible polymerase introduced mistakes. Only reproducible results were considered valid.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Mutation screening

Mutation screening of RAS, V600E BRAF, as well as PAX-8/ PPAR-{gamma} rearrangement detection was previously reported (Soares et al. 2004, Trovisco et al. 2005, Castro et al. 2006). Sequencing of TRHB exons 7–10 and adjacent intron boundaries did not disclose mutations in any of the samples studied, including the six thyroid cell lines.

DNA sequencing revealed the presence of three sequence variants, one of which had not been previously described in the literature.

The novel synonymous variant, an ACC->ACT transition in codon 232, was found in a nodular goitre. The two previously reported variants were: (a) a g/a transition within a non-coding region that was found in heterozygosity at position 367933 (single nucleotide polymorphism (SNP) ID: rs13063628) in four of the 28 FTC (14.3%) and in three of the 16 PTC (18.75%); two homozygotes for the A allele were found in two anaplastic cell lines (C643 and Hth74) (Fig. 1Go); (b) the transition at position 245 (SNP ID: rs3752874) was found in 43% of the tumour samples; in the latter, the frequency of the rare T allele appeared to be overrepresented in the tumour samples when our data were compared with the data on record (NCBI: SNP database); however, analysis of the blood donor population revealed that the frequency was similar to that of the normal Portuguese population (39%).


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
Figure 1 A Electropherogram demonstrating the presence of 367933 g/a SNP in THRB gene in homozygosity and heterozygosity. The dotted line indicates the coding sequence of exon 9 and the arrow indicates the nucleotide that is variable.

 
The frequency of the variants did not differ according to the histology of the cases (Table 1Go).


View this table:
[in this window]
[in a new window]

 
Table 1 Distribution of THRB DNA variants in the different histotypes of thyroid lesions
 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
THRs belong to the superfamily of ligand-dependent transcription factors that regulate growth, differentiation and maintenance of metabolic homeostasis. THRs are encoded by ß and {alpha} genes, located on chromosomes 3 and 17 respectively (Cheng 2005). Kaneshige et al.(2000) created a mutant mouse by targeting a mutation to the THRB locus (THRBPV/+ mice). This mutation, found in heterozygosity in a patient with thyroid hormone resistance syndrome (PV), leads to a protein without triiodo thyromine (T3)-binding activity that exhibits potent dominant negative activity (Kaneshige et al. 2000). Heterozygous PV mice develop thyroid hormone resistance syndrome while homozygous PV mice develop, as they age, hyperplasia, FTC with capsular and vascular invasion, anaplasia and, eventually, lung metastases (Kato et al. 2004).

In an attempt to verify whether THRB is involved in human thyroid carcinoma we analysed, in a series of 44 PTC and FTC, exons 7–10 of THRB gene. We did not detect any mutation in the regions analysed (only silent sequence variants); thus our results do not support a role for THRB gene alterations in sporadic thyroid tumours in contrast with the in vivo transgenic model (Kato et al. 2004).

Gene expression profiling of thyroid carcinomas in THRBpv/pv mice has identified variation in a number of proteins that can contribute to tumorigenesis (Ying et al. 2003a). Two of the altered pathways consisted of the repression of the PPAR-{gamma}-signalling pathway and upregulation of cyclin D1 (Ying et al. 2003b, Kato et al. 2004).

PAX-8/PPAR-{gamma} rearrangements are frequent in both follicular adenomas and carcinomas (Castro et al. 2006) and the putative mechanism for the effect of this chimeric gene is the loss of function of PPAR-{gamma} (Kroll et al. 2000). In the present series, 8 of the 28 cases had PAX-8/PPAR-{gamma} rearrangements which should harbour the predicted changes in PPAR-{gamma} function and signalling (Castro et al. 2006). It is likely that, regardless of the mechanism, when the PPAR-{gamma} pathway is inactivated in thyroid follicular cells, the line of progression leading to the development of follicular adenoma and carcinoma is activated. Although it is tempting to use this hypothesis to explain the transgenic mice results, we cannot rule out that other tumorigenic mechanisms may be present, namely the upregulation of cell cycle and growth factor-signalling pathway molecules as demonstrated by Kato et al.(2004) and Furuya et al.(2006).

Early reports on THRB mRNA expression in thyroid showed that THRB expression was decreased in PTC and FTC, but not in benign lesions (Bronnegard et al. 1994). Furthermore, methylation of THRB gene promoter has also been demonstrated in breast cancer with concomitant reduction in protein expression (Li et al. 2002). High frequency of somatic deletions has been observed in chromosome 3, where THRB lies, in several human malignancies (Gonzalez-Sancho et al. 2003). Rodrigues-Serpa et al.(2003) demonstrated that thyroid tumours in general, and FTC in particular, display Loss of heterozygosity (LOH), in chromosome 3 (Rodrigues-Serpa et al. 2003). LOH can be excluded in 39% of FTC cases and in 37.5% of PTC cases of the present series since we could detect two different alleles for the C245T SNP. Thus, LOH does not appear to be involved in the regulation of THRB expression in this setting.

Summing up, we did not detect mutations in THRB gene in PTC or in FTC. Our results indicate that THRB is not a classical tumour suppressor gene in human FTC and show that THRB gene mutations are not a relevant mechanism for human thyroid carcinogenesis.


    Acknowledgements
 
The authors would like to thank the precious help of Professor Sobrinho-Simöes in the discussion of the results as well as for the critical evaluation of the manuscript. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


   Funding

This study was partially supported by a Post-Doc Grant (SFRH/BPD/14891/2004-ASR) from the Portuguese Science and Technology Foundation (FCT) and with further funding from the same source (Project – ‘Programa Operacional Ciência Tecnologia e Inovação/Ciências Biomédicas e Oncológicas POCTI/CBO/41084/2001’).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bronnegard M, Torring O, Boos J, Sylven C, Marcus C & Wallin G 1994 Expression of thyrotropin receptor and thyroid hormone receptor messenger ribonucleic acid in normal, hyperplastic, and neoplastic human thyroid tissue. Journal of Clinical Endocrinology and Metabolism 79 384–389.[Abstract]

Castro P, Rebocho AP, Soares RJ, Magalhaes J, Roque L, Trovisco V, Vieira dC I, Cardoso-de-Oliveira M, Fonseca E, Soares P et al. 2006 PAX8-PPARgamma rearrangement is frequently detected in the follicular variant of papillary thyroid carcinoma. Journal of Clinical Endocrinology and Metabolism 91 213–220.[Abstract/Free Full Text]

Cheng SY 2005 Thyroid hormone receptor mutations and disease: beyond thyroid hormone resistance. Trends in Endocrinology and Metabolism 16 176–182.[CrossRef][Web of Science][Medline]

Furuya F, Hanover JA & Cheng SY 2006 Activation of phosphatidylinositol 3-kinase signaling by a mutant thyroid hormone beta receptor. PNAS 103 1780–1785.[Abstract/Free Full Text]

Gonzalez-Sancho JM, Garcia V, Bonilla F & Munoz A 2003 Thyroid hormone receptors/THR genes in human cancer. Cancer Letters 192 121–132.[CrossRef][Web of Science][Medline]

Jhiang SM, Sagartz JE, Tong Q, Parker-Thornburg J, Capen CC, Cho JY, Xing S & Ledent C 1996 Targeted expression of the ret/PTC1 oncogene induces papillary thyroid carcinomas. Endocrinology 137 375–378.[Abstract]

Kaneshige M, Kaneshige K, Zhu X, Dace A, Garrett L, Carter TA, Kazlauskaite R, Pankratz DG, Wynshaw-Boris A, Refetoff S et al. 2000 Mice with a targeted mutation in the thyroid hormone beta receptor gene exhibit impaired growth and resistance to thyroid hormone. PNAS 97 13209–13214.[Abstract/Free Full Text]

Kato Y, Ying H, Willingham MC & Cheng SY 2004 A tumor suppressor role for thyroid hormone beta receptor in a mouse model of thyroid carcinogenesis. Endocrinology 145 4430–4438.[Abstract/Free Full Text]

Knauf JA, Ma X, Smith EP, Zhang L, Mitsutake N, Liao XH, Refetoff S, Nikiforov YE & Fagin JA 2005 Targeted expression of BRAFV600E in thyroid cells of transgenic mice results in papillary thyroid cancers that undergo dedifferentiation. Cancer Research 65 4238–4245.[Abstract/Free Full Text]

Kondo T, Ezzat S & Asa SL 2006 Pathogenetic mechanisms in thyroid follicular-cell neoplasia. Nature reviews. Cancer 6 292–306.[CrossRef][Web of Science][Medline]

Kroll TG, Sarraf P, Pecciarini L, Chen CJ, Mueller E, Spiegelman BM & Fletcher JA 2000 PAX8-PPARgamma1 fusion oncogene in human thyroid carcinoma (corrected). Science 289 1357–1360.[Abstract/Free Full Text]

Li Z, Meng ZH, Chandrasekaran R, Kuo WL, Collins CC, Gray JW & Dairkee SH 2002 Biallelic inactivation of the thyroid hormone receptor beta1 gene in early stage breast cancer. Cancer Research 62 1939–1943.[Abstract/Free Full Text]

Lin KH, Zhu XG, Hsu HC, Chen SL, Shieh HY, Chen ST, McPhie P & Cheng SY 1997 Dominant negative activity of mutant thyroid hormone alpha1 receptors from patients with hepatocellular carcinoma. Endocrinology 138 5308–5315.[Abstract/Free Full Text]

Lin KH, Shieh HY, Chen SL & Hsu HC 1999 Expression of mutant thyroid hormone nuclear receptors in human hepatocellular carcinoma cells. Molecular Carcinogenesis 26 53–61.[CrossRef][Web of Science][Medline]

Puzianowska-Kuznicka M, Nauman A, Madej A, Tanski Z, Cheng S & Nauman J 2000 Expression of thyroid hormone receptors is disturbed in human renal clear cell carcinoma. Cancer Letters 155 145–152.[CrossRef][Web of Science][Medline]

Puzianowska-Kuznicka M, Krystyniak A, Madej A, Cheng SY & Nauman J 2002 Functionally impaired TR mutants are present in thyroid papillary cancer. Journal of Clinical Endocrinology and Metabolism 87 1120–1128.[Abstract/Free Full Text]

Rodrigues-Serpa A, Catarino A & Soares J 2003 Loss of heterozygosity in follicular and papillary thyroid carcinomas. Cancer Genetics and Cytogenetics 141 26–31.[CrossRef][Web of Science][Medline]

Rosai J, LiVolsi VA, Sobrinho-Simoes M & Williams ED 2003 Renaming papillary microcarcinoma of the thyroid gland: the Porto proposal. International Journal of Surgical Pathology 11 249–251.[Free Full Text]

Soares P, Trovisco V, Rocha AS, Feijao T, Rebocho AP, Fonseca E, Vieira dC I, Cameselle-Teijeiro J, Cardoso-Oliveira M & Sobrinho-Simoes M 2004 BRAF mutations typical of papillary thyroid carcinoma are more frequently detected in undifferentiated than in insular and insular-like poorly differentiated carcinomas. Virchows Archives 444 572–576.[CrossRef][Web of Science][Medline]

Takano T, Miyauchi A, Yoshida H, Nakata Y, Kuma K & Amino N 2003 Expression of TRbeta1 mRNAs with functionally impaired mutations is rare in thyroid papillary carcinoma. Journal of Clinical Endocrinology and Metabolism 88 3447–3449.[Abstract/Free Full Text]

Trovisco V, Soares P, Preto A, de C IV, Lima J, Castro P, Maximo V, Botelho T, Moreira S, Meireles AM et al. 2005 Type and prevalence of BRAF mutations are closely associated with papillary thyroid carcinoma histotype and patients’ age but not with tumour aggressiveness. Virchows Archives 446 589–595.[CrossRef][Web of Science][Medline]

Ying H, Suzuki H, Furumoto H, Walker R, Meltzer P, Willingham MC & Cheng SY 2003a Alterations in genomic profiles during tumor progression in a mouse model of follicular thyroid carcinoma. Carcinogenesis 24 1467–1479.[Abstract/Free Full Text]

Ying H, Suzuki H, Zhao L, Willingham MC, Meltzer P & Cheng SY 2003b Mutant thyroid hormone receptor beta represses the expression and transcriptional activity of peroxisome proliferator-activated receptor gamma during thyroid carcinogenesis. Cancer Research 63 5274–5280.[Abstract/Free Full Text]

Received in final form 27 September 2006
Accepted 4 October 2006
Made available online as an Accepted Preprint 17 October 2006




This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
B. Joseph, M. Ji, D. Liu, P. Hou, and M. Xing
Lack of Mutations in the Thyroid Hormone Receptor (TR) {alpha} and Genes but Frequent Hypermethylation of the TR Gene in Differentiated Thyroid Tumors
J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4766 - 4770.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rocha, A. S.
Right arrow Articles by Soares, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rocha, A. S.
Right arrow Articles by Soares, P.


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS