JOE Society for Endocrinology Archive
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2007) 192, 237-247       DOI: 10.1677/joe.1.06769
© 2007 Society for Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dumitrescu, A.
Right arrow Articles by Albrecht, E. D
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dumitrescu, A.
Right arrow Articles by Albrecht, E. D

Developmental expression of cell cycle regulators in the baboon fetal adrenal gland

Adina Dumitrescu, Graham W Aberdeen, Gerald J Pepe1 and Eugene D Albrecht

Department of Obstetrics, Gynecology and Reproductive Sciences and Department of Physiology, Center for Studies in Reproduction, University of Maryland School of Medicine, Baltimore, Maryland 21201, USA
1 Department of Physiological Sciences, Eastern Virginia Medical School, Norfolk, Virginia 23507, USA

(Requests for offprints should be addressed to E D Albrecht who is now at Department of Obstetrics, Gynecology and Reproductive Sciences, University of Maryland School of Medicine, Bressler Research Laboratories 11-019, 655 West Baltimore Street, Baltimore, Maryland 21201, USA; Email: ealbrech{at}umaryland.edu)


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although the human and the nonhuman primate fetal adrenal glands undergo a highly unique pattern of cortical zone-specific intrauterine growth and development, studies of the regulatory components of the cell cycle responsible for this growth have not been conducted. Therefore, the present study determined expression of the cell cycle regulators, cyclin D1 and cyclin E, and their cyclin-dependent kinases, Cdk2, Cdk4, and Cdk6, and Ki67 a marker of cell proliferation within the baboon fetal adrenal cortex during advancing stages of gestation. Fetal adrenal glands were obtained on days 60 (early), 100 (mid), and 160–170 (late) of gestation (term = 184 days). Mean ( ± S.E.) cyclin D1 mRNA levels, determined by RT-PCR and expressed relative to 18S rRNA, were similar at early (0.85 ± 0.09) and mid (1.04 ± 0.08) gestation, then decreased (P < 0.001, ANOVA) approximately 50% by late gestation (0.57 ± 0.04). Cyclin E mRNA levels were also similar at early (2.03 ± 0.07) and mid (1.63 ± 0.31) gestation, and decreased by 70% (P < 0.001) in late gestation (0.53 ± 0.09). Coinciding with the decrease in cyclin D1 and cyclin E, the percentage of Ki67 positive cells in the definitive zone decreased twofold (P < 0.01) between mid (28.2 ± 3.6) and late (13.8 ± 1.7) gestation. The cyclin D1 and cyclin E proteins, determined by immunocytochemistry, were expressed at high levels in the definitive zone of baboon fetal adrenal gland, where they decreased between mid- and late gestation. In contrast, immunocytochemical expression of the functionally important steroidogenic enzyme Delta; 5-3ß-hydroxysteroid dehydrogenase (3ß-HSD) became abundant in the definitive and transitional zones with advancing pregnancy. However, fetal adrenal Cdk2, Cdk4, and Cdk6 mRNA levels and protein immunoexpression were similar in the baboon fetal adrenal at early-, mid-, and late gestation. In summary, expression of cyclin D1, cyclin E, and Ki67 decreased, while 3ß-HSD expression increased, in the fetal adrenal cortex, particularly in the definitive zone, between mid- and late-baboon gestation. We propose that a developmental decline in cellular proliferation permits functional differentiation of fetal adrenal cortical cells, leading to increased production of steroid hormones important for placental estrogen synthesis and maturation of organ systems within the developing fetus.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The human and nonhuman primate fetal adrenal glands undergo a highly unique pattern of cortical zone-specific intrauterine growth and development. Throughout pregnancy, the fetal adrenal cortex is comprised primarily of the fetal zone, which undergoes marked growth and expression of the P450 17{alpha}-hydroxylase, 17–20 lyase (P450C17) enzyme catalyzing synthesis of the C19-steroids, e.g. dehydroepian-drosterone (DHA) and DHA-sulfate (DHAS), utilized as precursors for estrogen synthesis by the placenta (Pepe & Albrecht 1990, Mesiano & Jaffe 1997). The definitive zone, the site of the Delta; 5-3ß-hydroxysteroid dehydrogenase (3ß-HSD) and aldosterone synthase enzymes, appears at early to mid gestation. However, the transitional zone, which expresses both the 3ß-HSD and P450C17 enzymes (Mesiano et al. 1993) that catalyze the production of cortisol for fetal organ maturation, does not develop and undergo growth until late in gestation. The factors that underpin this very striking pattern of fetal adrenocortical growth and development, however, are not clearly understood.

Proliferating mammalian cells pass through an orderly sequence of phases that comprise the cell cycle to promote tissue growth (Pestell et al. 1999, for review). Progression through G1 to S phase is promoted by cyclin D1 and cyclin E, which heterodimerize with catalytic subunits, the cyclin-dependent kinases (Cdks), to form active holoenzymes. Cyclin D1 when associated with Cdk4 and Cdk6, and cyclin E when associated with Cdk2, phosphorylate substrates essential for progression through the restriction point of the cell cycle. We propose that the unique pattern of growth and development of the primate fetal adrenal cortex is regulated by expression of the cyclins and their Cdks in a cortical zone and gestational age-specific manner. However, despite the importance of the cell cycle regulators for cell proliferation and growth, studies of the developmental expression of the cyclins and Cdks in the human fetal adrenal cortex have not been conducted.

Our laboratories have used the baboon as a nonhuman primate model to study the regulation of fetal and placental development (Albrecht & Pepe 1990; Pepe & Albrecht 1995). Therefore, in the present study, we used the baboon and a developmental approach to determine the expression of components of the cyclin system, and the number of cells expressing Ki67 as an index of cell proliferation, in the baboon fetal adrenal cortex at early-, mid-, and late gestation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

Female baboons (Papio anubis) weighing 12–16 kg were housed individually in stainless steel cages in air-conditioned rooms under a 12 h light:12 h darkness cycle. The baboons received standard primate chow and fresh fruit twice daily, vitamins daily and water ad libitum. Females were paired with male baboons for a period of 5 days during the ovulatory phase of the menstrual cycle and pregnancy was determined by palpation and ultrasonography. Animals were cared for and used strictly in accordance with the United States Department of Agriculture (USDA) regulations and the National Research Council Guide for the Care and Use of Laboratory Animals. The experimental protocol employed in this study was approved by the Institutional Animal Care and Use Committees of the University of Maryland School of Medicine and Eastern Virginia Medical School.

On days 60 (n = 4), 100 (n = 5), and 160–170 (n = 5) of gestation (term = 184 days), baboons underwent cesarean section under halothane anesthesia. Blood samples (1 ml) were obtained from a maternal saphenous vein and umbilical (i.e. fetal) artery at the time of cesarean section for analysis of serum estradiol, DHAS, and cortisol levels by RIA (Albrecht et al. 2000, 2005). Estrogen levels in the maternal saphenous vein reflect placental production from fetal adrenal C19-steroid precursors, while DHAS and cortisol levels in the umbilical artery reflect production by the fetal adrenal cortex (Albrecht & Pepe 1990). The fetuses (females and males) were euthanized with an overdose of sodium pentobarbital, the adrenal glands weighed, and one gland immediately frozen and stored in liquid nitrogen for mRNA analysis and the other gland fixed in 4% paraformaldehyde for immunocytochemistry.

RT-PCR of cyclin and Cdk mRNA

The mRNA levels for the cyclins and their kinases were determined by RT-PCR using methods previously established and completely validated in our laboratory (Albrecht et al. 1999, Niklaus et al. 2003). Total RNA was isolated from whole adrenal gland by 4 M guanidine isothiocyanate homogenization, chloroform-isoamyl alcohol extraction, and cesium chloride centrifugation and quantified by u.v. absorption spectophotometry. Oligonucleotide primers were synthesized by Invitrogen Life Technologies, Inc. and based on human cDNA sequences: cyclin D1 (forward) 5'-3' : TAAGATGAAGGAGACCATCC, (reverse) 5'-3' : GGATTGGAAATGAACTTCAC; cyclin E (forward) 5'-3' : ATACAGACCCACAGAGACAG, (reverse) 5'-3' : TGCCATCCACAGAAATACTT; Cdk2 (forward) 5'-3' : GCTTTCTGCCATTCTCATCG, (reverse) 5'-3' : GTCCC-CAGAGTCCGAAAGAT; Cdk4 (forward) 5'-3' : CTTCC-CATCAGCACAGTTCG, (reverse) 5'-3' : AGTCAGCATT-TCCAGCAGCA; Cdk6 (forward) 5'-3' : CGAATGCGTGG-CGGAGATC, (reverse) 5'-3' : CCACTGAGGTTAGAGCCA-TC; 18S (forward) 5'-3' : TCAAGAACGAAAGTCGGAGG, (reverse) 5'-3' : GGACATCTAAGGGCATCACA.

A constant amount of total RNA (50 ng/4 µ l) was added to an RT mixture for cyclin D1 and cyclin E, and Cdk2, Cdk4, Cdk6, and 18S rRNA. In all the experiments, the presence of possible genomic DNA contamination was evaluated in control reactions by omitting either the RT enzyme or RNA. Five microliters of the RT mixture were added to separate PCR mixtures containing 0.2 mM each of deoxy dATP, dCTP, dGTP, and dTTP, 1.25 U cloned Thermus aquaticus DNA polymerase (Amplitaq; Perkin-Elmer Corp./Cetus, Norwalk, CT, USA) and 10 pmol of the respective paired primers to generate cDNA templates. PCR was performed in a programmable thermal cycler (MJ Research, Inc., Cambridge, MA, USA) for 25 (cyclin D1, Cdk2, and Cdk4), 26 (Cdk6), 27 (cyclin E), and 14 (18S rRNA) cycles respectively, at 94 ° C for 1 min, 55–62 ° C for 1 min, and 72 ° C for 2 min. PCR products were fractionated byelectrophoresis in 2% agarose gel, visualized with ethidium bromide and photographed using 665 positive/negative film. Negatives were scanned using a Gel Doc 1000 imaging system and Multi-Analyst software programs (Bio-Rad Laboratories). The intensity of the amplified products was expressed as the area under each band and the relative units of cyclin D1, cyclin E and Cdk2, Cdk4, and Cdk6 expressed relative to 18S rRNA values.

Immunocytochemistry of cyclin, Cdk, Ki67, P450C17, and 3ß-HSD

The expression of cyclin D1, cyclin E, Cdk2, Cdk4, and Cdk6, P450C17, and 3ß-HSD was determined by immunocytochemistry essentially as described previously by our laboratories (Pepe et al. 1994, Albrecht et al. 1999, Leavitt et al. 1999). Paraffin-embedded adrenal glands were sectioned (6 µ m) and mounted onto glass slides (Fisher Scientific Co., Arlington, VA, USA) and antigen retrieval performed by boiling in 0.01 M Na citrate buffer. Tissues were incubated in H2O2 to inhibit endogenous peroxidase, blocked with Protein Block Serum Free (Dako Corporation, Carpinteria, CA, USA) and incubated 24–48 h (4° C) with primary antibodies: cyclin D1 (1:80 dilution, clone SP4, Lab Vision, Fremont, CA, USA), cyclin E (1:40 dilution, Novocastra, Burlingame, CA, USA), Cdk2 (1:100 dilution, BD Biosciences – Transduction Laboratories, Lexington, KY, USA), Cdk4 (1:40 dilution, c-22: sc-260, Santa Cruz Biotechnology, Santa Cruz, CA, USA), Cdk6 (1:400 dilution, B-10: sc-7961, Santa Cruz Biotechnology), P450C17 (1:2000 dilution, supplied by Dr Michael Waterman, Vanderbilt University School of Medicine, Nashville, TN, USA), and 3ß-HSD (1:5000 dilution, supplied by Dr Ian Mason, Universityof Edinburgh, Edinburgh, UK) diluted in 5% normal goat serum-PBS. Human breast tissue and baboon spleen and lymph node tissues were simultaneously analyzed with baboon fetal adrenal tissue to confirm applicability and specificity of the cyclin and Cdk antibodies for immunocytochemistry in the baboon fetal adrenal. Tissue sections were washed in PBS, incubated with biotinylated anti-mouse or anti-rabbit IgG secondary antibody (Vector Laboratories, Burlingame, CA, USA) and incubated for 1 h with Avidin–Biotin Complex Reagent Kit (ABC Elite, Vector Laboratories). The reaction was colorized using diaminobenzidine–imidazole–H2O2 and sections counterstained with Mayer’s hematoxylin and examined by light microscopy. Negative controls were obtained by omitting primary antibody from the reaction. A minimum of 20 sections per animal and adrenals from four baboons per group were examined for each cyclin and Cdk.

The proportion of cells undergoing mitosis within the different fetal adrenocortical zones was assessed using Ki67 antibody (NCL-Ki67-MM1, Novocastra, Newcastle upon Tyne, UK), which stains nuclei in the G1, S, M, and G2 phases of the cell cycle. The percentage of Ki67 positive cells, i.e. number of immunopositive cells divided by the total number of cells, was determined using a Nikon Eclipse E100/Video-Based Image 1 Analysis System (New York, NY, USA). Counts were performed in at least five randomly selected sections of each adrenal gland (i.e. each baboon) and in approximately 1000 cells within each cortical zone.

Statistical analysis

Data were expressed as the mean ± S.E. and analyzed by ANOVA with post hoc comparison of the means by Student Neuman–Keuls multiple comparison test (Instat, Graphpad Software, San Diego, CA, USA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Serum estradiol, DHAS, and cortisol levels

Serum estradiol concentrations (mean ± S.E.) in the maternal saphenous vein on day 60 of gestation (357 ± 100 pg/ml) increased (P < 0.05) to 1969 ± 368 pg/ml at midgestation and 3573 ± 477 pg/ml late in gestation (Table 1Go). Serum estradiol levels in the umbilical (i.e. fetal) artery were similar in early (103 ± 27) and mid (171 ± 38) gestation, and then increased (P < 0.05) approximately threefold in late gestation (494 ± 136). Cortisol levels (µ g/dl) in the maternal saphenous vein were similar in early (22.6 ± 0.9) and mid (38.4 ± 2.7) gestation, then increased (P < 0.001) late in gestation (68.0 ± 3.7). Cortisol levels in the umbilical artery increased (P < 0.001) from 6.9 ± 1.3 at mid to 38.6 ± 1.8 at late gestation. However, serum DHAS concentrations in the maternal saphenous and umbilical artery did not show a significant change with advancing pregnancy (Table 1Go).


View this table:
[in this window]
[in a new window]

 
Table 1 Serum estradiol, dehydroepiandrosterone-sulfate, and cortisol levels in baboons. Values represent the means ( ± S.E.) of serum estradiol, DHAS, and cortisol levels in maternal saphenous vein and umbilical (i.e. fetal) artery for baboons on days 60 (early), 100 (mid), and 160–170 (late) of gestation
 
Maternal and fetal weights

Fetal body weight increased (P < 0.001) between early (12.3 ± 0.5 g), mid (171.9 ± 3.8 g), and late (859.8 ± 16.9 g) gestation, whereas maternal body weights were not significantly changed at these times of gestation (Table 2Go). Fetal organ weights increased with advancing gestation, with adrenal weights (mg) increasing almost threefold (P < 0.001) between early (50.7 ± 4.1), mid (126.7 ± 5.6), and late (354.5 ± 14.5) gestation.


View this table:
[in this window]
[in a new window]

 
Table 2 Maternal body and fetal body and organ weights in baboons. Values represent the means ( ± S.E.) of maternal body and fetal body and organ weights on days 60 (early), 100 (mid), and 160–170 (late) of gestation
 
RT-PCR of cyclin and Cdk mRNA

Figure 1Go show a representative semiquantitative RT-PCR for cyclin D1 and cyclin E mRNA in the baboon fetal adrenal. Based on results of the linear amplification range, 25 and 27 cycles were run for subsequent quantification of cyclin D1 and cyclin E respectively. Similar validation curves were conducted for Cdk2, Cdk4, and Cdk6. In all the experiments, PCR products were not generated when either RNA or RT enzyme were omitted from the reaction (data not shown).


Figure 1
View larger version (21K):
[in this window]
[in a new window]

 
Figure 1 Representative semiquantitative RT-PCR for cyclin D1 (A) and cyclin E (B) mRNA in the baboon fetal adrenal. Validation experiments were conducted using 50 ng total adrenal mRNA in RT mix and 22–34 cycles. The products were separated on 2% agarose gel and stained with ethidium bromide. Intensities of amplified products were analyzed by densitometry and log of relative units were plotted over number of cycles.

 
Figure 2Go illustrates results of RT-PCR analysis of cyclin D1 and cyclin E mRNAs in the baboon fetal adrenal at early-, mid-, and late gestation. Mean ( ± S.E.) cyclin D1 mRNA levels (arbitrary units corrected for levels of 18S rRNA) were similar at early (0.85 ± 0.09) and mid (1.04 ± 0.08) gestation (Fig. 2AGo), then decreased (P < 0.001) approximately 50% by late gestation (0.57 ± 0.04). Mean ( ± S.E.) cyclin E mRNA levels (Fig. 2BGo) in the fetal adrenal gland alsowere similar at early (2.03 ± 0.07) and mid (1.63 ± 0.31) gestation, then decreased (P < 0.001) approximately 70% by late gestation (0.53 ± 0.09).


Figure 2
View larger version (25K):
[in this window]
[in a new window]

 
Figure 2 Baboon fetal adrenal cyclin D1 (A) and cyclin E (B) mRNA levels (means ± S.E.), relative to 18 S rRNA, on days 60 (early, n = 4), 100 (mid, n = 5) and 160–170 (late, n = 5) of gestation (term is 184 days). RNA was extracted from whole adrenal tissue and mRNA levels determined by RT-PCR. Values with different letter superscripts differ at P < 0.001 (ANOVA and Student Neuman–Keuls multiple comparison test).

 
In contrast to the results for cyclin D1 and cyclin E, fetal adrenal mRNA levels for Cdk4 (Fig. 3AGo) and Cdk6 (Fig. 3BGo), which heterodimerize with cyclin D1, were similar in early (0.90 ± 0.05 and 2.06 ± 0.14 respectively), mid (1.07 ± 0.12 and 1.68 ± 0.16), and late (0.96 ± 0.10 and 1.64 ± 0.19) gestation. Moreover, mRNA levels for Cdk2, which is associated with cyclin E, were similar at early (1.63 ± 0.11), mid (1.32 ± 0.06), and late (1.50 ± 0.15) gestation (Fig. 3CGo).


Figure 3
View larger version (12K):
[in this window]
[in a new window]

 
Figure 3 Baboon fetal adrenal Cdk4(A), Cdk6 (B), and Cdk2 (C) mRNA levels (means ± S.E.), relative to 18S rRNA, determined by RT-PCR on days 60 (early), 100 (mid), and 160–170 (late) of gestation for the same baboons in which cyclin D1 and cyclin E levels are shown in Fig. 2Go.

 
Immunocytochemistry of P450C17 and 3 -HSD

As described by Mesiano et al.(1993), the expression of P450C17 which occurs in the transitional and fetal (but not the definitive) zones (Fig. 4AGo), and 3ß-HSD which occurs in the definitive and transitional (but not the fetal) zones (Fig. 4BGo), permits identification of the three zones of the primate fetal adrenal cortex.


Figure 4
View larger version (84K):
[in this window]
[in a new window]

 
Figure 4 Representative photomicrographs of P450C17 (A) and 3ß-HSD (B) immunocytochemistry in the baboon fetal adrenal on day 160–170 of gestation. Brown precipitate represents immunoreactivity. DZ, definitive zone; TZ, transitional zone; FZ, fetal zone. Magnification: 100 x .

 
Immunocytochemistry of cyclin and Cdk

The immunocytochemical localization of cyclin D1 and cyclin E proteins shown in Fig. 5Go and the Cdk shown in Fig. 6Go are representative of at least four different baboon fetal adrenals analyzed for each peptide. The fetal adrenal in early gestation (day 60) was comprised primarily of well-defined definitive and fetal zone cells, many of the nuclei of which stained for cyclin D1 (Fig. 5AGo) and cyclin E (Fig. 5EGo). However, the level of immunostaining appeared to be greater in the definitive zone than in the fetal zone. At midgestation (day 100), cyclin D1 (Fig. 5BGo), and cyclin E (Fig. 5FGo) expression remained abundant in the definitive zone cells and continued to exceed that in the fetal zone. However, late in gestation and consistent with the results for mRNA levels, there was an apparent decrease in cyclin D1 (Fig. 5CGo) and cyclin E (Fig. 5GGo) protein immunoexpression throughout the fetal adrenal cortex, particularly in the definitive zone.


Figure 5
View larger version (99K):
[in this window]
[in a new window]

 
Figure 5 Representative photomicrographs of cyclin D1 (panels A–D) and cyclin E (panels E–H) immunocytochemistry in the baboon fetal adrenal on days 60 (early, A and E), 100 (mid, B and F), and 160–170 (late, C and G) of gestation. Negative control for cyclin D1 (D) and cyclin E (H) (i.e. performed without primary antibody). Brown precipitate reflects immunoreactivity in nuclei. C, capsule; DZ, definitive zone; TZ, transitional zone; FZ, fetal zone. Magnification: 200 x .

 

Figure 6
View larger version (48K):
[in this window]
[in a new window]

 
Figure 6 Representative photomicrographs of Cdk4 (A), Cdk6 (B), and Cdk2 (C) immunocytochemistry in the baboon fetal adrenal on day 160–170 (i.e. late) of gestation. (D) Negative CdK4 control. DZ, definitive zone; TZ, transitional zone; FZ, fetal zone. Magnification: 200 x .

 
Figure 6Go shows the immunocytochemical expression of Cdk4 (A), Cdk6 (B), and Cdk2 (C) in the baboon fetal adrenal gland for late gestation only because, as with the results for mRNA levels, the pattern and level of staining for each of these proteins appeared similar at early-, mid-, and late gestation. Each of these kinases was abundantly expressed throughout the three zones of the baboon fetal adrenal cortex. Specificity of the cyclin and Cdk antibodies was confirmed by the absence of staining when the primary antibodies to cyclin D1 (Fig. 5DGo), cyclin E (Fig. 5HGo), and Cdk 4 (Fig. 6DGo) were omitted in the reaction.

Immunocytochemistry of Ki67

Figure 7Go shows the immunocytochemical expression of Ki67 (panels A–D) and 3ß-HSD (panels E–H) in representative baboon fetal adrenal glands at early (A and E), mid (B and F), and late (C and G) gestation. Nuclear immunostaining for Ki67 was present throughout the fetal adrenal cortex early in pregnancy, particularly in cells of the definitive zone (Fig. 7AGo). With advancing gestation, however, there was a marked decrease in Ki67 staining, particularly in the definitive zone late in gestation (Fig. 7CGo).


Figure 7
View larger version (105K):
[in this window]
[in a new window]

 
Figure 7 Representative photomicrographs of Ki67 (A–D) and 3ß-HSD (E–H) immunocytochemistry in the baboon fetal adrenal on days 60 (A and E), 100 (B and F), and 160–170 (C and G) of gestation. Negative control for Ki67 (D) and 3ß-HSD (H) (i.e. performed without primary antibody). DZ, definition zone; FZ, fetal zone; TZ, transitional zone. Magnification: 200 x .

 
In contrast, immunocytochemical expression of 3ß-HSD was minimal in the definitive zone in the early gestation (Fig. 7EGo) appeared only in the outer margin of the definitive zone at midgestation (Fig. 7FGo), and became abundant throughout the definitive and transitional zones by late gestation (Fig. 7GGo).

As analyzed by image analysis, with advancing gestation there was a progressive decrease in the number of Ki67 positive cells in the definitive zone of the baboon fetal adrenal (Fig. 8AGo) to a value on day 170 (13.8 ± 1.7) that was threefold lower (P < 0.001) than on day 60 (41.3 ± 4.1) and twofold lower (P < 0.001) than on day 100 (28.2 ± 3.6). Ki67 immunolabeling in the cells of the fetal zone (Fig. 8BGo) exhibited a twofold decrease (P < 0.05) on day 170 (7.0 ± 0.6) when compared with that on day 100 (14.1 ± 1.4).


Figure 8
View larger version (21K):
[in this window]
[in a new window]

 
Figure 8 Percentage of Ki67 positive cells, i.e. number of immunopositive cells divided by the total number of cells, determined within the definitive (A) and fetal (B) zones of the baboon fetal adrenal cortex on days 60 (early), 100 (mid), and 160–170 (late) of gestation. Values indicated with different letter superscripts differ (P < 0.001 in definitive zone and P < 0.05 in fetal zone) from each other (ANOVA and Neuman–Keuls statistic).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This present study shows for the first time that the mRNAs and proteins for cyclin D1 and cyclin E, along with their respective Cdk4, Cdk6, and Cdk2, were expressed in high levels in the baboon fetal adrenal cortex at early and midgestation, particularly in the outer definitive zone where localization of these cell cycle regulators was extensive. Since cyclin D1 and cyclin E, in conjunction with Cdk, form holoenzymes which promote progression of the cell cycle from the G1 phase to the S phase (Pestell et al. 1999, Sherr & Roberts 1999), where DNA replication occurs, the high expression of cyclin D1 and cyclin E and their Cdks in the baboon fetal adrenal cortex presumably would promote cell replication during the first half of gestation. Consistent with this possibility, the present study also shows that almost half of the cells of the definitive zone in the early baboon gestation expressed Ki67, an index of cellular mitosis. Although cell cycle regulatory components were not assessed, mitotic activity has also been observed to be extensive in the definitive zone of the human fetal adrenal in early gestation (Johannisson 1968, Jirasek 1980, Spencer et al. 1999). Collectively, the elevated expression of cyclin D1 and cyclin E and mitotic activity in the human and nonhuman primate fetal adrenal indicate that growth of the cortex occurs primarily by hyperplasia during the first half of gestation.

Most importantly, the present study further shows that cyclin D1 and cyclin E mRNA and protein levels, as well as the proportion of Ki67-positive cells, decreased markedly in the baboon fetal adrenal cortex, especially within the definitive zone, between mid- and late gestation. The decline was specific for the cyclin components of the cell regulatory system, since Cdk mRNA and protein levels remained constant within the baboon fetal adrenal cortical zones with advancing pregnancy. The reduction in cyclin D1 and cyclin E and Ki67 suggests that cell proliferation within the fetal adrenal definitive zone declines during the second half of primate pregnancy. Presumably, this reduction in cell proliferation of the definitive zone would also impact growth of the fetal zone, which is thought to be formed via centripetal migration from cells originating in the definitive zone (Keene & Hewer 1927, Crowder 1957, Muench et al. 2003, Coulter 2004). Consistent with the observations in baboons of the present study, the percentage of cells labeled with proliferating cell nuclear antigen in both the definitive and the fetal zones were lower in preterm human infants than in fetuses at midgestation (Spencer et al. 1999), although the latter results were confounded by glucocorticoid treatment of preterm infants. However, the decline in cell proliferation within the definitive and fetal zones with advancing gestation was not associated with a reduction in growth, because the volume of these zones within the baboon (Albrecht et al. 2005) and human (Bocian-Sobkowska et al. 1993, Mesiano & Jaffe 1997) fetal adrenal cortex exhibits a progressive increase during the second half of gestation. Therefore, other cellular mechanisms, presumably hypertrophy (Mesiano & Jaffe 1992), may become proportionally more important with advancing gestation to account for the continued growth/volume of the fetal adrenal cortex, especially the fetal zone where the cells are much larger in size than those comprising the definitive zone. Although apoptosis also potentially impacts tissue growth, apoptosis was not exhibited in the definitive zone and increased in the fetal zone of the human fetal adrenal between midgestation and birth (Spencer et al. 1999) and was not observed in the baboon fetal adrenal (Albrecht et al. 1996).

The physiological impact of the decrease in cell proliferation of the fetal adrenal cortex in the second half of primate pregnancy remains to be determined. However, the present study also showed that coinciding with the decline in cell proliferative capacity, there was an increase in expression of the functionally important steroidogenic enzyme 3ß-HSD within the fetal adrenal definitive and transitional zones with advancing baboon pregnancy. Therefore, we propose that the decline in cellular proliferation would permit these cells to undergo functional differentiation, whereby the definitive and transitional zones would achieve the capacity to form mineralocorticoids and glucocorticoids respectively, and the fetal zone would secrete C19-steroid precursors for the production of placental estrogen. The increase in serum levels of estradiol and cortisol, both of which depend upon a functionally competent fetal adrenal, in the baboon mother and fetus shown between mid-and late gestation is consistent with this concept.

The factor(s) involved in regulating the decrease in cyclin expression and cell proliferation in the fetal adrenal cortex with advancing baboon gestation are not known. However, advancing primate pregnancy is associated with an increase in estrogen and estrogen decreases cyclin and Cdk expression and cell proliferation in the placental trophoblast (Rama et al. 2004). Our recent studies showing expression of estrogen receptor {alpha} and ß in the baboon fetal adrenal cortex (Albrecht et al. 1999), and a twofold increase in fetal cortical zone volume after suppressing estrogen during the second half of baboon pregnancy (Albrecht et al. 2005), are consistent with the concept that the decrease in cyclin expression and cell proliferation, particularly within the definitive zone precursor cells, involves estrogen. However, additional studies are required to definitively assess the role of estrogen on fetal adrenal cyclin expression and growth.

However, in addition to estrogen, several studies in humans (Jaffe et al. 1981, Di Blasio et al. 1990), rhesus monkeys (Challis et al. 1974, Walsh et al. 1979), and baboons (Pepe & Albrecht 1990, Aberdeen et al. 1998) show that ACTH has a pivotal role in functional maturation and development of the fetal adrenal cortex. Thus, there is marked atrophy of the fetal adrenal gland when pituitary ACTH release is suppressed by administration of synthetic corticosteroids in the human (Mesiano & Jaffe 1992), baboon (Leavitt et al. 1997, Aberdeen et al. 1998), and rhesus monkey (Challis et al. 1974). Depending upon the experimental conditions employed in culture studies, however, ACTH had either inhibitory (Ramachandran & Suyama 1975, Hornsby & Gill 1977, Simonian & Gill 1981), stimulatory (Kahri & Halinen 1974, Roos 1974), or limited (Di Blasio et al. 1990) effects on the proliferation of human fetal adrenocortical cells, and caused hypertrophy of the primate fetal adrenal cortex (Coulter et al. 1996). Other peptides of placental or fetal origin, e.g. epidermal growth factor and fibroblast growth factor, also appear to have a role in growth of the primate fetal adrenal (Crickard et al. 1981, Jaffe et al. 1981, Simonian & Gill 1981, Pepe & Albrecht 1990, Aberdeen et al. 1999). Therefore, it is apparent that regulation of fetal adrenocortical growth and maturation is a complex process involving fetal pituitary peptides, placental estrogen, and fetal growth factors, which act/interact to regulate mitosis and hypertrophy.

In summary, the present study shows that expression of the cell cycle regulators cyclin D1 and cyclin E and the cell proliferation marker Ki67 decreased, while expression of the steroidogenic enzyme 3ß-HSD increased, in the fetal adrenal cortex, particularly in the definitive zone, between mid- and late baboon gestation. We propose that a developmental decline in cellular proliferation would permit functional differentiation of fetal adrenal cortical cells, leading to increased production of steroid hormones important for placental estrogen synthesis and maturation of organ systems within the developing fetus.


    Acknowledgements
 
The authors greatly appreciated the technical assistance of Ms Donna Suresch with the immunocytochemistry and the secretarial assistance of Mrs Wanda James with the manuscript.


   Funding

This study was supported by National Institutes of Health Research Grant RO1 HD 13294. There is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Aberdeen GW, Leavitt MG, Pepe GJ & Albrecht ED 1998 Effect of maternal betamethasone administration at midgestation on baboon fetal adrenal gland development and adrenocorticotropin receptor messenger ribonucleic acid expression. Journal of Clinical Endocrinology and Metabolism 83 976–982.[Abstract/Free Full Text]

Aberdeen GW, Pepe GJ & Albrecht ED 1999 Developmental expression of and effect of betamethasone on the messenger ribonucleic acid levels for peptide growth factors in the baboon fetal adrenal gland. Journal of Endocrinology 163 123–130.[Abstract]

Albrecht ED & Pepe CJ 1990 Placental steroid hormone biosynthesis in primate preganancy. Endocrine Reviews 11 124–150.[Abstract/Free Full Text]

Albrecht ED, Aberdeen GW, Babischkin JS, Tilly JL & Pepe GJ 1996 Biphasic developmental expression of adrenocorticotropin receptor messenger ribonucleic acid levels in the baboon fetal adrenal gland. Endocrinology 137 1292–1298.[Abstract]

Albrecht ED, Babischkin JS, Davies WA, Leavitt MG & Pepe GJ 1999 Identification and developmental expression of the estrogen receptors {alpha} and ß in the baboon fetal adrenal gland. Endocrinology 140 5953–5961.[Abstract/Free Full Text]

Albrecht ED, Aberdeen GW & Pepe GJ 2000 The role of estrogen in the maintenance of primate pregnancy. American Journal of Obstetrics and Gynecology 182 432–438.[CrossRef][Web of Science][Medline]

Albrecht ED, Aberdeen GW & Pepe GJ 2005 Estrogen elicits cortical zone-specific effects on development of the primate fetal adrenal gland. Endocrinology 146 1737–1744.[Abstract/Free Full Text]

Bocian-Sobkowska J, Malendowicz LK & Wozniak T 1993 Cytological aspects of the human adrenal cortex development in the course of intra-uterine life. Histology and Histopathology 8 725–730.[Web of Science][Medline]

Challis JRG, Davies IJ, Benirshke K, Hendrickx AG & Ryan K 1974 The effects of dexamethasone on plasma steroid levels and fetal adrenal histology in the pregnant rhesus monkey. Endocrinology 103 1300–1305.

Coulter CL 2004 Functional biology of the primate fetal adrenal gland: advances in technology provide new insight. Clinical and Experimental Pharmacology and Physiology 31 475–484.[CrossRef][Web of Science][Medline]

Coulter CL, Goldsmith PC, Mesiano S, Voytek CC, Martin MC, Han VKM & Jaffe RB 1996 Functional maturation of the primate fetal adrenal in vivo: role of insulin-like growth factors. IGF-I receptor and IGF binding proteins in growth regulation. Endocrinology 137 4487–4498.[Abstract]

Crickard K, Ill CR & Jaffe RB 1981 Control of proliferation of human fetal adrenal cells in vitro. Journal of Clinical Endocrinology and Metabolism 53 790–796.[Abstract/Free Full Text]

Crowder RE 1957 The development of the adrenal gland in man, with special reference to origin and ultimate location of cell types and evidence in favor of the ‘cell migration’ theory. Contemporary Embryology 251 195–209.

Di Blasio AM, Fujii DK, Yamamoto M, Martin MC & Jaffe RB 1990 Maintenance of cell proliferation and steroidogenesis in cultured human fetal adrenal cells chronically exposed to adrenocorticotropic hormone: rationalization of in vitro and in vivo findings. Biology of Reproduction 42 683–691.[Abstract]

Hornsby PJ & Gill GN 1977 Hormonal control of adrenocortical cell proliferation. Desensitization to ACTH and interaction between ACTH and fibroblast growth factor in bovine adrenocortical cell cultures. Journal of Clinical Investigation 60 342–352.[Web of Science][Medline]

Jaffe RB, Seron-Ferre M, Crickard K, Koritnik D, Mitchell BF & Huhtaniemi IT 1981 Regulation and function of the primate fetal adrenal gland and gonad. Recent Progress in Hormone Research 37 41–103.[Medline]

Jirasek J 1980 Human Fetal Endocrines. pp 69–82 London: Martinus Nijhoff.

Johannisson E 1968 The foetal adrenal cortex in the human. Its ultrastructure at different stages of development and in different functional states. Acta Endocrinologica 130 (Suppl) 1–107.

Kahri AI & Halinen H 1974 Studies on the cortical cells of human fetal adrenals in tissue culture. Acta Anatomica 88 541–555.[Web of Science][Medline]

Keene MFL & Hewer EE 1927 Observations on the development of the human suprarenal gland. Journal of Anatomy 61 302–324.[Web of Science][Medline]

Leavitt MG, Aberdeen GW, Burch MG, Albrecht ED & Pepe GJ 1997 Inhibition of fetal adrenal adrenocorticotropin receptor messenger ribonucleic acid expression by betamethasone administration to the baboon fetus in late gestation. Endocrinology 138 2705–2712.[Abstract/Free Full Text]

Leavitt MG, Albrecht ED & Pepe GJ 1999 Development of the baboon fetal adrenal gland: regulation of the ontogenesis of the definitive and transitional zones by adrenocorticotropin. Journal of Clinical Endocrinology and Metabolism 84 3831–3835.[Abstract/Free Full Text]

Mesiano S & Jaffe RB 1992 Regulation of growth and differentiated function in the human fetal adrenal. In Cellular and Molecular Biology of the Adrenal Cortex, pp 235–245. Eds JM Saez, AC Brownie, A Capponi, EM Chambaz & F Mantero. Paris: INSERM/Libbey Eurotext.

Mesiano S & Jaffe RB 1997 Developmental and functional biology of the primate fetal adrenal cortex. Endocrine Reviews 18 378–403.[Abstract/Free Full Text]

Mesiano S, Coulter CL & Jaffe RB 1993 Localization of cytochrome P-450 cholesterol side-chain cleavage, cytochrome P-450 17{alpha}-hydroxyl-ase/17,20-lyase, and 3ß-hydroxy steroid dehydrogenase isomerase steroidogenic enzymes in human and rhesus monkey fetal adrenal glands: reappraisal of functional zonation. Journal of Clinical Endocrinology and Metabolism 77 1184–1189.[Abstract]

Muench MO, Ratclihhe JV, Nakanishi M, Ishimoto H & Jaffe RB 2003 Isolation of definitive zone and chromaffin cells based upon expression of CD56 (neural cell adhesion molecule) in the human fetal adrenal gland. Journal of Clinical Endocrinology and Metabolism 88 3921–3930.[Abstract/Free Full Text]

Niklaus AL, Aberdeen GW, Babischkin JS, Pepe GJ & Albrecht ED 2003 Effect of estrogen on vascular endothelial growth/permeability factor expression by glandular epithelial and stromal cells in the baboon endometrium. Biology of Reproduction 68 1997–2004.[Abstract/Free Full Text]

Pepe GJ & Albrecht ED 1990 Regulation of the primate fetal adrenal cortex. Endocrine Reviews 11 151–176.[Abstract/Free Full Text]

Pepe GJ & Albrecht ED 1995 Actions of placental and fetal adrenal steroid hormones in primate pregnancy. Endocrine Reviews 16 608–648.[Abstract/Free Full Text]

Pepe GJ, Davies WA & Albrecht ED 1994 Activation of the baboon fetal pituitary–adrenocortical axis at midgestation by estrogen: enhancement of fetal pituitary proopiomelanocortin messenger ribonucleic acid expression. Endocrinology 134 2581–2587.[Abstract/Free Full Text]

Pestell RG, Albanese C, Reutens A, Segall JE, Lee RJ & Arnold A 1999 The cyclins and cyclin-dependent kinase inhibitors in hormonal regulation of proliferation and differentiation. Endocrine Reviews 20 501–534.[Abstract/Free Full Text]

Rama S, Petrusz P & Rao AJ 2004 Hormonal regulation of human trophoblast differentiation: a possible role for 17ß-estradiol and GnRH. Molecular and Cellular Endocrinology 218 79–94.[CrossRef][Web of Science][Medline]

Ramachandran J & Suyama T 1975 Inhibition of replication of normal adrenocortical cells in culture by adrenocorticotrophin. PNAS 72 113–118.[Abstract/Free Full Text]

Roos BA 1974 Effect of ACTH and cAMP on human adrenocortical growth and function in vitro. Endocrinology 94 685–690.[Abstract/Free Full Text]

Sherr CJ & Roberts JM 1999 CDK inhibitors: positive and negative regulators of G1-phase progression. Genes and Development 13 1501–1512.[Free Full Text]

Simonian MH & Gill GN 1981 Regulation of the fetal adrenal cortex: effect of adrenocorticotropin on growth and function of monolayer cultures of fetal and definitive zone cells. Endocrinology 108 1769–1779.[Abstract/Free Full Text]

Spencer SJ, Mesiano S, Lee JY & Jaffe RB 1999 Proliferation and apoptosis in the human adrenal cortex during the fetal and perinatal periods: implications for growth and remodeling. Journal of Clinical Endocrinology and Metabolism 84 1110–1115.[Abstract/Free Full Text]

Walsh SW, Norman RL & Novy MJ 1979 In utero regulation of rhesus monkey fetal adrenals: effects of dexamethasone, adrenocorticotropin, thyrotropin releasing hormone, prolactin, human chorionic gonadotropin and {alpha}-melanocyte stimulating hormone on fetal and maternal plasma steroids. Endocrinology 104 1805–1813.[Abstract/Free Full Text]

Received in final form 3 October 2006
Accepted 9 October 2006
Made available online as an Accepted Preprint 17 October 2006





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dumitrescu, A.
Right arrow Articles by Albrecht, E. D
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dumitrescu, A.
Right arrow Articles by Albrecht, E. D


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS