JOE Society for Endocrinology Archive
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2006) 189, 665-670       DOI: 10.1677/joe.1.06645
© 2006 Society for Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kralisch, S
Right arrow Articles by Fasshauer, M
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kralisch, S
Right arrow Articles by Fasshauer, M

Tissue inhibitor of metalloproteinase 1 expression and secretion are induced by ß-adrenergic stimulation in 3T3-L1 adipocytes

S Kralisch, U Lossner, M Bluher, R Paschke, M Stumvoll and M Fasshauer

University of Leipzig, Department of Internal Medicine III, Ph-Rosenthal-Str. 27, 04103 Leipzig, Germany

(Requests for offprints should be addressed to M Fasshauer; Email: mathias.fasshauer{at}medizin.uni-leipzig.de)


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissue inhibitor of metalloproteinase (TIMP)-1 is an adipocytokine upregulated in obesity which might promote adipose tissue development. In the current study, the impact of the ß-adrenergic agonist isoproterenol on TIMP-1 gene expression and secretion was determined in 3T3-L1 adipocytes. Interestingly, isoproterenol increased TIMP-1 secretion 2.7-fold. Furthermore, isoproterenol induced TIMP-1 mRNA in a time- and dose-dependent fashion with significant effects observed as early as 1 h after effector addition and at concentrations as low as 1 µM isoproterenol. Significant isoproterenol-induced upregulation of TIMP-1 mRNA could also be found in immortalized brown adipocytes. Inhibitor experiments confirmed that the positive effect of isoproterenol on TIMP-1 is mediated via ß-adrenergic receptors and protein kinase A. Moreover, increasing cAMP levels with forskolin or dibutyryl-cAMP was sufficient to stimulate TIMP-1 synthesis. Insulin induced basal TIMP-1 mRNA, but did not significantly influence forskolin-induced TIMP-1 expression. Taken together, we demonstrate that TIMP-1 expression and secretion are selectively upregulated in adipocytes by ß-adrenergic agonists via a classic Gs-protein-coupled pathway.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Obesity is a rapidly growing nutritional disorder in industrialized countries and is associated with insulin resistance, hypertension and dyslipidemia (Kahn & Flier 2000). When weight is gained, excessive accumulation of adipose tissue, with both hyperplasia and hypertrophy of fat cells, can be found (Kahn & Flier 2000). Furthermore, neovascularization is critical to maintain the proper function of expanding adipose tissue (Crandall et al. 1997). These dynamic processes depend on changes of cell–matrix interactions and extensive extracellular matrix (ECM) remodeling (Beaudeux et al. 2004). It has been suggested recently that several matrix metalloproteinases (MMPs) and tissue inhibitors of MMPs (TIMPs) mediate ECM remodeling (Beaudeux et al. 2004). MMPs consist of 20 neutral endopeptidases which can cleave ECM and non-ECM proteins, including cytokines, adhesion molecules and proteinase inhibitors (Beaudeux et al. 2004). In addition, TIMPs comprise a family of four members, which are able to inhibit MMP activity (Beaudeux et al. 2004).

The possible contribution of MMP and TIMP family members to obesity-related adipose tissue enlargement has been better elucidated in recent years, especially in rodents. Among them, TIMP-1 might be an interesting adipose-secreted candidate promoting fat accumulation in vivo and in vitro. Thus, two independent studies showed significant upregulation of adipose tissue TIMP-1 in obese as compared with lean mice (Maquoi et al. 2002, Chavey et al. 2003). Furthermore, transgenic overexpression of TIMP-1 increased the rate of adipocyte differentiation in rodents in vivo (Alexander et al. 2001). Most interestingly, a direct effect of TIMP-1 on 3T3-L1 cell differentiation could be demonstrated in vitro (Alexander et al. 2001). Thus, recombinant TIMP-1 dramatically accelerated lipid accumulation during differentiation in these cells (Alexander et al. 2001). Moreover, TIMP-1-deficient mice were protected from nutritionally induced obesity (Lijnen et al. 2003). Taking these studies into account, TIMP-1 might be a novel fat-derived protein promoting adipose tissue development when weight is gained.

Growing evidence suggests that obesity is associated with increased activity of the sympathetic nervous system (Facchini et al. 1996, Reaven et al. 1996, Hoieggen et al. 2000, Maison et al. 2000). Furthermore, increased catecholamine levels in overweight humans have been linked to obesity-associated insulin resistance and hypertension (Facchini et al. 1996, Reaven et al. 1996, Hoieggen et al. 2000, Maison et al. 2000). However, it is unknown whether catecholamines might impact on TIMP-1 expression. In the current study, we therefore examined the effect of the ß-adrenergic agonist isoproterenol on TIMP-1 synthesis in 3T3-L1 adipocytes in vitro. We demonstrate for the first time that isoproterenol induces TIMP-1 gene expression and secretion. Furthermore, we show that this stimulatory effect is mediated via ß-adrenergic receptors, protein kinase A (PKA) and adenylyl cyclase.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

Oligonucleotides were purchased from MWG-Biotech (Ebersberg, Germany), cell culture reagents were from Life Technologies, Inc. Dexamethasone, dibutyryl-cAMP, forskolin, H89, insulin, isobutylmethylxanthine, isoproterenol, phentolamine and propranolol were obtained from Sigma Chemical Co.

Culture and differentiation of 3T3-L1 cells and immortalized brown preadipocytes

3T3-L1 cells (American Type Culture Collection, Rockville, MD, USA) and immortalized brown preadipocytes (Fasshauer et al. 2000) were differentiated as described (Kralisch et al. 2005a). Briefly, confluent preadipocytes were grown for 3 days in DMEM containing 25 mM glucose (DMEM-H), 10% fetal bovine serum and antibiotics (culture medium) further supplemented with 1 µM insulin, 0.5 mM isobutylmethylxanthine and 0.1 µM dexamethasone. Then, the cells were cultured for 3 days in culture medium with 1 µM insulin and for 3–6 more days in culture medium. Effectors were added to cells starved in DMEM-H for the indicated periods of time. At the time of the experiments at least 95% of the cells showed fat droplet accumulation.

Analysis of TIMP-1 secretion

TIMP-1 secretion into 3T3-L1 cell culture supernatants was quantified with a commercially available enzyme-linked immunoassay from RayBiotech Inc. (Norcross, GA, USA, USA) according to the manufacturer’s instructions.

Analysis of TIMP-1 and TIMP-2 mRNA

Expression of TIMP-1 and TIMP-2 mRNA was determined by quantitative real-time RT-PCR in a fluorescent temperature cycler (ABI Prism 7000; Applied Biosystems, Darmstadt, Germany) as described recently (Kralisch et al. 2005b). In brief, total RNA was isolated from 3T3-L1 adipocytes using TRIzol reagent (Life Technologies, Inc. One microgram of RNA was reverse transcribed using standard reagents (Life Technologies) and 2 µl of each RT reaction were amplified in a 26 µl PCR reaction using the following conditions: initial denaturation at 95 °C for 10 min followed by 40 PCR cycles consisting of 95 °C for 15 s, 60 °C for 1 min and 72 °C for 1 min. The following primer pairs were used for quantification: TIMP-1 (accession no. NM_011593 [GenBank] ) ctatagtgctggctgtggggtgtg (sense) and ttccgtggcaggcaagcaaagt (antisense); TIMP-2 (accession no. NM_011594 [GenBank] ) ggcctccctcccttactcc (sense) and gacttcatattccagcacgcacat (antisense); 36B4 (accession no. NM007475) aagcgcgtcctggcattgtct (sense) and ccgcagggg cagcagtggt (antisense). SYBR Green I fluorescence emissions were monitored after each cycle. TIMP-1, TIMP-2 and 36B4 mRNA were quantified using the second derivative maximum method of the ABI Prism 7000 software (Applied Biosystems), which determines the crossing points of individual samples by an algorithm identifying the first turning point of the fluorescence curve. TIMP-1 and TIMP-2 expression was calculated relative to 36B4, which was used as an internal control due to its resistance to hormonal regulation (Laborda 1991). Synthesis of specific transcripts was confirmed by melting curve profiles (cooling the sample to 68 °C and heating slowly to 95 °C with measurement of fluorescence) at the end of each PCR and by subjecting the amplification products to agarose gel electrophoresis. In each experiment and for each condition, RNA from one 6 cm plate was isolated and quantified for TIMP-1, TIMP-2 and 36B4 expression as indicated.

Statistical analysis

Results are shown as means ± S.E.M. Differences between various treatments were analyzed by unpaired Student’s t-tests. P values <0.01 were considered highly significant and <0.05 significant. The number of independent experiments performed for each condition is indicated in the Figure legends.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TIMP-1 secretion is stimulated by isoproterenol

TIMP-1 secretion into the medium was quantified in differentiated 3T3-L1 cells after 16 h of isoproterenol (10 µM) treatment. Interestingly, isoproterenol increased TIMP-1 protein in the cell culture supernatants from 28.3 ng/ml (basal) to 76.1 ng/ml (P<0.01) (Fig. 1Go).


Figure 1
View larger version (5K):
[in this window]
[in a new window]
 
Figure 1 TIMP-1 secretion is stimulated by isoproterenol. 3T3-L1 cells were serum-starved for 6 h before isoproterenol (Iso, 10 µM) was added for 16 h. After this period, TIMP-1 protein levels in the supernatants were determined as described in Materials and Methods. Data represent the means ± S.E.M. of three independent experiments. **P<0.01 comparing isoproterenol-treated with untreated control (Con) adipocytes.

 
TIMP-1 but not TIMP-2 mRNA is induced by isoproterenol

Next, we tested whether isoproterenol influences TIMP-1 mRNA synthesis in 3T3-L1 adipocytes. Interestingly, 10 µM isoproterenol induced TIMP-1 in a time-dependent fashion (Fig. 2Go). Thus, a significant 1.6-fold stimulation could be seen as early as 1 h after effector addition (P<0.05), maximal 6.3-fold upregulation was observed after 4 h (P<0.01), and activation persisted for up to 24 h (P<0.01) (Fig. 2Go). In contrast, TIMP-2 mRNA expression was not significantly altered by isoproterenol treatment (Fig. 2Go).


Figure 2
View larger version (9K):
[in this window]
[in a new window]
 
Figure 2 Isoproterenol stimulates TIMP-1 but not TIMP-2 mRNA time-dependently. After serum-deprivation overnight, 3T3-L1 adipocytes were treated with 10 µM isoproterenol for the indicated periods of time. Total RNA was extracted and subjected to quantitative real-time RT-PCR as described in Materials and Methods. TIMP-1 and TIMP-2 mRNA levels normalized to 36B4 expression were determined relative to untreated control cells (=100%). Data represent the means of three independent experiments. **P<0.01, *P<0.05 in TIMP-1 expression comparing isoproterenol-treated with control adipocytes.

 
Furthermore, isoproterenol induced TIMP-1 mRNA synthesis dose-dependently after 16 h of treatment (Fig. 3Go). Thus, a significantly greater than 10-fold stimulation was seen at concentrations as low as 1 µM isoproterenol (P<0.05) and maximal upregulation could be observed at 10 µM effector (P<0.01) (Fig. 3Go).


Figure 3
View larger version (7K):
[in this window]
[in a new window]
 
Figure 3 Isoproterenol stimulates TIMP-1 mRNA dose-dependently. Differentiated 3T3-L1 cells were serum-starved for 6 h before various concentrations of isoproterenol were added for 16 h. Extraction of total RNA and quantitative real-time RT-PCR determining TIMP-1 mRNA levels normalized to 36B4 expression were performed as described in Materials and Methods. Data are shown relative to untreated control (Con) cells (=100%) and represent the means ± S.E.M. of two independent experiments. **P<0.01, *P<0.05 comparing isoproterenol-treated with control cells.

 
ß-Adrenergic receptors and PKA mediate isoproterenol-induced TIMP-1

We determined which proteins implicated in isoproterenol signaling are potential mediators of its positive effect on TIMP-1. To this end, 3T3-L1 cells were pretreated with specific pharmacological inhibitors of ß-adrenergic receptors (propranolol, 100 µM), {alpha}-adrenergic receptors (phentolamine, 100 µM) and PKA (H89, 10 µM) for 1 h before isoproterenol (10 µM) was added for another 16 h. Treatment of 3T3-L1 fat cells with propranolol, phentolamine and H89 alone for 17 h did not significantly influence basal TIMP-1 expression (Fig. 4Go). Again, isoproterenol significantly stimulated TIMP-1 mRNA 4.1-fold (P<0.05) (Fig. 4Go). This induction was almost completely reversed by pretreatment with either propranolol or H89, to 106 and 112% of untreated control cells respectively (P<0.05) (Fig. 4Go). In contrast, phentolamine did not significantly alter isoproterenol-stimulated TIMP-1 synthesis (Fig. 4Go).


Figure 4
View larger version (10K):
[in this window]
[in a new window]
 
Figure 4 TIMP-1 induction by isoproterenol is mediated via ß-adrenergic receptors and PKA. After serum-starvation, 3T3-L1 adipocytes were cultured in the presence or absence of propranolol (Prop, 100 µM), phentolamine (Phen, 100 µM) or H89 (10 µM) for 1 h before isoproterenol (10 µM) was added for another 16 h. Total RNA was extracted and subjected to quantitative real-time RT-PCR to determine TIMP-1 normalized to 36B4 expression as described in Materials and Methods. Data are expressed relative to non-treated control (Con) cells (=100%) and represent the means ± S.E.M. of three independent experiments. *P<0.05 comparing isoproterenol-treated cells with inhibitor-pretreated or control adipocytes.

 
Elevation of cAMP levels is sufficient to induce TIMP-1

We determined whether a cellular increase in cAMP induced by the adenylyl cyclase stimulator forskolin or the stable cAMP analogue dibutyryl-cAMP would be sufficient to upregulate TIMP-1 mRNA. Again, addition of 10 µM isoproterenol for 16 h significantly induced TIMP-1 synthesis 5.8-fold (P<0.01) (Fig. 5Go). Treatment of 3T3-L1 adipocytes with 5 and 50 µM forskolin for 16 h significantly stimulated TIMP-1 mRNA expression 24.6-fold and 20.4-fold respectively (P<0.01) (Fig. 5Go). Similarly, dibutyryl-cAMP at 100 and 1000 ng/ml significantly induced TIMP-1 synthesis 2.9-fold and 21.2-fold respectively (P<0.05) (Fig. 5Go).


Figure 5
View larger version (9K):
[in this window]
[in a new window]
 
Figure 5 Elevation of cAMP levels is sufficient to induce TIMP-1 mRNA. After serum-starvation, 3T3-L1 cells were cultured in the presence or absence of isoproterenol (Iso, 10 µM), dibutyryl-cAMP (cAMP, 100 or 1000 ng/ml), or forskolin (For, 5 or 50 µM) for 16 h. Total RNA was extracted and subjected to quantitative real-time RT-PCR determining TIMP-1 normalized to 36B4 expression as described in Materials and Methods. Data are expressed relative to non-treated control (Con) cells (=100%) and represent the means ± S.E.M. of four independent experiments. **P<0.01, *P<0.05 comparing effector-treated with untreated adipocytes.

 
Insulin increases TIMP-1 mRNA but does not alter forskolin-induced TIMP-1

We tested whether insulin, which decreases intracellular cAMP levels, might influence basal and forskolin-induced TIMP-1 mRNA expression. Interestingly, insulin alone significantly increased TIMP-1 mRNA 3.8-fold (P<0.05) (Fig. 6Go). Again, forskolin significantly stimulated TIMP-1 synthesis 35.9-fold (P<0.01) (Fig. 6Go). This effect of forskolin on TIMP-1 mRNA was not significantly influenced by insulin co-treatment (Fig. 6Go).


Figure 6
View larger version (7K):
[in this window]
[in a new window]
 
Figure 6 Insulin induces basal TIMP-1 expression but does not influence forskolin-induced TIMP-1. After serum-starvation, 3T3-L1 cells were cultured in the presence or absence of 50 µM forskolin (For) and 100 nM insulin (Ins) for 16 h. Total RNA was extracted and subjected to quantitative real-time RT-PCR. TIMP-1 synthesis was normalized to 36B4 expression as described in Materials and Methods. Data are expressed relative to non-treated control (Con) cells (=100%) and represent the means ± S.E.M. of four independent experiments. **P<0.01, *P<0.05 comparing effector-treated with untreated adipocytes.

 
TIMP-1 is induced in brown adipocytes by isoproterenol

We tested whether isoproterenol’s effect on TIMP-1 mRNA is specific for 3T3-L1 adipocytes. For this purpose, differentiated immortalized brown adipocytes were treated with 10 µM isoproterenol for different periods of time. As shown in Fig. 7Go, isoproterenol time-dependently stimulated TIMP-1 mRNA expression with a significant 1.6-fold stimulation first seen after 4 h of effector addition and a maximal 1.7-fold upregulation observed after 8 h of treatment (P<0.01).


Figure 7
View larger version (7K):
[in this window]
[in a new window]
 
Figure 7 Isoproterenol stimulates TIMP-1 mRNA in brown adipocytes. After serum-deprivation overnight, brown adipocytes were treated with 10 µM isoproterenol for the indicated periods of time. Total RNA was extracted and subjected to quantitative real-time RT-PCR as described in Materials and Methods. TIMP-1 mRNA normalized to 36B4 was determined relative to untreated control cells (=100%). Data represent the means ± S.E.M. of three independent experiments. **P<0.01 comparing isoproterenol-treated with control adipocytes.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the current study, we demonstrate for the first time that TIMP-1 expression and secretion are significantly induced in 3T3-L1 adipocytes by isoproterenol in vitro. Furthermore, ß-adrenergic stimulation also induces TIMP-1 mRNA in brown adipocytes; however, the extent of induction is less pronounced as compared with 3T3-L1 fat cells. Besides ß-adrenergic agonists, the pro-inflammatory adipocytokines tumor necrosis factor-{alpha} and interleukin (IL)-6 also induce TIMP-1 synthesis in 3T3-L1 adipocytes in vitro (Kralisch et al. 2005c).

Since TIMP-1 deficiency protects from nutritionally induced obesity (Lijnen et al. 2003), whereas TIMP-1 overexpression accelerates adipocyte differentiation in vivo and in vitro (Alexander et al. 2001), this adipocytokine might actively maintain adipose tissue mass, at least in rodents. Potential mechanisms by which TIMP-1 promotes fat accumulation have been better elucidated. Thus, this adipocytokine has growth-promoting activity in a wide range of cells and appears as a novel serum growth factor (Hayakawa et al. 1992). Another independent study shows significant suppression of apoptosis in B cells after TIMP-1 treatment (Guedez et al. 1998). Furthermore, both studies suggest that the effects of TIMP-1 are not due to metalloproteinase inhibition and cannot be mimicked by another family member, TIMP-2 (Hayakawa et al. 1992, Guedez et al. 1998). These findings are of special interest, since pharmacological inhibition of MMPs, in contrast to TIMP-1 addition, leads to reduced adipogenesis in vitro and in vivo (Lijnen et al. 2002, Maquoi et al. 2002, Chavey et al. 2003, Demeulemeester et al. 2005). Taking these studies into consideration, TIMP-1 might maintain adipose tissue mass independently of MMP inhibition, possibly via increased proliferation and/or decreased apoptosis, at least in rodents. However, it has to be pointed out that data on potential pro-adipogenic effects of TIMP-1 in humans are not available so far. Clearly, additional work is needed to better understand the mechanisms by which TIMP-1 might promote fat accumulation.

In the current study, we present evidence that induction of TIMP-1 by isoproterenol can be almost completely reversed by ß-adrenergic blockade, as well as pharmacological PKA inhibition. In contrast, the {alpha}-adrenergic antagonist phentolamine is without any effect. Furthermore, stimulation of adenylyl cyclase with forskolin and elevation of cAMP levels with dibutyryl-cAMP are sufficient to mimic isoproterenol’s positive effect, i.e. an increase of TIMP-1 synthesis. These results are in accord with the classic view of isoproterenol activating GS-protein-coupled ß-adrenergic receptors leading to activation of adenylyl cyclase and PKA (Collins & Surwit 2001). Surprisingly, however, stimulation of 3T3-L1 adipocytes with forskolin or high concentrations of dibutyryl-cAMP increases TIMP-1 expression significantly more, as compared with isoproterenol. The reasons for this stronger effect are unclear and remain speculative. Thus, available intracellular cAMP levels in 3T3-L1 adipocytes might be higher after addition of forskolin or high concentrations of dibutyryl-cAMP as compared with isoproterenol. Alternatively, isoproterenol in contrast to forskolin and dibutyryl-cAMP might activate cAMP-independent pathways that negatively interact with the cAMP-dependent increase in TIMP-1 synthesis.

We show for the first time that insulin significantly upregulates TIMP-1 mRNA but does not influence forskolin-induced TIMP-1. These results suggest that insulin and forskolin induce TIMP-1 synthesis most probably via independent signaling pathways. Furthermore, reduction of intracellular cAMP concentrations by insulin does not appear to be sufficient to overcome forskolin’s stimulatory effect.

The current study extends previous data from our group demonstrating that various adipocytokines are regulated by ß-adrenergic activation in 3T3-L1 adipocytes. Thus, we have recently shown downregulation of resistin (Fasshauer et al. 2001b), adiponectin (Fasshauer et al. 2001a) and visfatin (Kralisch et al. 2005a), whereas IL-6 is induced by isoproterenol (Fasshauer et al. 2003).

Taken together, we demonstrate for the first time that TIMP-1 expression and secretion are selectively upregulated in fat cells by ß-adrenergic activation. Further studies are needed to more clearly define the mechanisms by which TIMP-1 might promote adipose tissue accumulation.


    Funding
 
This work was supported by a grant of the Deutsche Forschungsgemeinschaft (DFG, FA376/3–1) to M F and the Deutsche Diabetes Gesellschaft (DDG) to S K. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Alexander CM, Selvarajan S, Mudgett J & Werb Z 2001 Stromelysin-1 regulates adipogenesis during mammary gland involution. Journal of Cell Biology 152 693–703.[Abstract/Free Full Text]

Beaudeux JL, Giral P, Bruckert E, Foglietti MJ & Chapman MJ 2004 Matrix metalloproteinases, inflammation and atherosclerosis: therapeutic perspectives. Clinical and Chemical Laboratory Medicine 42 121–131.[CrossRef][Web of Science][Medline]

Chavey C, Mari B, Monthouel MN, Bonnafous S, Anglard P, Van Obberghen E & Tartare-Deckert S 2003 Matrix metalloproteinases are differentially expressed in adipose tissue during obesity and modulate adipocyte differentiation. Journal of Biological Chemistry 278 11888–11896.[Abstract/Free Full Text]

Collins S & Surwit RS 2001 The beta-adrenergic receptors and the control of adipose tissue metabolism and thermogenesis. Recent Progress in Hormone Research 56 309–328.[Abstract]

Crandall DL, Hausman GJ & Kral JG 1997 A review of the microcirculation of adipose tissue: anatomic, metabolic, and angiogenic perspectives. Microcirculation 4 211–232.[Web of Science][Medline]

Demeulemeester D, Collen D & Lijnen HR 2005 Effect of matrix metalloproteinase inhibition on adipose tissue development. Biochemical and Biophysical Research Communications 329 105–110.[CrossRef][Web of Science][Medline]

Facchini FS, Stoohs RA & Reaven GM 1996 Enhanced sympathetic nervous system activity. The linchpin between insulin resistance, hyperinsulinemia, and heart rate. American Journal of Hypertension 9 1013–1017.[CrossRef][Web of Science][Medline]

Fasshauer M, Klein J, Ueki K, Kriauciunas KM, Benito M, White MF & Kahn CR 2000 Essential role of insulin receptor substrate-2 in insulin stimulation of Glut4 translocation and glucose uptake in brown adipocytes. Journal of Biological Chemistry 275 25494–25501.[Abstract/Free Full Text]

Fasshauer M, Klein J, Neumann S, Eszlinger M & Paschke R 2001a Adiponectin gene expression is inhibited by beta-adrenergic stimulation via protein kinase A in 3T3-L1 adipocytes. FEBS Letters 507 142–146.[CrossRef][Web of Science][Medline]

Fasshauer M, Klein J, Neumann S, Eszlinger M & Paschke R 2001b Isoproterenol inhibits resistin gene expression through a G(S)-protein-coupled pathway in 3T3-L1 adipocytes. FEBS Letters 500 60–63.[CrossRef][Web of Science][Medline]

Fasshauer M, Klein J, Lossner U & Paschke R 2003 Interleukin (IL)-6 mRNA expression is stimulated by insulin, isoproterenol, tumour necrosis factor alpha, growth hormone, and IL-6 in 3T3-L1 adipocytes. Hormone and Metabolic Research 35 147–152.[CrossRef][Web of Science][Medline]

Guedez L, Stetler-Stevenson WG, Wolff L, Wang J, Fukushima P, Mansoor A & Stetler-Stevenson M 1998 In vitro suppression of programmed cell death of B cells by tissue inhibitor of metalloproteinases-1. Journal of Clinical Investigation 102 2002–2010.[Web of Science][Medline]

Hayakawa T, Yamashita K, Tanzawa K, Uchijima E & Iwata K 1992 Growth-promoting activity of tissue inhibitor of metalloproteinases-1 (TIMP-1) for a wide range of cells. A possible new growth factor in serum. FEBS Letters 298 29–32.[CrossRef][Web of Science][Medline]

Hoieggen A, Fossum E, Nesbitt SD, Palmieri V & Kjeldsen SE 2000 Blood viscosity, plasma adrenaline and fasting insulin in hypertensive patients with left ventricular hypertrophy. ICARUS, a LIFE Substudy. Insulin CARotids US Scandinavica. Blood Pressure 9 83–90.[CrossRef][Web of Science][Medline]

Kahn BB & Flier JS 2000 Obesity and insulin resistance. Journal of Clinical Investigation 106 473–481.[Web of Science][Medline]

Kralisch S, Klein J, Lossner U, Bluher M, Paschke R, Stumvoll M & Fasshauer M 2005a Hormonal regulation of the novel adipocytokine visfatin in 3T3-L1 adipocytes. Journal of Endocrinology 185 R1–R8.[Abstract/Free Full Text]

Kralisch S, Klein J, Lossner U, Bluher M, Paschke R, Stumvoll M & Fasshauer M 2005b Interleukin-6 is a negative regulator of visfatin gene expression in 3T3-L1 adipocytes. American Journal of Physiology. Endocrinology and Metabolism 289 E586–E590.[Abstract/Free Full Text]

Kralisch S, Klein J, Lossner U, Bluher M, Paschke R, Stumvoll M & Fasshauer M 2005c Proinflammatory adipocytokines induce TIMP-1 expression in 3T3-L1 adipocytes. FEBS Letters 579 6417–6422.[CrossRef][Web of Science][Medline]

Laborda J 1991 36B4 cDNA used as an estradiol-independent mRNA control is the cDNA for human acidic ribosomal phosphoprotein PO. Nucleic Acids Research 19 3998.[Free Full Text]

Lijnen HR, Maquoi E, Hansen LB, Van Hoef B, Frederix L & Collen D 2002 Matrix metalloproteinase inhibition impairs adipose tissue development in mice. Arteriosclerosis, Thrombosis, and Vascular Biology 22 374–379.[Abstract/Free Full Text]

Lijnen HR, Demeulemeester D, Van Hoef B, Collen D & Maquoi E 2003 Deficiency of tissue inhibitor of matrix metalloproteinase-1 (TIMP-1) impairs nutritionally induced obesity in mice. Thrombosis and Haemostasis 89 249–255.[Web of Science][Medline]

Maison P, Byrne CD, Hales CN & Wareham NJ 2000 Hypertension and its treatment influence changes in fasting nonesterified fatty acid concentrations: a link between the sympathetic nervous and the metabolic syndrome? Metabolism 49 81–87.[CrossRef][Web of Science][Medline]

Maquoi E, Munaut C, Colige A, Collen D & Lijnen HR 2002 Modulation of adipose tissue expression of murine matrix metalloproteinases and their tissue inhibitors with obesity. Diabetes 51 1093–1101.[Abstract/Free Full Text]

Reaven GM, Lithell H & Landsberg L 1996 Hypertension and associated metabolic abnormalities – the role of insulin resistance and the sympathoadrenal system. New England Journal of Medicine 334 374–381.[Free Full Text]

Received in final form 28 February 2006
Accepted 17 March 2006
Made available online as an Accepted Preprint 24 March 2006




This article has been cited by other articles:


Home page
J EndocrinolHome page
S. Weise, S. Kralisch, G. Sommer, U. Lossner, M. Bluher, M. Stumvoll, and M. Fasshauer
Tissue inhibitor of metalloproteinase-1 mRNA production and protein secretion are induced by interleukin-1{beta} in 3T3-L1 adipocytes
J. Endocrinol., July 1, 2008; 198(1): 169 - 174.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
L. Jensen, B. Sloth, I. Krog-Mikkelsen, A. Flint, A. Raben, T. Tholstrup, N. Brunner, and A. Astrup
A low-glycemic-index diet reduces plasma plasminogen activator inhibitor-1 activity, but not tissue inhibitor of proteinases-1 or plasminogen activator inhibitor-1 protein, in overweight women
Am. J. Clinical Nutrition, January 1, 2008; 87(1): 97 - 105.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
S. Kralisch, M. Bluher, A. Tonjes, U. Lossner, R. Paschke, M. Stumvoll, and M. Fasshauer
Tissue inhibitor of metalloproteinase-1 predicts adiposity in humans
Eur. J. Endocrinol., February 1, 2007; 156(2): 257 - 261.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kralisch, S
Right arrow Articles by Fasshauer, M
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kralisch, S
Right arrow Articles by Fasshauer, M


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS