|
|
||||||||
Department of Obstetrics, Gynecology and Reproductive Sciences and Department of Physiology, Center for Studies in Reproduction, University of Maryland School of Medicine, Baltimore, Maryland 21201, USA
1 Department of Physiological Sciences, Eastern Virginia Medical School, Norfolk, Virginia 23507, USA
(Requests for offprints should be addressed to E D Albrecht who is now at Department of Obstetrics, Gynecology and Reproductive Sciences, University of Maryland School of Medicine, Bressler Research Laboratories 11-019, 655 West Baltimore Street, Baltimore, Maryland 21201, USA; Email: ealbrech{at}umaryland.edu)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
-hydroxylase, 1720 lyase (P450C17) enzyme catalyzing synthesis of the C19-steroids, e.g. dehydroepian-drosterone (DHA) and DHA-sulfate (DHAS), utilized as precursors for estrogen synthesis by the placenta (Pepe & Albrecht 1990, Mesiano & Jaffe 1997). The definitive zone, the site of the Delta; 5-3ß-hydroxysteroid dehydrogenase (3ß-HSD) and aldosterone synthase enzymes, appears at early to mid gestation. However, the transitional zone, which expresses both the 3ß-HSD and P450C17 enzymes (Mesiano et al. 1993) that catalyze the production of cortisol for fetal organ maturation, does not develop and undergo growth until late in gestation. The factors that underpin this very striking pattern of fetal adrenocortical growth and development, however, are not clearly understood. Proliferating mammalian cells pass through an orderly sequence of phases that comprise the cell cycle to promote tissue growth (Pestell et al. 1999, for review). Progression through G1 to S phase is promoted by cyclin D1 and cyclin E, which heterodimerize with catalytic subunits, the cyclin-dependent kinases (Cdks), to form active holoenzymes. Cyclin D1 when associated with Cdk4 and Cdk6, and cyclin E when associated with Cdk2, phosphorylate substrates essential for progression through the restriction point of the cell cycle. We propose that the unique pattern of growth and development of the primate fetal adrenal cortex is regulated by expression of the cyclins and their Cdks in a cortical zone and gestational age-specific manner. However, despite the importance of the cell cycle regulators for cell proliferation and growth, studies of the developmental expression of the cyclins and Cdks in the human fetal adrenal cortex have not been conducted.
Our laboratories have used the baboon as a nonhuman primate model to study the regulation of fetal and placental development (Albrecht & Pepe 1990; Pepe & Albrecht 1995). Therefore, in the present study, we used the baboon and a developmental approach to determine the expression of components of the cyclin system, and the number of cells expressing Ki67 as an index of cell proliferation, in the baboon fetal adrenal cortex at early-, mid-, and late gestation.
| Materials and Methods |
|---|
|
|
|---|
Female baboons (Papio anubis) weighing 1216 kg were housed individually in stainless steel cages in air-conditioned rooms under a 12 h light:12 h darkness cycle. The baboons received standard primate chow and fresh fruit twice daily, vitamins daily and water ad libitum. Females were paired with male baboons for a period of 5 days during the ovulatory phase of the menstrual cycle and pregnancy was determined by palpation and ultrasonography. Animals were cared for and used strictly in accordance with the United States Department of Agriculture (USDA) regulations and the National Research Council Guide for the Care and Use of Laboratory Animals. The experimental protocol employed in this study was approved by the Institutional Animal Care and Use Committees of the University of Maryland School of Medicine and Eastern Virginia Medical School.
On days 60 (n = 4), 100 (n = 5), and 160170 (n = 5) of gestation (term = 184 days), baboons underwent cesarean section under halothane anesthesia. Blood samples (1 ml) were obtained from a maternal saphenous vein and umbilical (i.e. fetal) artery at the time of cesarean section for analysis of serum estradiol, DHAS, and cortisol levels by RIA (Albrecht et al. 2000, 2005). Estrogen levels in the maternal saphenous vein reflect placental production from fetal adrenal C19-steroid precursors, while DHAS and cortisol levels in the umbilical artery reflect production by the fetal adrenal cortex (Albrecht & Pepe 1990). The fetuses (females and males) were euthanized with an overdose of sodium pentobarbital, the adrenal glands weighed, and one gland immediately frozen and stored in liquid nitrogen for mRNA analysis and the other gland fixed in 4% paraformaldehyde for immunocytochemistry.
RT-PCR of cyclin and Cdk mRNA
The mRNA levels for the cyclins and their kinases were determined by RT-PCR using methods previously established and completely validated in our laboratory (Albrecht et al. 1999, Niklaus et al. 2003). Total RNA was isolated from whole adrenal gland by 4 M guanidine isothiocyanate homogenization, chloroform-isoamyl alcohol extraction, and cesium chloride centrifugation and quantified by u.v. absorption spectophotometry. Oligonucleotide primers were synthesized by Invitrogen Life Technologies, Inc. and based on human cDNA sequences: cyclin D1 (forward) 5'-3' : TAAGATGAAGGAGACCATCC, (reverse) 5'-3' : GGATTGGAAATGAACTTCAC; cyclin E (forward) 5'-3' : ATACAGACCCACAGAGACAG, (reverse) 5'-3' : TGCCATCCACAGAAATACTT; Cdk2 (forward) 5'-3' : GCTTTCTGCCATTCTCATCG, (reverse) 5'-3' : GTCCC-CAGAGTCCGAAAGAT; Cdk4 (forward) 5'-3' : CTTCC-CATCAGCACAGTTCG, (reverse) 5'-3' : AGTCAGCATT-TCCAGCAGCA; Cdk6 (forward) 5'-3' : CGAATGCGTGG-CGGAGATC, (reverse) 5'-3' : CCACTGAGGTTAGAGCCA-TC; 18S (forward) 5'-3' : TCAAGAACGAAAGTCGGAGG, (reverse) 5'-3' : GGACATCTAAGGGCATCACA.
A constant amount of total RNA (50 ng/4 µ l) was added to an RT mixture for cyclin D1 and cyclin E, and Cdk2, Cdk4, Cdk6, and 18S rRNA. In all the experiments, the presence of possible genomic DNA contamination was evaluated in control reactions by omitting either the RT enzyme or RNA. Five microliters of the RT mixture were added to separate PCR mixtures containing 0.2 mM each of deoxy dATP, dCTP, dGTP, and dTTP, 1.25 U cloned Thermus aquaticus DNA polymerase (Amplitaq; Perkin-Elmer Corp./Cetus, Norwalk, CT, USA) and 10 pmol of the respective paired primers to generate cDNA templates. PCR was performed in a programmable thermal cycler (MJ Research, Inc., Cambridge, MA, USA) for 25 (cyclin D1, Cdk2, and Cdk4), 26 (Cdk6), 27 (cyclin E), and 14 (18S rRNA) cycles respectively, at 94 ° C for 1 min, 5562 ° C for 1 min, and 72 ° C for 2 min. PCR products were fractionated byelectrophoresis in 2% agarose gel, visualized with ethidium bromide and photographed using 665 positive/negative film. Negatives were scanned using a Gel Doc 1000 imaging system and Multi-Analyst software programs (Bio-Rad Laboratories). The intensity of the amplified products was expressed as the area under each band and the relative units of cyclin D1, cyclin E and Cdk2, Cdk4, and Cdk6 expressed relative to 18S rRNA values.
Immunocytochemistry of cyclin, Cdk, Ki67, P450C17, and 3ß-HSD
The expression of cyclin D1, cyclin E, Cdk2, Cdk4, and Cdk6, P450C17, and 3ß-HSD was determined by immunocytochemistry essentially as described previously by our laboratories (Pepe et al. 1994, Albrecht et al. 1999, Leavitt et al. 1999). Paraffin-embedded adrenal glands were sectioned (6 µ m) and mounted onto glass slides (Fisher Scientific Co., Arlington, VA, USA) and antigen retrieval performed by boiling in 0.01 M Na citrate buffer. Tissues were incubated in H2O2 to inhibit endogenous peroxidase, blocked with Protein Block Serum Free (Dako Corporation, Carpinteria, CA, USA) and incubated 2448 h (4° C) with primary antibodies: cyclin D1 (1:80 dilution, clone SP4, Lab Vision, Fremont, CA, USA), cyclin E (1:40 dilution, Novocastra, Burlingame, CA, USA), Cdk2 (1:100 dilution, BD Biosciences Transduction Laboratories, Lexington, KY, USA), Cdk4 (1:40 dilution, c-22: sc-260, Santa Cruz Biotechnology, Santa Cruz, CA, USA), Cdk6 (1:400 dilution, B-10: sc-7961, Santa Cruz Biotechnology), P450C17 (1:2000 dilution, supplied by Dr Michael Waterman, Vanderbilt University School of Medicine, Nashville, TN, USA), and 3ß-HSD (1:5000 dilution, supplied by Dr Ian Mason, Universityof Edinburgh, Edinburgh, UK) diluted in 5% normal goat serum-PBS. Human breast tissue and baboon spleen and lymph node tissues were simultaneously analyzed with baboon fetal adrenal tissue to confirm applicability and specificity of the cyclin and Cdk antibodies for immunocytochemistry in the baboon fetal adrenal. Tissue sections were washed in PBS, incubated with biotinylated anti-mouse or anti-rabbit IgG secondary antibody (Vector Laboratories, Burlingame, CA, USA) and incubated for 1 h with AvidinBiotin Complex Reagent Kit (ABC Elite, Vector Laboratories). The reaction was colorized using diaminobenzidineimidazoleH2O2 and sections counterstained with Mayers hematoxylin and examined by light microscopy. Negative controls were obtained by omitting primary antibody from the reaction. A minimum of 20 sections per animal and adrenals from four baboons per group were examined for each cyclin and Cdk.
The proportion of cells undergoing mitosis within the different fetal adrenocortical zones was assessed using Ki67 antibody (NCL-Ki67-MM1, Novocastra, Newcastle upon Tyne, UK), which stains nuclei in the G1, S, M, and G2 phases of the cell cycle. The percentage of Ki67 positive cells, i.e. number of immunopositive cells divided by the total number of cells, was determined using a Nikon Eclipse E100/Video-Based Image 1 Analysis System (New York, NY, USA). Counts were performed in at least five randomly selected sections of each adrenal gland (i.e. each baboon) and in approximately 1000 cells within each cortical zone.
Statistical analysis
Data were expressed as the mean ± S.E. and analyzed by ANOVA with post hoc comparison of the means by Student NeumanKeuls multiple comparison test (Instat, Graphpad Software, San Diego, CA, USA).
| Results |
|---|
|
|
|---|
Serum estradiol concentrations (mean ± S.E.) in the maternal saphenous vein on day 60 of gestation (357 ± 100 pg/ml) increased (P < 0.05) to 1969 ± 368 pg/ml at midgestation and 3573 ± 477 pg/ml late in gestation (Table 1
). Serum estradiol levels in the umbilical (i.e. fetal) artery were similar in early (103 ± 27) and mid (171 ± 38) gestation, and then increased (P < 0.05) approximately threefold in late gestation (494 ± 136). Cortisol levels (µ g/dl) in the maternal saphenous vein were similar in early (22.6 ± 0.9) and mid (38.4 ± 2.7) gestation, then increased (P < 0.001) late in gestation (68.0 ± 3.7). Cortisol levels in the umbilical artery increased (P < 0.001) from 6.9 ± 1.3 at mid to 38.6 ± 1.8 at late gestation. However, serum DHAS concentrations in the maternal saphenous and umbilical artery did not show a significant change with advancing pregnancy (Table 1
).
|
Fetal body weight increased (P < 0.001) between early (12.3 ± 0.5 g), mid (171.9 ± 3.8 g), and late (859.8 ± 16.9 g) gestation, whereas maternal body weights were not significantly changed at these times of gestation (Table 2
). Fetal organ weights increased with advancing gestation, with adrenal weights (mg) increasing almost threefold (P < 0.001) between early (50.7 ± 4.1), mid (126.7 ± 5.6), and late (354.5 ± 14.5) gestation.
|
Figure 1
show a representative semiquantitative RT-PCR for cyclin D1 and cyclin E mRNA in the baboon fetal adrenal. Based on results of the linear amplification range, 25 and 27 cycles were run for subsequent quantification of cyclin D1 and cyclin E respectively. Similar validation curves were conducted for Cdk2, Cdk4, and Cdk6. In all the experiments, PCR products were not generated when either RNA or RT enzyme were omitted from the reaction (data not shown).
|
|
|
As described by Mesiano et al.(1993), the expression of P450C17 which occurs in the transitional and fetal (but not the definitive) zones (Fig. 4A
), and 3ß-HSD which occurs in the definitive and transitional (but not the fetal) zones (Fig. 4B
), permits identification of the three zones of the primate fetal adrenal cortex.
|
The immunocytochemical localization of cyclin D1 and cyclin E proteins shown in Fig. 5
and the Cdk shown in Fig. 6
are representative of at least four different baboon fetal adrenals analyzed for each peptide. The fetal adrenal in early gestation (day 60) was comprised primarily of well-defined definitive and fetal zone cells, many of the nuclei of which stained for cyclin D1 (Fig. 5A
) and cyclin E (Fig. 5E
). However, the level of immunostaining appeared to be greater in the definitive zone than in the fetal zone. At midgestation (day 100), cyclin D1 (Fig. 5B
), and cyclin E (Fig. 5F
) expression remained abundant in the definitive zone cells and continued to exceed that in the fetal zone. However, late in gestation and consistent with the results for mRNA levels, there was an apparent decrease in cyclin D1 (Fig. 5C
) and cyclin E (Fig. 5G
) protein immunoexpression throughout the fetal adrenal cortex, particularly in the definitive zone.
|
|
Immunocytochemistry of Ki67
Figure 7
shows the immunocytochemical expression of Ki67 (panels AD) and 3ß-HSD (panels EH) in representative baboon fetal adrenal glands at early (A and E), mid (B and F), and late (C and G) gestation. Nuclear immunostaining for Ki67 was present throughout the fetal adrenal cortex early in pregnancy, particularly in cells of the definitive zone (Fig. 7A
). With advancing gestation, however, there was a marked decrease in Ki67 staining, particularly in the definitive zone late in gestation (Fig. 7C
).
|
As analyzed by image analysis, with advancing gestation there was a progressive decrease in the number of Ki67 positive cells in the definitive zone of the baboon fetal adrenal (Fig. 8A
) to a value on day 170 (13.8 ± 1.7) that was threefold lower (P < 0.001) than on day 60 (41.3 ± 4.1) and twofold lower (P < 0.001) than on day 100 (28.2 ± 3.6). Ki67 immunolabeling in the cells of the fetal zone (Fig. 8B
) exhibited a twofold decrease (P < 0.05) on day 170 (7.0 ± 0.6) when compared with that on day 100 (14.1 ± 1.4).
|
| Discussion |
|---|
|
|
|---|
Most importantly, the present study further shows that cyclin D1 and cyclin E mRNA and protein levels, as well as the proportion of Ki67-positive cells, decreased markedly in the baboon fetal adrenal cortex, especially within the definitive zone, between mid- and late gestation. The decline was specific for the cyclin components of the cell regulatory system, since Cdk mRNA and protein levels remained constant within the baboon fetal adrenal cortical zones with advancing pregnancy. The reduction in cyclin D1 and cyclin E and Ki67 suggests that cell proliferation within the fetal adrenal definitive zone declines during the second half of primate pregnancy. Presumably, this reduction in cell proliferation of the definitive zone would also impact growth of the fetal zone, which is thought to be formed via centripetal migration from cells originating in the definitive zone (Keene & Hewer 1927, Crowder 1957, Muench et al. 2003, Coulter 2004). Consistent with the observations in baboons of the present study, the percentage of cells labeled with proliferating cell nuclear antigen in both the definitive and the fetal zones were lower in preterm human infants than in fetuses at midgestation (Spencer et al. 1999), although the latter results were confounded by glucocorticoid treatment of preterm infants. However, the decline in cell proliferation within the definitive and fetal zones with advancing gestation was not associated with a reduction in growth, because the volume of these zones within the baboon (Albrecht et al. 2005) and human (Bocian-Sobkowska et al. 1993, Mesiano & Jaffe 1997) fetal adrenal cortex exhibits a progressive increase during the second half of gestation. Therefore, other cellular mechanisms, presumably hypertrophy (Mesiano & Jaffe 1992), may become proportionally more important with advancing gestation to account for the continued growth/volume of the fetal adrenal cortex, especially the fetal zone where the cells are much larger in size than those comprising the definitive zone. Although apoptosis also potentially impacts tissue growth, apoptosis was not exhibited in the definitive zone and increased in the fetal zone of the human fetal adrenal between midgestation and birth (Spencer et al. 1999) and was not observed in the baboon fetal adrenal (Albrecht et al. 1996).
The physiological impact of the decrease in cell proliferation of the fetal adrenal cortex in the second half of primate pregnancy remains to be determined. However, the present study also showed that coinciding with the decline in cell proliferative capacity, there was an increase in expression of the functionally important steroidogenic enzyme 3ß-HSD within the fetal adrenal definitive and transitional zones with advancing baboon pregnancy. Therefore, we propose that the decline in cellular proliferation would permit these cells to undergo functional differentiation, whereby the definitive and transitional zones would achieve the capacity to form mineralocorticoids and glucocorticoids respectively, and the fetal zone would secrete C19-steroid precursors for the production of placental estrogen. The increase in serum levels of estradiol and cortisol, both of which depend upon a functionally competent fetal adrenal, in the baboon mother and fetus shown between mid-and late gestation is consistent with this concept.
The factor(s) involved in regulating the decrease in cyclin expression and cell proliferation in the fetal adrenal cortex with advancing baboon gestation are not known. However, advancing primate pregnancy is associated with an increase in estrogen and estrogen decreases cyclin and Cdk expression and cell proliferation in the placental trophoblast (Rama et al. 2004). Our recent studies showing expression of estrogen receptor
and ß in the baboon fetal adrenal cortex (Albrecht et al. 1999), and a twofold increase in fetal cortical zone volume after suppressing estrogen during the second half of baboon pregnancy (Albrecht et al. 2005), are consistent with the concept that the decrease in cyclin expression and cell proliferation, particularly within the definitive zone precursor cells, involves estrogen. However, additional studies are required to definitively assess the role of estrogen on fetal adrenal cyclin expression and growth.
However, in addition to estrogen, several studies in humans (Jaffe et al. 1981, Di Blasio et al. 1990), rhesus monkeys (Challis et al. 1974, Walsh et al. 1979), and baboons (Pepe & Albrecht 1990, Aberdeen et al. 1998) show that ACTH has a pivotal role in functional maturation and development of the fetal adrenal cortex. Thus, there is marked atrophy of the fetal adrenal gland when pituitary ACTH release is suppressed by administration of synthetic corticosteroids in the human (Mesiano & Jaffe 1992), baboon (Leavitt et al. 1997, Aberdeen et al. 1998), and rhesus monkey (Challis et al. 1974). Depending upon the experimental conditions employed in culture studies, however, ACTH had either inhibitory (Ramachandran & Suyama 1975, Hornsby & Gill 1977, Simonian & Gill 1981), stimulatory (Kahri & Halinen 1974, Roos 1974), or limited (Di Blasio et al. 1990) effects on the proliferation of human fetal adrenocortical cells, and caused hypertrophy of the primate fetal adrenal cortex (Coulter et al. 1996). Other peptides of placental or fetal origin, e.g. epidermal growth factor and fibroblast growth factor, also appear to have a role in growth of the primate fetal adrenal (Crickard et al. 1981, Jaffe et al. 1981, Simonian & Gill 1981, Pepe & Albrecht 1990, Aberdeen et al. 1999). Therefore, it is apparent that regulation of fetal adrenocortical growth and maturation is a complex process involving fetal pituitary peptides, placental estrogen, and fetal growth factors, which act/interact to regulate mitosis and hypertrophy.
In summary, the present study shows that expression of the cell cycle regulators cyclin D1 and cyclin E and the cell proliferation marker Ki67 decreased, while expression of the steroidogenic enzyme 3ß-HSD increased, in the fetal adrenal cortex, particularly in the definitive zone, between mid- and late baboon gestation. We propose that a developmental decline in cellular proliferation would permit functional differentiation of fetal adrenal cortical cells, leading to increased production of steroid hormones important for placental estrogen synthesis and maturation of organ systems within the developing fetus.
| Acknowledgements |
|---|
| Funding |
|---|
| References |
|---|
|
|
|---|
Aberdeen GW, Pepe GJ & Albrecht ED 1999 Developmental expression of and effect of betamethasone on the messenger ribonucleic acid levels for peptide growth factors in the baboon fetal adrenal gland. Journal of Endocrinology 163 123130.[Abstract]
Albrecht ED & Pepe CJ 1990 Placental steroid hormone biosynthesis in primate preganancy. Endocrine Reviews 11 124150.
Albrecht ED, Aberdeen GW, Babischkin JS, Tilly JL & Pepe GJ 1996 Biphasic developmental expression of adrenocorticotropin receptor messenger ribonucleic acid levels in the baboon fetal adrenal gland. Endocrinology 137 12921298.[Abstract]
Albrecht ED, Babischkin JS, Davies WA, Leavitt MG & Pepe GJ 1999 Identification and developmental expression of the estrogen receptors
and ß in the baboon fetal adrenal gland. Endocrinology 140 59535961.
Albrecht ED, Aberdeen GW & Pepe GJ 2000 The role of estrogen in the maintenance of primate pregnancy. American Journal of Obstetrics and Gynecology 182 432438.[CrossRef][Web of Science][Medline]
Albrecht ED, Aberdeen GW & Pepe GJ 2005 Estrogen elicits cortical zone-specific effects on development of the primate fetal adrenal gland. Endocrinology 146 17371744.
Bocian-Sobkowska J, Malendowicz LK & Wozniak T 1993 Cytological aspects of the human adrenal cortex development in the course of intra-uterine life. Histology and Histopathology 8 725730.[Web of Science][Medline]
Challis JRG, Davies IJ, Benirshke K, Hendrickx AG & Ryan K 1974 The effects of dexamethasone on plasma steroid levels and fetal adrenal histology in the pregnant rhesus monkey. Endocrinology 103 13001305.
Coulter CL 2004 Functional biology of the primate fetal adrenal gland: advances in technology provide new insight. Clinical and Experimental Pharmacology and Physiology 31 475484.[CrossRef][Web of Science][Medline]
Coulter CL, Goldsmith PC, Mesiano S, Voytek CC, Martin MC, Han VKM & Jaffe RB 1996 Functional maturation of the primate fetal adrenal in vivo: role of insulin-like growth factors. IGF-I receptor and IGF binding proteins in growth regulation. Endocrinology 137 44874498.[Abstract]
Crickard K, Ill CR & Jaffe RB 1981 Control of proliferation of human fetal adrenal cells in vitro. Journal of Clinical Endocrinology and Metabolism 53 790796.
Crowder RE 1957 The development of the adrenal gland in man, with special reference to origin and ultimate location of cell types and evidence in favor of the cell migration theory. Contemporary Embryology 251 195209.
Di Blasio AM, Fujii DK, Yamamoto M, Martin MC & Jaffe RB 1990 Maintenance of cell proliferation and steroidogenesis in cultured human fetal adrenal cells chronically exposed to adrenocorticotropic hormone: rationalization of in vitro and in vivo findings. Biology of Reproduction 42 683691.[Abstract]
Hornsby PJ & Gill GN 1977 Hormonal control of adrenocortical cell proliferation. Desensitization to ACTH and interaction between ACTH and fibroblast growth factor in bovine adrenocortical cell cultures. Journal of Clinical Investigation 60 342352.[Web of Science][Medline]
Jaffe RB, Seron-Ferre M, Crickard K, Koritnik D, Mitchell BF & Huhtaniemi IT 1981 Regulation and function of the primate fetal adrenal gland and gonad. Recent Progress in Hormone Research 37 41103.[Medline]
Jirasek J 1980 Human Fetal Endocrines. pp 6982 London: Martinus Nijhoff.
Johannisson E 1968 The foetal adrenal cortex in the human. Its ultrastructure at different stages of development and in different functional states. Acta Endocrinologica 130 (Suppl) 1107.
Kahri AI & Halinen H 1974 Studies on the cortical cells of human fetal adrenals in tissue culture. Acta Anatomica 88 541555.[Web of Science][Medline]
Keene MFL & Hewer EE 1927 Observations on the development of the human suprarenal gland. Journal of Anatomy 61 302324.[Web of Science][Medline]
Leavitt MG, Aberdeen GW, Burch MG, Albrecht ED & Pepe GJ 1997 Inhibition of fetal adrenal adrenocorticotropin receptor messenger ribonucleic acid expression by betamethasone administration to the baboon fetus in late gestation. Endocrinology 138 27052712.
Leavitt MG, Albrecht ED & Pepe GJ 1999 Development of the baboon fetal adrenal gland: regulation of the ontogenesis of the definitive and transitional zones by adrenocorticotropin. Journal of Clinical Endocrinology and Metabolism 84 38313835.
Mesiano S & Jaffe RB 1992 Regulation of growth and differentiated function in the human fetal adrenal. In Cellular and Molecular Biology of the Adrenal Cortex, pp 235245. Eds JM Saez, AC Brownie, A Capponi, EM Chambaz & F Mantero. Paris: INSERM/Libbey Eurotext.
Mesiano S & Jaffe RB 1997 Developmental and functional biology of the primate fetal adrenal cortex. Endocrine Reviews 18 378403.
Mesiano S, Coulter CL & Jaffe RB 1993 Localization of cytochrome P-450 cholesterol side-chain cleavage, cytochrome P-450 17
-hydroxyl-ase/17,20-lyase, and 3ß-hydroxy steroid dehydrogenase isomerase steroidogenic enzymes in human and rhesus monkey fetal adrenal glands: reappraisal of functional zonation. Journal of Clinical Endocrinology and Metabolism 77 11841189.[Abstract]
Muench MO, Ratclihhe JV, Nakanishi M, Ishimoto H & Jaffe RB 2003 Isolation of definitive zone and chromaffin cells based upon expression of CD56 (neural cell adhesion molecule) in the human fetal adrenal gland. Journal of Clinical Endocrinology and Metabolism 88 39213930.
Niklaus AL, Aberdeen GW, Babischkin JS, Pepe GJ & Albrecht ED 2003 Effect of estrogen on vascular endothelial growth/permeability factor expression by glandular epithelial and stromal cells in the baboon endometrium. Biology of Reproduction 68 19972004.
Pepe GJ & Albrecht ED 1990 Regulation of the primate fetal adrenal cortex. Endocrine Reviews 11 151176.
Pepe GJ & Albrecht ED 1995 Actions of placental and fetal adrenal steroid hormones in primate pregnancy. Endocrine Reviews 16 608648.
Pepe GJ, Davies WA & Albrecht ED 1994 Activation of the baboon fetal pituitaryadrenocortical axis at midgestation by estrogen: enhancement of fetal pituitary proopiomelanocortin messenger ribonucleic acid expression. Endocrinology 134 25812587.
Pestell RG, Albanese C, Reutens A, Segall JE, Lee RJ & Arnold A 1999 The cyclins and cyclin-dependent kinase inhibitors in hormonal regulation of proliferation and differentiation. Endocrine Reviews 20 501534.
Rama S, Petrusz P & Rao AJ 2004 Hormonal regulation of human trophoblast differentiation: a possible role for 17ß-estradiol and GnRH. Molecular and Cellular Endocrinology 218 7994.[CrossRef][Web of Science][Medline]
Ramachandran J & Suyama T 1975 Inhibition of replication of normal adrenocortical cells in culture by adrenocorticotrophin. PNAS 72 113118.
Roos BA 1974 Effect of ACTH and cAMP on human adrenocortical growth and function in vitro. Endocrinology 94 685690.
Sherr CJ & Roberts JM 1999 CDK inhibitors: positive and negative regulators of G1-phase progression. Genes and Development 13 15011512.
Simonian MH & Gill GN 1981 Regulation of the fetal adrenal cortex: effect of adrenocorticotropin on growth and function of monolayer cultures of fetal and definitive zone cells. Endocrinology 108 17691779.
Spencer SJ, Mesiano S, Lee JY & Jaffe RB 1999 Proliferation and apoptosis in the human adrenal cortex during the fetal and perinatal periods: implications for growth and remodeling. Journal of Clinical Endocrinology and Metabolism 84 11101115.
Walsh SW, Norman RL & Novy MJ 1979 In utero regulation of rhesus monkey fetal adrenals: effects of dexamethasone, adrenocorticotropin, thyrotropin releasing hormone, prolactin, human chorionic gonadotropin and
-melanocyte stimulating hormone on fetal and maternal plasma steroids. Endocrinology 104 18051813.
Received in final form 3 October 2006
Accepted 9 October 2006
Made available online as an Accepted Preprint 17 October 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |