|
|
||||||||
Department of Biochemistry and Molecular Biology, Faculties of Kinesiology and Medicine, University of Calgary, 2500 University Drive NW, Calgary, AB T2N 1N4 Canada
(Requests for offprints should be addressed to R A Reimer; Email: reimer{at}ucalgary.ca)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Previously, we identified the NCI-H716 enteroendocrine cell line as a unique human model for studying the regulation of GLP-1 secretion (Reimer et al. 2001). Similar to several animal cellular models, the NCI-H716 cells respond to activators of protein kinase A (PKA) and protein kinase C (PKC) with increased GLP-1 secretion (Reimer et al. 2001). The neuromediator, gastrin-releasing peptide, is also able to increase GLP-1 secretion at high doses. In addition, Anini & Brubaker (2003) have described a role for M1 and M2 muscarinic receptors in the control of GLP-1 secretion in NCI-H716 cells. Reimann et al.(2004) have recently shown that glutamine is a potent stimulator of GLP-1 secretion from the murine glucagon gene simian virus-40 large T-antigen (GLUTag) cell line. They suggest a possible involvement of the Na-coupled glutamine transporters and using reverse transcriptase (RT)-PCR have identified several Na-coupled amino acid transporters in the GLUTag cells with the strongest bands observed for ATA-2 (electrogenic neutral amino acid transporter), ASCT-2 (sodium dependent neutral amino acid transporter type 2) and y+LAT2 (electroneutral amino acid transporter; Hyde et al. 2003, Reimann et al. 2004). These transporters may play a role in the release of GLP-1 in response to protein and amino acids.
Nutrient ingestion is a major stimulus for GLP-1 release from the L-cells (Drucker 1998). The direct effect of nutrients on GLP-1 secretion has been examined in several cellular models. Saturated fatty acids, palmitic and the unsaturated oleic acids stimulate GLP-1 secretion in human NCI-H716 cells (Reimer et al. 2001). In contrast, only unsaturated fatty acids were effective in the murine GLUTag enteroendocrine cell line and in fetal rat intestinal cells (Brubaker et al. 1998, Rocca et al. 2001). Meat hydrolysate (MH), previously shown in rodent cells to stimulate GLP-1 secretion (Cordier-Bussat et al. 1998), results in a potent stimulation of GLP-1 release in the human NCI-H716 cell line (Reimer et al. 2001). The cellular mechanisms by which MH induces GLP-1 secretion are not known. Given the potential use of modified diets and functional foods to enhance endogenous GLP-1 secretion and improve glucose control in human subjects, understanding the mechanisms involved in nutrient-stimulated GLP-1 secretion is critical. This in vitro work will help identify important targets that can ultimately be tested in future human trials.
The mitogen-activated protein kinase (MAPK) family of signalling molecules, includes extracellular signal-regulated kinase (ERK)1/2, p38 MAPK, c-Jun N-terminal kinase/ stress-activated protein kinase (JNK/SAPK), ERK3 and ERK5. MAPKs are the regulators in pathways controlling embryogenesis, cell differentiation, cell proliferation and cell death (Pearson et al. 2001). Glucose-dependent insulinotrophic polypeptide (GIP) and GLP-1 are two incretins, whose actions are mediated via their respective G-protein-coupled receptors (Brubaker & Drucker 2002). The p38 MAPK signal has been shown to mediate GLP-1 induced ß-cell proliferation (Buteau et al. 2001) and GIP-stimulated ß-(insulinoma cell line (INS)-1) cell survival (Ehses et al. 2003). Many other members of the vasoactive intestinal polypeptide/secretin/glucagon superfamily also exert their downstream effects via activation of MAPKs (Barrie et al. 1997, Montrose-Rafizadeh et al. 1999, Jiang et al. 2001). These studies demonstrate the important role played by the MAPK family of signal molecules in the physiological actions exerted by GLP-1, particularly in the pancreas. However, the role of MAPKs in the stimulation of endogenous GLP-1 secretion by nutrients has never been described. We, hereby, provide evidence for the role of MAPKs in MH-induced GLP-1 secretion in the NCI-H716 cell line. Given the lack of consensus on the role of amino acids in stimulating GLP-1 release, we also demonstrate the ability of essential amino acids (EAAs), but not non-essential amino acids (NEAAs) to trigger secretion.
| Materials and Methods |
|---|
|
|
|---|
Cell line and culture conditions
Human NCI-H716 cells were grown in suspension at 37 °C, 5% CO2. The culture medium was RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, 100 IU/ml penicillin and 100 µg/ml streptomycin. Endocrine differentiation was enhanced by growing cells in dishes coated with Matrigel (Becton Dickinson, Bedford, MA, USA), as described previously (de Bruine et al. 1993).
Secretion studies
Two days before the experiments, 1 x 106 cells were seeded in 12-well culture plates coated with Matrigel and containing high-glucose DMEM, 10% FBS, 2 mM L-glutamine, 100 IU/ml penicillin and 100 µg/ml streptomycin. On the day of the experiment, medium was replaced by KRB containing 0.2% (w/v) BSA with or without test agents and pH adjusted to 7.2. In experiments with pharmacological inhibitors, cells were preincubated with the inhibitor or dimethyl sulphoxide (DMSO) as a control for 30 min prior to the secretion period. Fresh media were added and cells incubated for 2 h at 37 °C with a 2% (w/v) MH solution alone or in combination with the various inhibitors. DMSO was used as a control. Supernatants were collected with the addition of 50 µg/ml phenylmethylsulphonyl fluoride (PMSF) and diprotin-A (34 µg/ml) and frozen at 80 °C for subsequent RIA analysis. Cells were scraped off and sonicated in a homogenization buffer (1 M HCl containing 5% (v/v) HCOOH, 1% (v/v) trifluoroacetic acid and 1% (w/v) NaCl). Peptides were extracted from the cell media and homogenates using an alcohol extraction method as described by the supplier of the GLP-1(736) Active RIA Kit (Linco Research, Inc., St Charles, MO, USA). Protein content of the cell homogenate was determined using the Bradford protein assay (Bio-Rad, Inc.).
Western blots
Cells were lysed on ice in buffer (50 mM HEPES, 150 mM NaCl, 10% glycerol, 1.5 mM MgCl2, 1 mM EGTA, 100 mM NaF and 1% NP40) containing 1 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 1 mM sodium othorandanole and 1 mM Na3VO4. Total protein concentrations were determined using the Bradford protein assay (Bio-Rad), and aliquots of each sample representing equal amounts of proteins were subjected to Western immunoblotting analysis. Cell lysates were suspended in sample buffer (10% glycerol, 62.5 mM TrisHCl, 2% SDS and 50 mM DTT (pH 6.8)) and subjected to electrophoresis in 10% polyacrylamide SDS gel and transferred to nitrocellulose membranes. The membranes were blocked in buffer (1x Tris-buffered saline (TBS) (50 mM Tris-base, 0.14 M NaCl, 4.8 mM KCl, 0.1% Tween-20)) with skim milk and incubated overnight with a 1:1000 dilution of antibody against phosphorylated p38, 1:5000 dilution of phosphorylated ERK1/2 antibody or 1:500 dilution of JNK antibody. Membranes were washed and incubated for 1 h with a 1:10 000 dilution of peroxidase-conjugated anti-rabbit immunoglobulin (Amersham Pharmacia). Proteins were visualized with electrochemiluminescence (ECL) substrate reagent (Amersham Pharmacia). To control for protein concentration, membranes were stripped and reprobed for total p38 kinase (1:100), total ERK1/2 (1:1000) and total JNK (1:500).
RT-PCR
RT-PCR was performed as described previously (Reimer et al. 2001) using the following primers: PEPT1 (SLC15A1) sense TGTCGCTCTCCATTGTCTAC, antisense TTCCA-CATTGTTGAACTCTGAG; Y+LAT2 (SLC7A6) sense GCACTCATCTACCTCATCG, antisense GATAGCAGC-CAGGACATTC; ASCT2 (SLC1A5) sense GCTTATCCG-CTTCTTCAACTCCTTC, antisense CC-ATTATTCT-CCTCCACGCACTTC; ATA-2 (SLC38A2) sense TGGTAT-CTGAACGGGAACTATTTG, antisense AATTGGCACAGCATAGACAGTC and actin sense GTTGCTATCCAGGC-TGTG, antisense CATAGTCCG-CCTAGAAGC.
Statistical analysis
Data in figures are presented as means ± S.E.M. and represent a minimum of three experiments measured in duplicate. Statistical differences were determined using the KruskalWalliss H-test with post hoc analysis to determine the differences between treatments using the MannWhitneys U-test. Statistical significance was defined as P
0.05.
| Results |
|---|
|
|
|---|
Incubation of NCI-H716 cells with SB203580, a specific inhibitor of p38 MAPK, significantly reduced MH-induced GLP-1 secretion (291.9 ± 46.4% control) compared with MH alone (471.0 ± 65.2% control; P < 0.05; Fig. 1
). In addition, wortmannin, a phosphatidyl inositol 3 kinase (PI3K) inhibitor, significantly reduced MH-induced GLP-1 secretion (161.1 ± 75.7% control; P < 0.05) compared with MH alone (471.0 ± 65.2% control). The U0126 compound, an inhibitor of MEK1/2 upstream from ERK1/2, also significantly reduced MH-induced GLP-1 secretion. Incubation solely with wortmannin or U0126 caused a slight reduction in basal GLP-1 secretion.
|
|
|
|
|
|
|
|
|
, granulocytemacrophage colony-stimulating factor and lipo-polysaccharide did not elicit an activation of ERK1/2 in the NCI-H716 cells (data not shown). Given that activation of ERK1/2 alone is not sufficient to induce GLP-1 secretion, it may suggest that MH is able to initiate GLP-1 secretion and perhaps then potentiate its release via the ERK1/2 pathway. This will require further examination. | Discussion |
|---|
|
|
|---|
In addition to the MAPK family, we also determined that the inhibition of PI3K impaired MH-induced GLP-1 secretion. In fact, both p38 MAPK and PI3K have been implicated in the growth promotive effects of GLP-1 (Buteau et al. 1999, 2001). It is, therefore, not unusual that several signalling modules are involved in the cellular response to MH. While glucose is known to cause a rapid and continuous activation of ERK1/2 in ß-cells (Arnette et al. 2003), our study is the first to describe the activation of ERK1/2 by MH and furthermore by EAAs in enteroendocrine cells.
Our work is in agreement with recently published evidence that enhanced secretion of GLP-1 by free fatty acids (FFA) in the murine cholecystokinin-secreting murine small intestine endocrine (STC)-1 cell line is accompanied by the activation of ERK1/2 (Hirasawa et al. 2005). GPR120, a G-protein-coupled receptor abundantly expressed in the STC-1 cell line, was identified as a receptor for unsaturated long-chain FFA. Transfection of the STC-1 cells with GPR-120-specific small interfering RNA significantly reduced
-linolenic acid-induced GLP-1 secretion (Hirasawa et al. 2005). Transfection of NCI-H716 cells (which have little expression of GPR120) with GPR120 improved the ability of NCI-H716 cells to secrete GLP-1 in response to
-linolenic acid (Hirasawa et al. 2005). Taken together with our present work, it suggests that ERK1/2 may serve as a common pathway regulating nutrient-induced GLP-1 secretion.
We and other researchers had previously shown that activation of the PKA and PKC pathways in enteroendocrine cells stimulates GLP-1 secretion (Brubaker & Vranic 1987, Buchan et al. 1987, Drucker et al. 1987, Reimer et al. 2001). In the present study, however, we found that inhibition of the PKA or PKC pathway with RpcAMPS or chelerythrine respectively, did not reduce MH-induced GLP-1 secretion. These findings are in agreement with work by Reimann et al.(2004) in which inhibition of PKA or PKC did not affect glutamine-stimulated GLP-1 secretion. The intracellular amino acid target mammalian target of rapamycin mTOR also did not significantly impair the response to glutamine (Reimann et al. 2004). Inhibition of calmodulin kinase impaired GLP-1 secretion in response to glutamine but also glucose and alanine. In contrast to the lack of effects of PKA and PKC inhibitors, blocking p38 MAPK, PI3K or MEK1/2, all resulted in a reduction in the potential for MH to trigger GLP-1 release. Our specific examination of the MAPK pathways suggests that the ERK1/2 and p38 MAPK subfamilies appear to work in concert to regulate the response to MH by the enteroendocrine cell. This is based on the observations that MH increases ERK1/2 phosphorylation and that inhibition of p38 MAPK further augments the level of phosphorylated ERK1/2 in response to MH. This same crosstalk between ERK1/2 and p38 MAPK has been observed in the rat pineal gland in response to norepinephrine (Mackova et al. 2000) and in a rat hepatoma cell line (Singh et al. 1999).
The work by Reimann & Gribble (2002) also suggests that GLUTag cells are electrically active and respond to increased glucose concentrations with membrane depolarization, triggering enhanced action potential firing and GLP-1 secretion. Interestingly, the non-metabolizable sugar, methyl-
-glucopyranoside, also stimulates electrical activity and GLP-1 secretion by inducing an inward current, largely explained by electrogenic actions of sodiumglucose co-transporters (Gribble et al. 2003). Glutamine has also been shown, by the same group, to both initiate GLP-1 secretion in the GLUTag cell line via triggering membrane depolarization and generating action potentials, as well as potentiating GLP-1 secretion downstream of the calcium signal (Reimann et al. 2004). Although to date, work elucidating the mechanisms by which nutrients stimulate GLP-1 release has been limited, recent studies coupled with our data suggest that the pathways involved are likely complex and in some cases nutrient specific.
MH is a complex compound that is poorly defined, but it is likely to be composed of a mixture of di- and tri-peptides and amino acids. It was, therefore, our intent to provide further insight into the active components of this protein source that stimulate GLP-1 secretion. We effectively demonstrated that a mixture of EAAs, in contrast to a mixture of NEAAs, stimulates GLP-1 secretion in human NCI-H716 cells. While our cells did not express the H+-coupled peptide transporter 1 (PEPT1), which mediates transport of small peptides from the lumen into cells (Terada & Inui 2004), we did confirm the presence of several of the same amino acid transporters (ATA-2, ASCT-2 and y+LAT2) reported by Reimann et al.(2004) in the murine GLUTag cells. ATA-2 is an electrogenic amino acid transporter and evidence from Reimann et al.(2004) demonstrates that the depolarizing action of glutamine contributes to GLP-1 secretion. The role of depolarization by MH or a mixture of EAAs remains to be demonstrated in human NCI-H716 cells.
Since the evidence for the role of proteins and amino acids in GLP-1 secretion has been conflicting; it is important to continue to probe the cellular mechanisms responsible for endogenous secretion. While some show that oral amino acids, but not luminal perfusion induce a rapid plasma GLP-1 response (Herrmann et al. 1995), others show that an oral protein meal (Elliott et al. 1993) but not ileal protein perfusion (Layer et al. 1995) result in elevated plasma GLP-1 levels. While confusing, some explanation may be found in the type of protein utilized based on the findings of Hall et al.(2003), who showed that plasma GLP-1 is higher following a whey preload compared with casein. Whey is considered a fast protein, whereas casein is considered a slow protein based on their differences in rate of digestion and absorption (Boirie et al. 1997). In addition to the speed with which dietary amino acids are delivered to the plasma (Boirie et al. 1997), whey also contains a high proportion of branched chain amino acids (Ha & Zemel 2003), which are EAAs and may affect GLP-1 secretion. Our results suggest that EAAs can exert a direct stimulatory effect on GLP-1 secretion in the human NCI-H716 cell line. Even though many proteins are absorbed by the time they reach the distal small intestine, it is nevertheless important to understand the mechanisms by which various protein sources, including MH, stimulate GLP-1 secretion. The rapid advances in the area of functional foods have the potential to foster the development of novel foods with specific targeted actions, including GLP-1 release from the distal gut.
In conclusion, we have demonstrated the involvement of ERK1/2 MAPK in the secretion of GLP-1 in response to MH. When a mixture of EAAs was used to give greater definition to the complex hydrolysate, p38 MAPK was activated in addition to ERK1/2. This work provides evidence for the cellular pathways involved in nutrient-stimulated GLP-1 release. While our work suggests that protein hydrolysates and mixtures of EAAs are effective potentiators of GLP-1 secretion, work by other researchers suggests that even single amino acids such as glutamine may be an effective nutrient stimulus (Reimann et al. 2004). Evaluating these compounds in vivo will shed light on the potential for their use in patients perhaps in the form of functional foods. Identification of cellular targets and mechanisms involved in GLP-1 release using this in vitro model will provide important insight for the design of future human trials with the ultimate goal of designing novel nutritional strategies for the treatment of type-2 diabetes and obesity.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Arnette D, Beers Gibson T, Lawrence MC, January B, Khoo S, McGlynn K, Vanderbilt CA & Cobb MH 2003 Regulation of ERK1 and ERK2 by glucose and peptide hormones in pancreatic B-cells. Journal of Biological Chemistry 278 3251732525.
Barrie AP, Clohessy AM, Buensuceso CS, Rogers MV & Allen JM 1997 Pituitary adenylyl cyclase-activating peptide stimulates extracellular signal-regulated kinase 1 or 2 (ERK1/2) activity in a Ras-independent, mitogen-activated protein kinase/ERK kinase 1 or 2-dependent manner in PC-12 cells. Journal of Biological Chemistry 272 1966619671.
Boirie Y, Dangin M, Gachon P, Vasson M, Maubois J & Beaufrère B 1997 Slow and fast dietary proteins differently modulate postprandial protein accretion. PNAS 94 1493014935.
Brubaker PL & Drucker D 2002 Structure-function of the glucagon receptor family of G protein-coupled receptors: the glucagon, GIP, GLP-1 and GLP-2 receptors. Receptors and Channels 8 179188.[CrossRef][Web of Science][Medline]
Brubaker PL & Vranic M 1987 Fetal rat intestinal cells in monolayer culture: a new in vitro system to study the glucagon-like immunoreactive peptides. Endocrinology 120 19761985.
Brubaker PL, Schloos J & Drucker DJ 1998 Regulation of glucagon-like peptide-1 synthesis and secretion in the GLUTag enteroendocrine cell line. Endocrinology 139 41084114.
de Bruine AP, Dinjens WN, van der Linden EP, Pijls MM, Moerkerk PT & Bosman FT 1993 Extracellular matrix components induce endocrine differentiation in vitro in NCI-H716 cells. American Journal of Pathology 142 773782.[Abstract]
Buchan AM, Barber DL, Gregor M & Soll AH 1987 Morphologic and physiologic studies of canine ileal enteroglucagon-containing cells in short-term culture. Gastroenterology 93 791800.[Web of Science][Medline]
Buteau J, Roduit R, Susini S & Prentki M 1999 Glucagon-like peptide-1 promotes DNA synthesis, activates phosphatidylinositol 3-kinase and increases transcription factor pancreatic and duodenal homeobox gene 1 (PDX-1) DNA binding activity. Diabetologia 42 856864.[CrossRef][Web of Science][Medline]
Buteau J, Foisy S, Rhodes CJ, Carpenter L, Biden TJ & Prentki M 2001 Protein kinase C gamma activation mediates glucagon-like peptide-1-induced pancreatic B-cell proliferation. Diabetes 50 22372243.
Cordier-Bussat M, Bernard C, Levenez F, Klages N, Laser-Ritz B, Philippe J, Chayvialle JA & Cuber JC 1998 Peptones stimulate both the secretion of the incretin hormone glucagon-like peptide-1 and the transcription of the proglucagon gene. Diabetes 47 10381045.[Abstract]
Dostmann WR, Taylor SS, Genieser HG, Jastorff B, Doskeland SO & Ogreid D 1990 Probing the cyclic nucleotide binding sites of cAMP-dependent protein kinases I and II with analogs of adenosine 3',5'-cyclic phosphorothioates. Journal of Biological Chemistry 265 1048410491.
Drucker DJ 1998 Glucagon-like peptides. Diabetes 47 159169.[Abstract]
Drucker DJ, Philippe J, Mojsov S, Chick WL & Habener JF 1987 Glucagon-like peptide I stimulates insulin gene expression and increases cyclic AMP levels in a rat islet cell line. PNAS 84 34343438.
Ehses JA, Casilla VR, Doty T, Pospisilik JA, Winter KD, Demuth H-U, Pederson RA & McIntosh CH 2003 Glucose-dependent insulinotropic polypeptide promotes B-(INS-1) cell survival via cyclic adenosine monophosphate-mediated caspase-3 inhibition and regulation of p38 mitogen-activated protein kinase. Endocrinology 144 44334445.
Elliott RM, Morgan LM, Tredger JA, Deacon S, Wright J & Marks V 1993 Glucagon-like peptide-1 (736)amide and glucose-dependent insulinotropic polypeptide secretion in response to nutrient ingestion in man: acute post-prandial and 24 h secretion patterns. Journal of Endocrinology 138 159166.
Flint A, Raben A, Astrup A & Holst JJ 1998 Glucagon-like peptide 1 promotes satiety and suppresses energy intake in humans. Journal of Clinical Investigation 101 515520.[Web of Science][Medline]
Gribble FM, Williams L, Simpson AK & Reimann F 2003 A novel glucose-sensing mechanism contributing to glucagon-like peptide-1 secretion from the GLUTag cell line. Diabetes 52 11471154.
Ha E & Zemel MB 2003 Functional properties of whey, whey components, and essential amino acids: mechanisms underlying health benefits for active people (review). Journal of Nutritional Biochemistry 14 251258.[CrossRef][Web of Science][Medline]
Hall WL, Millward DJ, Long SJ & Morgan LM 2003 Casein and whey exert different effects on plasma amino acid profiles, gastrointestinal hormone secretion and appetite. British Journal of Nutrition 89 239248.[CrossRef][Web of Science][Medline]
Herrmann C, Goke R, Richter G, Fehmann HC, Arnold R & Goke B 1995 Glucagon-like peptide-1 and glucose-dependent insulin-releasing polypeptide plasma levels in response to nutrients. Digestion 56 117126.[Web of Science][Medline]
Hirasawa A, Tsumaya K, Awaji T, Katsuma S, Adachi T, Yamada M, Sugimoto Y, Miyazaki S & Tsujimoto G 2005 Free fatty acids regulate gut incretin glucagon-like peptide-1 secretion through GPR120. Nature Medicine 11 9094.[CrossRef][Web of Science][Medline]
Hyde R, Taylor PM & Hundal HS 2003 Amino acid transporters: roles in amino acid sensing and signalling in animal cells. Biochemical Journal 373 118.[CrossRef][Web of Science][Medline]
Jarvis WD, Turner AJ, Povirk LF, Traylor RS & Grant S 1994 Induction of apoptotic DNA fragmentation and cell death in HL-60 human promyelocytic leukemia cells by pharmacological inhibitors of protein kinase C. Cancer Research 54 17071714.
Jiang Y, Cypress AM, Muse ED, Wu C-R, Unson CG, Merrifield RB & Sakmar TP 2001 Glucagon receptor activates extracellular signal-regulated protein kinase 1/2 via cAMP-dependent protein kinase. PNAS 98 1010210107.
Kieffer TJ & Habener JF 1999 The glucagon-like peptides. Endocrine Reviews 20 876913.
Layer P, Holst JJ, Grandt D & Goebell H 1995 Ileal release of glucagon-like peptide-1 (GLP-1): association with inhibition of gastric acid secretion in humans. Digestive Diseases and Sciences 40 10741082.[CrossRef][Web of Science][Medline]
Mackova M, Man JR, Chik CL & Ho AK 2000 p38MAPK inhibition enhances basal and norepinephrine stimulated p42/44MAPK phosphorylation in rat pinealocytes. Endocrinology 141 42024208.
Montrose-Rafizadeh C, Avdonin P, Garant MJ, Rodgers BD, Kole S, Yang H, Levine MA, Schwindinger W & Bernier M 1999 Pancreatic glucagon-like peptide-1 receptor couples to multiple G proteins and activates mitogen-activated protein kinase pathways in Chinese hamster ovary cells. Endocrinology 140 11321140.
Pearson G, Robinson F, Beers Gibson T, Xu B-E, Karandikar M, Berman K & Cobb MH 2001 Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocrine Reviews 22 153183.
Reimann F & Gribble FM 2002 Glucose-sensing in glucagon-like peptide-1 secreting cells. Diabetes 51 27572763.
Reimann F, Williams L, da Silva Xavier G, Rutter GA & Gribble FM 2004 Glutamine potently stimulates glucagon-like peptide-1 secretion from GLUTag cells. Diabetologia 47 15921601.[CrossRef][Web of Science][Medline]
Reimer RA, Darimont C, Nicolas-Metral V, Gremlich S, Rüegg UT & Macé K 2001 A human cellular model for studying the regulation of glucagon-like peptide 1 secretion. Endocrinology 142 45224528.
Rocca AS, LaGreca J, Kalitsky J & Brubaker PL 2001 Monounsaturated fatty acid diets improve glycemic tolerance through increased secretion of glucagon-like peptide-1. Endocrinology 142 11481155.
Singh RP, Dhawan P, Golden C, Kapoor GS & Mehta KD 1999 One-way cross-talk between p38MAPK and p42/44MAPK. Inhibition of p38MAPK induces low density lipoprotein receptor expression through activation of the p42/44MAPK cascade. Journal of Biological Chemistry 274 1959319600.
Terada T & Inui K 2004 Peptide transporters: structure, function, regulation and application for drug delivery. Current Drug Metabolism 5 8594.[CrossRef][Web of Science][Medline]
Turton MD, OShea D, Gunn I, Beak SA, Edwards CMB, Meeran K, Choi SJ, Taylor GM, Heath MM, Lambert PD et al. 1996 A role for glucagon-like peptide-1 in the central regulation of feeding. Nature 379 6972.[CrossRef][Medline]
Xiao Q, Boushey RP, Drucker DJ & Brubaker PL 1999 Secretion of the intestinotropic hormone glucagon-like peptide 2 is differentially regulated by nutrients in humans. Gastroenterology 117 99105.[CrossRef][Web of Science][Medline]
Received in final form 13 June 2006
Accepted 29 June 2006
Made available online as an Accepted Preprint 17 July 2006
This article has been cited by other articles:
![]() |
T. Hira, T. Mochida, K. Miyashita, and H. Hara GLP-1 secretion is enhanced directly in the ileum but indirectly in the duodenum by a newly identified potent stimulator, zein hydrolysate, in rats Am J Physiol Gastrointest Liver Physiol, October 1, 2009; 297(4): G663 - G671. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Lim, G. J. Huang, N. Flora, D. LeRoith, C. J. Rhodes, and P. L. Brubaker Insulin Regulates Glucagon-Like Peptide-1 Secretion from the Enteroendocrine L Cell Endocrinology, February 1, 2009; 150(2): 580 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kidd, I. M. Modlin, B. I. Gustafsson, I. Drozdov, O. Hauso, and R. Pfragner Luminal regulation of normal and neoplastic human EC cell serotonin release is mediated by bile salts, amines, tastants, and olfactants Am J Physiol Gastrointest Liver Physiol, August 1, 2008; 295(2): G260 - G272. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |