JOE Society for Endocrinology Archive
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2006) 190, 749-757       DOI: 10.1677/joe.1.06808
© 2006 Society for Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakata, I.
Right arrow Articles by Sakai, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakata, I.
Right arrow Articles by Sakai, T.

Gastric estrogen directly induces ghrelin expression and production in the rat stomach

Ichiro Sakata, Toru Tanaka1, Mami Yamazaki, Takashi Tanizaki, Zhao Zheng and Takafumi Sakai

Department of Regulation Biology, Faculty of Science, Saitama University, 255 Shimo-ohkubo, Sakuraku, Saitama 338-8570, Japan
1 Faculty of Pharmaceutical Sciences, Josai University, 1-1, Keyaki-dai, Saitama 350-02, Japan

(Requests for offprints should be addressed to T Sakai; Email: tsakai{at}post.saitama-u.ac.jp)


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ghrelin, an endogenous ligand for the GH secretagogue receptor, is predominantly produced in the stomach. Little is known about the regulation mechanism of gastric ghrelin. Here, we report that estrogen synthesized in the stomach induces rat gastric ghrelin gene expression and production. We established a gastric ghrelin cell enrichment method using Percoll centrifugation and then studied the effect of estrogen and/or its antagonist on ghrelin expression and production. Treatment with estrogen for 8 h significantly increased the level of ghrelin expression, and ICI-182 780, an estrogen receptor (ER) antagonist, completely reversed this effect. Reverse transcriptase-PCR analysis clearly showed that ER{alpha} and aromatase are expressed in the female rat stomach. Moreover, treatment with an aromatase inhibitor, 4-hydro-xyandrostenedione (formestane), significantly decreased the level of ghrelin mRNA expression in minced stomach tissue. In vivo studies revealed that the ghrelin mRNA expression and production did not change in gonadectomized rat 3 weeks after surgery. These results strongly suggest that estrogen produced in the stomach directly induces ghrelin expression and production in both female and male rat stomachs.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ghrelin, a gut–brain peptide, was identified as an endogenous ligandfor the growth hormone secretagoguereceptor (GHS-R), and has been shown to have a unique structure in which n-octanoyl modification at the third serine residue is essential for its biological activity (Kojima et al. 1999). It is known that ghrelin stimulates GH release from anterior pituitary cells (Kojima et al. 1999, Yamazaki et al. 2002, Hashizume et al. 2003, Malagon et al. 2003), and several recent studies have indicated that this effect is mediated via not only the direct, but also the indirect pathways, including the vagal afferent nerve (Date et al. 2002, Sakata et al. 2003). In addition to GH release, ghrelin also stimulates food intake and adiposity in humans and rodents (Tschop et al. 2000, 2001, Wren et al. 2000, 2001, Asakawa et al. 2001, Shintani et al. 2001), indicating that these physiological effects of ghrelin play an important role in growth regulation and energy homeostasis.

A large amount of acylated bio-active ghrelin, the only peripheral orexigenic peptide identified so far, is present in the stomach (Kojima et al. 1999, Ariyasu et al. 2001, Sakata et al. 2002a), and it has been reported that production and expression of ghrelin are regulated by some physiological conditions and factors; for example, it has been shown that gastric ghrelin mRNA and plasma circulating ghrelin levels increased after fasting and are affected by treatment with leptin, insulin, glucagons, and somatostatin (Toshinai et al. 2001, Bagnasco et al. 2002, Shimada et al. 2003, Chanoine & Wong 2004, Kamegai et al. 2004, Lippl et al. 2004, Sanchez et al. 2004). However, the factor that directly regulates ghrelin gene expression is still not clear. In a previous study, we demonstrated that the number of ghrelin cells and level of plasma ghrelin and gastric ghrelin mRNA transiently increased 3 days after ovariectomy in both 4- and 9-week-old female rats (Matsubara et al. 2004). Moreover, we found that ghrelin-immunopositive (ghrelin-ip) cells express estrogen receptor {alpha} (ER{alpha}; Matsubara et al. 2004), implying that estrogen plays a role in ghrelin expression.

On the other hand, it has been reported that estrogens are produced in extraovarian tissues, such as the testis (Harada & Yamada 1992, Brodie & Inkster 1993), brain (Harada & Yamada 1992, Lephart 1996), and adipose tissue (Ackerman et al. 1981, Nelson & Bulun 2001). Recently, Ueyama et al.(2002) clearly demonstrated that estrogen synthetase (aromatase) is expressed in gastric parietal cells of the rat stomach. Furthermore, Campbell-Thompson et al.(2001) reported that ER{alpha} expression was found in the stomach mucosa of rats, and Singh et al.(1997) also revealed the existence of ER mRNA and protein using Northern blot analysis and enzyme immunoassay in the human stomach mucosa. Taken together, these findings suggest that estrogen produced in the stomach regulates ghrelin gene expression. Therefore, in this study, we first established a method to obtain a ghrelin-rich cell fraction from gastric mucosa and then, using these cells or minced stomach, we investigated the effect of gastric estrogen on ghrelin gene expression and production.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

Intact adult male and female Wistar rats weighing 270–300 and 200–250 g respectively were used in this study. The rats were maintained under 12 h light:12 h darkness cycle (lights on at 0800 h) and room temperature (23 ± 2 °C) with food and water provided ad libitum. All procedures were performed in accordance with the institutional guidelines for animal care at Saitama University.

Dispersion of rat stomach cells

Isolated stomach cells were prepared by the enzymatic dispersion method. Female rats were sacrificed under ether anesthesia, and stomachs were quickly removed and then turned inside out. The stomachs were inflated and incubated in DISPASE I solution (1000 PU/ml Dispase I (Godo Shusei, Tokyo, Japan), 135 mM NaCl, 5 mM KCl, 0.8 mM MgCl2, 10 mM glucose, 10 mM HEPES, (DOJINDO, Kumamoto, Japan), 0.6 mM NaHCO3 (pH 7.4)) for 1–1.5 h. Stomach cells were removed from gastric mucosa using a glass pipe with a diameter of approximately 5 mm and passed through a 102 µm filter and then collected by centrifugation at 1500 r.p.m. for 5 min. The pellet was suspended in medium B (135 mM NaCl, 5 mM KCl, 0.8 mM MgCl2, 10 mM glucose, 10 mM HEPES, 0.6 mM NaHCO3 (pH 7.4)) and was stratified on 40% Percoll (Amersham Biosciences Corp.) in medium B. After centrifugation at 1500 r.p.m. for 5 min, the pellet was collected from the bottom of the tube and then stratified on the 40% layer on 50% Percoll medium and centrifuged again for 5 min. After centrifugation, cell solution fractioned on 50% Percoll medium was collected. These ghrelin-rich cells were resuspended in phenol red-free Dulbecco’s modified Eagle medium (DMEM, Life Technologies, Inc.) with 10% charcoal–dextran-treated fetal bovine serum. The cells were plated on a poly-L-lysine-coated culture dish (2.0 x 105 cells/ml) and incubated in humidified 95% air and 5% CO2 at 37 °C.

Experimental design

Experiment 1: effect of estrogen on isolated stomach cell  After 12–16 h culture, the medium was aspirated and the cells were washed twice with phenol red-free DMEM. The cells were then incubated in serum and phenol red-free DMEM containing 10–7–10–5 M water-soluble 17ß-estradiol (E2) (Sigma) or a vehicle for 8 h in humidified 95% air and 5% CO2 at 37 °C. The cells were treated with 10–4 M ICI-182 780, an ER antagonist, for 1 h before estrogen stimulation. After 8 h incubation, the medium was centrifuged at 3000 r.p.m. for 5 min and the supernatant was collected. Total RNA was extracted by using an ISOGEN kit (Nippon Gene, Tokyo, Japan). The samples were stored at –80 °C until analysis.

Experiment 2: effect of an aromatase inhibitor on stomach tissue culture  Female and male rats were killed under deep ether anesthesia and stomachs were quickly removed. The mucosa of the stomach body was minced (approximately 1 mm3) with a sharp razor blade in DMEM. These minced stomach tissues were incubated with serum-free DMEM containing 10–5 M formestane (Sigma), an aromatase inhibitor, for 8 h at 37 °C in humidified 95% air and 5% CO2. After incubation, these small tissues were collected, immersed in ISOGEN, and stored at –80 °C until analysis.

Experiment 3: effect of gonadectomy on gastric ghrelin mRNA level and plasma ghrelin concentration  For the gonadectomy study, ovariectomy and castration (CAST) were performed according to the general methods. All surgical operations were performed under sodium pentobarbital anesthesia (50 mg/kg i.p.). The animals were sacrificed by decapitation at 3 weeks after gonadectomy. Stomachs were collected and immersed in ISOGEN for ghrelin mRNA quantification, and trunk blood was also collected for determination of plasma ghrelin concentrations, and stored at –80 °C until analysis.

Immunocytochemical detection of ghrelin in isolated mucosal cells

Immunocytochemical detection of ghrelin cells using rabbit anti-ghrelin serum (# 603, a kind gift from Dr Kangawa, Department of Biochemistry, National Cardiovascular Centre Research Institute, Suita, Japan) was carried out by the avidin–biotin complex (ABC) method. The production and specificity of the anti-rat ghrelin serum used in this study were previously reported (Hosoda et al. 2000), and it is known that this antiserum recognizes the N-terminal region of rat ghrelin. Immunocytochemical staining was performed basically according to the previously reported procedure (Sakata et al. 2002a). Briefly, isolated stomach cells were fixed with 4% paraformaldehyde in 0.067 M phosphate buffer (PB; pH 7.4) for 30 min. After washing with PBS, they were treated with 0.5% sodium metaperiodate to block endogenous peroxidase for 15 min at room temperature and then incubated with TNBS (1% normal horse serum and 0.4% Triton X-100 in PBS) for 1 h. After washing with PBS, the cells were incubated overnight with anti-ghrelin serum diluted 1:100 000 in TNBS in a humidity chamber. An ABC method was used for immunocytochemistry using a staining kit (Vectastain ABC kit, Vector, Burlingame, CA, USA). All incubations were carried out in a humidity chamber at room temperature.

Double staining for aromatase mRNA and ghrelin

Female and male rats were deeply anesthetized with sodium pentobarbital (50 mg/kg i.p.) and perfused first with PBS, and then with 4% paraformaldehyde in 50 mM PB (pH 7.4). Stomachs were quickly removed from the rats and postfixed with 4% paraformaldehyde in 50 mM PB overnight. The tissues were immersed in 30% sucrose in PB overnight and embedded in O.C.T Tissue-Tek Compound (Sakura Fine-technical Co., Ltd, Tokyo, Japan). Serial cryosections (10 µm thick) were mounted on silane-coated slides (ShinEtsu Chemicals, Tokyo, Japan).

The sections were washed with PBS, treated with 2 µg/ml proteinase K for 30 min at 37 °C, and fixed with 4% paraformaldehyde in 0.067 M PB (pH 7.4). After washing with PBS for 1 min, the sections were incubated with 0.2 M HCl in water and then washed with PBS for 1 min. The sections were treated with 0.1 M triethanolamine–HCl (pH 8.0) for 1 min and with 0.25% acetic anhydride in 0.1 M triethanolamine for 10 min, washed with PBS for 1 min, immersed in a graded ethanol series (70, 80, and 90%) for 15 s each and then immersed twice in 100% ethanol for 15 s, and dried for 20 min. Digoxigenin (DIG)-labeled antisense and sense rat aromatase cRNA probes (GenBank accession no. M33986 [GenBank] , nucleotides 1093–2059) were synthesized using a labeling kit (Roche Diagnostics GmbH) with SP6 or T7 RNA polymerases. The probes were diluted to 1 ng/µl with hybridization buffer (50% formamide, 3 x standard saline citrate (SSC), 0.12 M diethyl pyrocarbonate (DEPC)-treated PB (pH 7.4), 1 x Denhardt solution, 125 µg/ml tRNA, 0.1 mg/ml sonicated salmon sperm DNA, and 10% dextran sulfate) and dropped on the tissue sections. A sense RNA probe was used as a negative control. The sections were covered with PARAFILM (American National Can, Chicago, IL, USA) and incubated for 16 h at 50 °C in a humid chamber. The covers were removed by soaking the slides in 5 x SSC and immersing in 2 x SSC containing 50% formamide for 30 min. The sections were then treated with TNE (10 mM Tris–HCl (pH 7.6), 500 mM NaCl, 1 mM EDTA (pH 8.0)) for 10 min and next with RNase A (5 µg/ml in TNE) for 30 min at 37 °C. The sections were immersed in TNE for 10 min at 37 °C and washed with 2 x SSC for 20 min at 50 °C and then with 0.2 x SSC for 20 min twice at 50 °C. The sections were incubated for 5 min in buffer-1 (100 mM Tris–HCl (pH 7.5), 150 mM NaCl, 0.01% Tween 20), immersed in 1.5% blocking reagent (Roche Diagnostics GmbH) in buffer-1 for 1 h at 37 °C, and then washed in buffer-1 for 5 min. After washing, the sections were incubated with an alkaline phosphatase-conjugated anti-DIG antibody (Roche Diagnostics Corporation) diluted 1:2000 in buffer-1. The sections were then washed in buffer-1 for 15 min twice and in buffer-2 (100 mM Tris–HCl (pH 9.5), 100 mM NaCl, 50 mM MgCl2) for 3 min. A chromagen solution (337 µg/ml 4-nitroblue tetrazolium chloride and 175 µg/ml 5-bromo-4-chloro-3-indolyl-phosphate in buffer-2) was added, and the sections were incubated until a visible signal was detected. The reaction was stopped by adding a reaction stop solution (10 mM Tris–HCl (pH 7.6), 1 mM EDTA (pH 8.0)). In this study, instead of DEPC-treated water, we used Gengard water (Gradient A10, Millipore, Tokyo, Japan) as RNase-free water. After the aromatase mRNA-expressing cells have been detected, immunohistochemistry for ghrelin was performed. After washing with PBS, the sections were incubated with TNBS for 1 h. After the second wash with PBS, the sections were incubated overnight with anti-ghrelin serum diluted 1:100 000 in TNBS in a humidity chamber. After the third wash, the sections were incubated with Alexa594-conjugated goat anti-rabbit IgG (Invitrogen, Corp.) as a second antibody. The sections were washed with PBS, mounted with 90% glycerol in PBS, and then viewed and photographed under a light microscope (BX60, Olympus, Tokyo, Japan).

Reverse transcriptase (RT)-PCR for ER{alpha} and aromatase mRNA

Total RNA was extracted from the isolated stomach cells or stomach tissues using ISOGEN according to the manufacturer’s instructions. Trace contamination of DNA was removed by DNase digestion (Promega). cDNA was synthesized from 1 µg total RNA using Superscript III reverse transcriptase (Invitrogen). The following primers were designed to amplify a rat ER{alpha} fragment (370 bp; accession no. Y00102 [GenBank] ): sense primer, ACCCATGGAACATTTCTGGA; antisense primer, CCGTAAGTGATGCTCGACTG. The following primers were designed to amplify a rat aromatase fragment (493 bp; accession no. M33986 [GenBank] ): sense primer, GGAATCCATCAAGCAGCAT; antisense primer, TTCCACCTCCGGATACTCTG. PCR was performed using HotStarTaq DNA Polymerase (Qiagen GmbH) according to the manufacturer’s instructions. Initial template denaturation was programmed for 15 min at 95 °C. The cycle profiles were programed as follows: 1 min at 94 °C (denaturation), 1 min at 55 °C (annealing), and 1 min at 72 °C (extension). Forty cycles of the profile were run, and PCR products were visualized by 2% agarose gel electrophoresis.

Quantitative RT-PCR for ghrelin mRNA

RNA extraction and cDNA synthesis were performed as described above. The following primers were designed to amplify a rat ghrelin fragment (191 bp; accession no. AB029433 [GenBank] ): sense primer, CAGGTTCCAGCTTCTTGA; antisense primer, GACAGCTTGATGCCAACA. Real-time quantitative PCR was performed using SYBR Premix Ex Taq (TakaraBIO, Shiga, Japan) according to the manufacturer’s instructions. Amplification reactions were performed using a LightCycler (Roche Diagnostics). Initial template denaturation was performed for 30 s at 95 °C. The cycle profiles were programed as follows: 5 s at 95 °C (denaturation) and 15 s at 60 °C (annealing and extension). Forty-five cycles of the profile were run and the final cooling step was continued for 30 s at 40 °C. Quantitative measurement of each mRNA was achieved by establishing a linear amplification curve from serial dilutions of each plasmid containing the amplicon sequence. Amplicon size and specificity were confirmed by melting curve analysis and 2% agarose gel electrophoresis.

Ghrelin C-RIA

Ghrelin concentrations were determined by a double-antibody RIA using rabbit anti-ghrelin serum (# 107, a kind gift from Dr Kangawa). The production and specificityof the anti-rat ghrelin serum used in this study were previously reported (Hosoda et al. 2000), and it is known that this antiserum recognizes the C-terminal region of rat ghrelin. Ghrelin C-RIA was performed basically according to the previously reported procedure (Hosoda et al. 2000). Two hundred microliters RIA-buffer (0.05 M Na2HPO4.12H2O, 0.08 M NaCl, 0.025 M EDTA.2Na, 0.05% NaN3, 0.5% skim milk) and 100 µl rabbit anti-rat ghrelin serum (1:3000 dilution in RIA buffer) was added to each tube. Then 100 µl 125I-ratGhrelin was added to each assay tube. After incubation for 24 h at 4 °C, 1000 µl goat anti-rabbit IgG serum (1:50 dilution in RIA buffer containing 10% PEG2000) was added to each tube. Then the precipitates were separated by centrifugation (3000 r.p.m., 15 min, 4 °C) and the radioactivities were counted using a gamma-counter (Auto-Gamma Counting Systems; PACK-ARD Instrument Co., Meriden, CT, USA). Each sample was assayed, and a standard curve was obtained from measurements in duplicate.

Statistical analysis

Statistical analysis was performed using Fisher’s protected least significant difference test with Stat View statistics software (SAS Institute, Cary, NC, USA). P < 0.05 was considered statistically significant. Values were given as mean ± S.E.M.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Preparation of ghrelin-rich cells and analysis of ER{alpha} and aromatase mRNA expression in isolated stomach cells

To study the direct effect of estrogen on ghrelin cells, we first established a procedure for obtaining a ghrelin cell-rich fraction from dispersed gastric mucosal cells. Immunocytochemical analysis showed that ghrelin-ip cells, which were detected using an antibody recognizing acylated-type ghrelin, were found in the ghrelin cell-rich fraction (Fig. 1Go). The percentage of ghrelin-ip cells in the primary digested cell fraction (approximately 3–5%) was increased by the Percoll procedure (10–15%). RT-PCR analysis clearly demonstrated that these isolated cell populations as well as whole stomach tissue express ER{alpha} and aromatase mRNA (Fig. 2Go).


Figure 1
View larger version (73K):
[in this window]
[in a new window]
 
Figure 1 Microphotograph of ghrelin-immunopositive (ghrelin-ip) cells in the ghrelin-rich cell fraction. Numerous ghrelin-ip cells (arrows) were found in this fraction. The percentage of ghrelin-ip cells in total isolated stomach cells was 10–15%. Some of the immuno-negative cells are indicated by arrowheads. Scale bar = 100 µm.

 

Figure 2
View larger version (19K):
[in this window]
[in a new window]
 
Figure 2 Reverse transcriptase-PCR analysis of estrogen receptor {alpha} (ER{alpha}) and aromatase mRNA expression. Both ER{alpha} and aromatase mRNA were expressed in the stomach and isolated cells. (1, 4) Whole stomach tissue; (2, 5) ghrelin-rich isolated cell fraction; (3, 6) water.

 
Effect of estrogen on isolated female rat stomach cells

Using immunohistochemistry, we previously demonstrated that ER{alpha} immunoreactivity colocalized in ghrelin cells (Matsubara et al. 2004). To elucidate the direct effect of estrogen on ghrelin cells, we investigated whether estrogen increases ghrelin mRNA expression and production in isolated stomach cells. Quantitative real-time RT-PCR showed that ghrelin mRNA levels were significantly increased by estrogen treatment in a dose-dependent manner (10–5 and 10–7 M; Fig. 3AGo). Moreover, ghrelin concentration in the medium was also elevated by estrogen treatment (Fig. 3BGo).


Figure 3
View larger version (11K):
[in this window]
[in a new window]
 
Figure 3 Effect of 17ß-estradiol (E2) treatment on ghrelin mRNA expression and peptide production in isolated stomach cells. (A) Changes in ghrelin mRNA expression after E2 treatment. (B) Changes in ghrelin concentration in the media. Both ghrelin mRNA expression and peptide production were significantly increased by E2 administration in a dose-dependent manner. Values are mean ± S.E.M. of four individual dishes. Significant differences compared with control values (P < 0.05) are expressed by an asterisk (*).

 
Treatment with ER antagonist and an aromatase inhibitor

Pretreatment with ICI-182 780, an ER antagonist, significantly inhibited the effect of ghrelin mRNA production by estrogen in the minced stomach tissue (Fig. 4AGo). It has been reported that estrogen is produced in gastric parietal cells as well as in the ovary (Ueyama et al. 2002). Moreover, the results of a previous study (Ueyama et al. 2002) and our results demonstrated that estrogen synthetase, aromatase, is present in rat gastric mucosal cells. Therefore, we analyzed ghrelin gene expression in stomach tissue culture after treatment with formestane, an aromatase inhibitor, for 8 h and found that ghrelin mRNA expression level was significantly decreased compared to that in the control group (Fig. 4BGo). We also found that formestane treatment of minced gastric tissue from male rats significantly suppressed ghrelin mRNA expression (Fig. 4CGo). No difference was found between ß-actin mRNA levels in the aromatase inhibitor and vehicle groups (data not shown).


Figure 4
View larger version (9K):
[in this window]
[in a new window]
 
Figure 4 Effects of ER antagonist and aromatase inhibitor on ghrelin mRNA expression. (A) Effect of an ER antagonist, ICI-182 780, on ghrelin mRNA expression in stomach cells isolated from female rats. ICI-182 780 completely abolished the effect of E2 treatment. (B) Effect of formestane, an aromatase inhibitor, on ghrelin mRNA expression in minced stomach tissue from female rats. Treatment with formestane significantly decreased ghrelin mRNA expression in the stomach. (C) Effect of an aromatase inhibitor, formestane, on ghrelin mRNA expression in the minced stomach tissue from male rats. Treatment with formestane significantly decreased ghrelin mRNA expression as was found in tissue from female rats. Values are mean ± S.E.M. of four individual dishes. Significant differences compared with control values (P < 0.05) are expressed by an asterisk (*).

 
Stomach ghrelin mRNA expression and plasma ghrelin concentration in gonadectomized rats

Ovariectomized (OVX) female rats were used to study the involvement of ovarian estrogen in gastric ghrelin expression. Stomachs and blood were collected 3 weeks after OVX surgery. Ghrelin mRNA expression and plasma ghrelin concentration in the OVX rats were not different from those in the sham-operated rats (Fig. 5A and BGo). As this was found in female rats, ghrelin mRNA expression levels in male rats were not different in sham and CAST groups, and plasma concentration of ghrelin also did not change in the CAST group (Fig. 5C and DGo).


Figure 5
View larger version (13K):
[in this window]
[in a new window]
 
Figure 5 Changes in ghrelin mRNA levels and plasma ghrelin levels in gonadectomized rats. (A) Gastric ghrelin mRNA levels determined by real-time quantitative PCR in the ovariectomized (OVX) female rat. (B) Plasma ghrelin concentration determined by C-RIA. Neither ghrelin mRNA level in the stomach nor plasma ghrelin concentration changed after OVX. (C) Gastric ghrelin mRNA levels determined by real-time quantitative PCR in the castrated (CAST) male rat. (D) Plasma ghrelin concentration determined by C-RIA. Neither ghrelin mRNA level in the stomach nor plasma ghrelin concentration changed after CAST. Data are presented as mean ± S.E.M. n = 4–5/group. Significant differences compared with control values (P < 0.05) are expressed by an asterisk (*).

 
Localization of ghrelin-immunopositive cells and aromatase mRNA-expressing cells

Many aromatase mRNA-expressing cells detected by in situ hybridization were found in the glandular body of the fundic gland (Fig. 6AGo). As previously reported, ghrelin-ip cells were scattered throughout the gastric mucosa (Fig. 6BGo). Aromatase mRNA-expressing cells in both male and female rats were found to be located close to ghrelin cells, and sometimes these cells were found to be in contact with each other (Fig. 6C and DGo).


Figure 6
View larger version (81K):
[in this window]
[in a new window]
 
Figure 6 Double staining of ghrelin-ip and aromatase mRNA-expressing cells. Most aromatase mRNA-expressing cells were found in the glandular body of the fundic gland. (A, inset) No signals were found in the negative control section (sense probe). (B) Ghrelin-ip cells were found sporadically throughout the gastric mucosa. (C) and (D) Localization of aromatase cells (bright field) and ghrelin cells (dark field). Aromatase mRNA-expressing cells (arrows) and ghrelin-ip cells (arrowheads) were localized close together. Several cells were found to be in contact with each other. (C) Female stomach. (D) Male stomach. Scale bar = (A, A inset, B) 100 µm and (C) and (D) 50 µm. MU, mucosa; SL, smooth muscle layer.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, using Percoll gradient centrifugation, we successfully established a method for obtaining ghrelin cell-rich fraction (10–15% ghrelin-ip cells). This fraction is useful for evaluation of the direct effects of various stimulatory or inhibitory factors. We found that estrogen treatment significantly stimulated ghrelin mRNA expression and ghrelin production in a dose-dependent manner and that ICI-182 780, a pure ER antagonist, abolished the stimulatory effect of estrogen, indicating that estrogen works on ghrelin gene expression through the ER. In a previous study, we demonstrated that ghrelin cells have an ER{alpha} (Matsubara et al. 2004). In addition, Kishimoto et al.(2003) cloned and analyzed the 5'-flanking promoter region of the human ghrelin gene and reported the existence of two half-site estrogen response elements (half ERE). Taken together, our results suggest that estrogen directly acts on and induces ghrelin mRNA expression via the ER.

Ueyama et al.(2002) demonstrated that parietal cells in the gastric mucosa produce and secrete a substantial amount of estrogen and that inhibition of aromatase activity by treatment with formestane resulted in a decrease in the production of gastric estrogen. We hypothesized that estrogen produced in the stomach directly regulates ghrelin gene transcription in a physiological state, and we demonstrated that aromatase mRNA is expressed in the stomach and that formestane treatment significantly decreased ghrelin mRNA level in vitro. These results indicate that gastric estrogen is the key regulator of ghrelin mRNA expression. On the other hand, ghrelin mRNA expression and production did not change in 3 weeks in gonadectomized rats. The fact that plasma estrogen concentrations are very low in this condition suggests that ghrelin mRNA transcription is regulated by stomach estrogen but not by gonadal estrogen, which is thought to be a source of circulating estrogen. Ueyama et al.(2004) studied the main steroidogenic pathway in rat stomach and showed that the rat stomach is incapable of producing pregnenolone and progesterone, suggesting that stomach estrogen is synthesized from circulating progesterone or testosterone. To our knowledge, the source of supply of estrogen precursor is considered to be the gonads or adrenal gland. Indeed, a previous study showed that plasma progesterone levels in OVX rats were lower than the levels in sham-operated rats (Lu & Judd 1982). However, the present study showed that gastric ghrelin expression did not change in OVX rats, indicating that even a decreased level of plasma estrogen precursor in OVX rats is sufficient for producing a physiologically effective amount of estrogen in the stomach. In addition, it has been shown that the amount of circulating estrogen precursors was much greater than that of estrogen concentrations (Lu & Judd 1982), and a decreased serum concentration of estrogen precursor after gonadectomy (approximately 7 ng/ml) may produce a sufficient amount of estrogen in the stomach (Lu & Judd 1982) because progesterone concentration in a physiological state was shown a small step down (approximately 2 ng/ml) in the portal vein close to the liver compared to that of artery (Ueyama et al. 2004). Taken together, these results suggest that the amount of estrogen precursor in blood as the sourceof gastric estrogenunder physiological conditionsis very large. Ueyama et al.(2004) also showed a significant increase in estrogen concentration in the portal vein compared with that in the artery, suggesting that the amount of estrogen produced in the stomach is much greater than that of plasma estrogen concentration. In addition, as mentioned above, two half ERE exist in the human ghrelin gene, and it has been reported that a half-site of the ERE palindrome exhibited lower ER-binding affinity and transcriptional activity (Klinge et al. 2001, Martini & Katzenellenbogen 2001), suggesting that a relatively high concentration of estrogen may be needed to induce gastric ghrelin mRNA expression. Moreover, we revealed that ghrelin cells and aromatase-expressing cells in the gastric mucosa were localized close together, suggesting that ghrelin cells are exposed to estrogen. Therefore, gastric ghrelin cells may be exposed to a higher concentration of gastric estrogen than that of plasma estrogen. Kellokoski et al.(2005) reported that peroral estrogen treatment, but not transdermal estrogen treatment, increased plasma ghrelin levels, suggesting that a direct effect and high levels of estrogen treatment is essential for an increase in stomach ghrelin expression. This may be the reason why gastric ghrelin mRNA expression and plasma ghrelin concentration did not change after gonadectomy. In our previous study, we found a significant increase in the stomach ghrelin expression level 3 days after ovariectomy (Matsubara et al. 2004). Considering this increased level rapidly returned to basal level, the decrease in negative feedback provoked by ovariectomy may cause the transient increase in ghrelin expression.

It has been reported that many physiological states or factors regulate gastric ghrelin expression. Moreover, significant sexual dimorphic differences were found in plasma ghrelin levels in humans and mice (Akamizu et al. 2005, Shaw et al. 2005) and in the numbers of ghrelin-ip and -ex cells in the neonatal rat stomach (Sakata et al. 2002b). Although there is no information on the relationship between gastric estrogen level and physiological conditions, studies on the regulatory mechanisms of estrogen produced in the stomach under various physiological conditions may be essential for understanding ghrelin regulation. In addition to aromatase, it has been reported that other steroidogenic enzymes, 17{alpha}-hydroxylase/17,20-lyase (P450 17{alpha}) and 17ß-hydroxysteroid dehydrogenase type III, were detected in the gastric mucosa (Ueyama et al. 2004). Therefore, it would also be interesting to investigate the rate-limiting process of gastric estrogen by these enzymes in various physiological states.

In conclusion, we demonstrated for the first time that estrogen in the stomach upregulates ghrelin mRNA expression in the rat stomach. The results of this study provide a new insight into ghrelin gene regulation and may contribute to the establishment of strategies for controlling plasma or gastric ghrelin levels in some disease cases.


    Acknowledgements
 
This work was supported in part by grants for research fellowships from the Japan Society for the Promotion of Science for Young Scientists. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ackerman GE, Smith ME, Mendelson CR, MacDonald PC & Simpson ER 1981 Aromatization of androstenedione by human adipose tissue stromal cells in monolayer culture. Journal of Clinical Endocrinology and Metabolism 53 412–417.[Abstract/Free Full Text]

Akamizu T, Shinomiya T, Irako T, Fukunaga M, Nakai Y, Nakai Y & Kangawa K 2005 Separate measurement of plasma levels of acylated and desacyl ghrelin in healthy subjects using a new direct ELISA assay. Journal of Clinical Endocrinology and Metabolism 90 6–9.[Abstract/Free Full Text]

Ariyasu H, Takaya K, Tagami T, Ogawa Y, Hosoda K, Akamizu T, Suda M, Koh T, Natsui K, Toyooka S et al. 2001 Stomach is a major source of circulating ghrelin, and feeding state determines plasma ghrelin-like immunoreactivity levels in humans. Journal of Clinical Endocrinology and Metabolism 86 4753–4758.[Abstract/Free Full Text]

Asakawa A, Inui A, Kaga T, Yuzuriha H, Nagata T, Ueno N, Makino S, Fujimiya M, Niijima A, Fujino MA et al. 2001 Ghrelin is an appetite-stimulatory signal from stomach with structural resemblance to motilin. Gastroenterology 120 337–345.[CrossRef][Web of Science][Medline]

Bagnasco M, Kalra PS & Kalra SP 2002 Ghrelin and leptin pulse discharge in fed and fasted rats. Endocrinology 143 726–729.[Abstract]

Brodie A & Inkster S 1993 Aromatase in the human testis. Journal of Steroid Biochemistry and Molecular Biology 44 549–555.[CrossRef][Web of Science][Medline]

Campbell-Thompson M, Reyher KK & Wilkinson LB 2001 Immunolocalization of estrogen receptor alpha and beta in gastric epithelium and enteric neurons. Journal of Endocrinology 171 65–73.[Abstract]

Chanoine JP & Wong AC 2004 Ghrelin gene expression is markedly higher in fetal pancreas compared with fetal stomach: effect of maternal fasting. Endocrinology 145 3813–3820.[Abstract/Free Full Text]

Date Y, Murakami N, Toshinai K, Matsukura S, Niijima A, Matsuo H, Kangawa K & Nakazato M 2002 The role of the gastric afferent vagal nerve in ghrelin-induced feeding and growth hormone secretion in rats. Gastroenterology 123 1120–1128.[CrossRef][Web of Science][Medline]

Harada N & Yamada K 1992 Ontogeny of aromatase messenger ribonucleic acid in mouse brain: fluorometrical quantitation by polymerase chain reaction. Endocrinology 131 2306–2312.[Abstract/Free Full Text]

Hashizume T, Horiuchi M, Tate N, Nonaka S, Kojima M, Hosoda H & Kangawa K 2003 Effects of ghrelin on growth hormone secretion from cultured adenohypophysial cells in cattle. Endocrine Journal 50 289–295.[CrossRef][Web of Science][Medline]

Hosoda H, Kojima M, Matsuo H & Kangawa K 2000 Ghrelin and des-acyl ghrelin: two major forms of rat ghrelin peptide in gastrointestinal tissue. Biochemical and Biophysical Research Communications 279 909–913.[CrossRef][Web of Science][Medline]

Kamegai J, Tamura H, Shimizu T, Ishii S, Sugihara H & Oikawa S 2004 Effects of insulin, leptin, and glucagon on ghrelin secretion from isolated perfused rat stomach. Regulatory Peptides 119 77–81.[CrossRef][Web of Science][Medline]

Kellokoski E, Poykko SM, Karjalainen AH, Ukkola O, Heikkinen J, Kesaniemi YA & Horkko S 2005 Estrogen replacement therapy increases plasma ghrelin levels. Journal of Clinical Endocrinology and Metabolism 90 2954–2963.[Abstract/Free Full Text]

Kishimoto M, Okimura Y, Nakata H, Kudo T, Iguchi G, Takahashi Y, Kaji H & Chihara K 2003 Cloning and characterization of the 5(')-flanking region of the human ghrelin gene. Biochemical and Biophysical Research Communications 305 186–192.[CrossRef][Web of Science][Medline]

Klinge CM, Jernigan SC, Smith SL, Tyulmenkov VV & Kulakosky PC 2001 Estrogen response element sequence impacts the conformation and transcriptional activity of estrogen receptor. Molecular and Cellular Endocrinology 174 151–166.[CrossRef][Web of Science][Medline]

Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H & Kangawa K 1999 Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402 656–660.[CrossRef][Medline]

Lephart ED 1996 A review of brain aromatase cytochrome P450. Brain Research Reviews 22 1–26.[CrossRef][Medline]

Lippl F, Kircher F, Erdmann J, Allescher HD & Schusdziarra V 2004 Effect of GIP, GLP-1, insulin and gastrin on ghrelin release in the isolated rat stomach. Regulatory Peptides 119 93–98.[CrossRef][Web of Science][Medline]

Lu JK & Judd HL 1982 Silastic implants of progesterone produce high circulating levels of both progesterone and 20 alpha-hydroxyprogesterone in ovariectomized, adrenalectomized rats. Biology of Reproduction 26 385–390.[Abstract]

Malagon MM, Luque RM, Ruiz-Guerrero E, Rodriguez-Pacheco F, Garcia-Navarro S, Casanueva FF, Gracia-Navarro F & Castano JP 2003 Intracellular signaling mechanisms mediating ghrelin-stimulated growth hormone release in somatotropes. Endocrinology 144 5372–5380.[Abstract/Free Full Text]

Martini PG & Katzenellenbogen BS 2001 Regulation of prothymosin alpha gene expression by estrogen in estrogen receptor-containing breast cancer cells via upstream half-palindromic estrogen response element motifs. Endocrinology 142 3493–5501.[Abstract/Free Full Text]

Matsubara M, Sakata I, Wada R, Yamazaki M, Inoue K & Sakai T 2004 Estrogen modulates ghrelin expression in the female rat stomach. Peptides 25 289–297.[CrossRef][Web of Science][Medline]

Nelson LR & Bulun SE 2001 Estrogen production and action. Journal of the American Academy of Dermatology 45 S116–S124.[CrossRef][Web of Science][Medline]

Sakata I, Nakamura K, Yamazaki M, Matsubara M, Hayashi Y, Kangawa K & Sakai T 2002a Ghrelin-producing cells exist as two types of cells, closed-and opened-type cells, in the rat gastrointestinal tract. Peptides 23 531–536.[CrossRef][Web of Science][Medline]

Sakata I, Tanaka T, Matsubara M, Yamazaki M, Tani S, Hayashi Y, Kangawa K & Sakai T 2002b Postnatal changes in ghrelin mRNA expression and in ghrelin-producing cells in the rat stomach. Journal of Endocrinology 174 463–471.[Abstract]

Sakata I, Yamazaki M, Inoue K, Hayashi Y, Kangawa K & Sakai T 2003 Growth hormone secretagogue receptor expression in the cells of the stomach-projected afferent nerve in the rat nodose ganglion. Neuroscience Letters 342 183–186.[CrossRef][Web of Science][Medline]

Sanchez J, Oliver P, Palou A & Pico C 2004 The inhibition of gastric ghrelin production by food intake in rats is dependent on the type of macronutrient. Endocrinology 145 5049–5055.[CrossRef][Web of Science][Medline]

Shaw AM, Irani BG, Moore MC, Haskell-Luevano C & Millard WJ 2005 Ghrelin-induced food intake and growth hormone secretion are altered in melanocortin 3 and 4 receptor knockout mice. Peptides 26 1720–1727.[CrossRef][Web of Science][Medline]

Shimada M, Date Y, Mondal MS, Toshinai K, Shimbara T, Fukunaga K, Murakami N, Miyazato M, Kangawa K, Yoshimatsu H et al. 2003 Somatostatin suppresses ghrelin secretion from the rat stomach. Biochemical and Biophysical Research Communications 302 520–525.[CrossRef][Web of Science][Medline]

Shintani M, Ogawa Y, Ebihara K, Aizawa-Abe M, Miyanaga F, Takaya K, Hayashi T, Inoue G, Hosoda K, Kojima M et al. 2001 Ghrelin, an endogenous growth hormone secretagogue, is a novel orexigenic peptide that antagonizes leptin action through the activation of hypothalamic neuropeptide Y/Y1 receptor pathway. Diabetes 50 227–232.[Abstract/Free Full Text]

Singh S, Poulsom R, Wright NA, Sheppard MC & Langman MJ 1997 Differential expression of oestrogen receptor and oestrogen inducible genes in gastric mucosa and cancer. Gut 40 516–520.[Abstract/Free Full Text]

Toshinai K, Mondal MS, Nakazato M, Date Y, Murakami N, Kojima M, Kangawa K & Matsukura S 2001 Upregulation of ghrelin expression in the stomach upon fasting, insulin-induced hypoglycemia, and leptin administration. Biochemical and Biophysical Research Communications 281 1220–1225.[CrossRef][Web of Science][Medline]

Tschop M, Smiley DL & Heiman ML 2000 Ghrelin induces adiposity in rodents. Nature 407 908–913.[CrossRef][Medline]

Tschop M, Weyer C, Tataranni PA, Devanarayan V, Ravussin E & Heiman ML 2001 Circulating ghrelin levels are decreased in human obesity. Diabetes 50 707–709.[Abstract/Free Full Text]

Ueyama T, Shirasawa N, Numazawa M, Yamada K, Shelangouski M, Ito T & Tsuruo Y 2002 Gastric parietal cells: potent endocrine role in secreting estrogen as a possible regulator of gastro-hepatic axis. Endocrinology 143 3162–3170.[Abstract/Free Full Text]

Ueyama T, Shirasawa N, Ito T & Tsuruo Y 2004 Estrogen-producing steroidogenic pathways in parietal cells of the rat gastric mucosa. Life Science 74 2327–2337.[CrossRef][Web of Science][Medline]

Wren AM, Small CJ, Ward HL, Murphy KG, Dakin CL, Taheri S, Kennedy AR, Roberts GH, Morgan DG, Ghatei MA et al. 2000 The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 141 4325–4328.[Abstract/Free Full Text]

Wren AM, Small CJ, Abbott CR, Dhillo WS, Seal LJ, Cohen MA, Batterham RL, Taheri S, Stanley SA, Ghatei MA et al. 2001 Ghrelin causes hyperphagia and obesity in rats. Diabetes 50 2540–2547.[Abstract/Free Full Text]

Yamazaki M, Nakamura K, Kobayashi H, Matsubara M, Hayashi Y, Kangawa K & Sakai T 2002 Regulational effect of ghrelin on growth hormone secretion from perifused rat anterior pituitary cells. Journal of Neuroendocrinology 14 156–162.[CrossRef][Web of Science][Medline]

Received in final form 27 April 2006
Accepted 12 May 2006
Made available online as an Accepted Preprint 12 June 2006




This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
I. Sakata, J. Yang, C. E. Lee, S. Osborne-Lawrence, S. A. Rovinsky, J. K. Elmquist, and J. M. Zigman
Colocalization of ghrelin O-acyltransferase and ghrelin in gastric mucosal cells
Am J Physiol Endocrinol Metab, July 1, 2009; 297(1): E134 - E141.
[Abstract] [Full Text] [PDF]


Home page
Acta Biochim Biophys SinHome page
X. Yin, Y. Li, G. Xu, W. An, and W. Zhang
Ghrelin fluctuation, what determines its production?
Acta Biochim Biophys Sin, March 1, 2009; 41(3): 188 - 197.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. C. Paulo, R. Brundage, M. Cosma, K. L. Mielke, C. Y. Bowers, and J. D. Veldhuis
Estrogen Elevates the Peak Overnight Production Rate of Acylated Ghrelin
J. Clin. Endocrinol. Metab., November 1, 2008; 93(11): 4440 - 4447.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
Z. Zhao, I. Sakata, Y. Okubo, K. Koike, K. Kangawa, and T. Sakai
Gastric leptin, but not estrogen and somatostatin, contributes to the elevation of ghrelin mRNA expression level in fasted rats
J. Endocrinol., March 1, 2008; 196(3): 529 - 538.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakata, I.
Right arrow Articles by Sakai, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakata, I.
Right arrow Articles by Sakai, T.


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS