|
|
||||||||
University of Leipzig, Department of Internal Medicine III, Ph-Rosenthal-Str. 27, 04103 Leipzig, Germany
(Requests for offprints should be addressed to M Fasshauer; Email: mathias.fasshauer{at}medizin.uni-leipzig.de)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The possible contribution of MMP and TIMP family members to obesity-related adipose tissue enlargement has been better elucidated in recent years, especially in rodents. Among them, TIMP-1 might be an interesting adipose-secreted candidate promoting fat accumulation in vivo and in vitro. Thus, two independent studies showed significant upregulation of adipose tissue TIMP-1 in obese as compared with lean mice (Maquoi et al. 2002, Chavey et al. 2003). Furthermore, transgenic overexpression of TIMP-1 increased the rate of adipocyte differentiation in rodents in vivo (Alexander et al. 2001). Most interestingly, a direct effect of TIMP-1 on 3T3-L1 cell differentiation could be demonstrated in vitro (Alexander et al. 2001). Thus, recombinant TIMP-1 dramatically accelerated lipid accumulation during differentiation in these cells (Alexander et al. 2001). Moreover, TIMP-1-deficient mice were protected from nutritionally induced obesity (Lijnen et al. 2003). Taking these studies into account, TIMP-1 might be a novel fat-derived protein promoting adipose tissue development when weight is gained.
Growing evidence suggests that obesity is associated with increased activity of the sympathetic nervous system (Facchini et al. 1996, Reaven et al. 1996, Hoieggen et al. 2000, Maison et al. 2000). Furthermore, increased catecholamine levels in overweight humans have been linked to obesity-associated insulin resistance and hypertension (Facchini et al. 1996, Reaven et al. 1996, Hoieggen et al. 2000, Maison et al. 2000). However, it is unknown whether catecholamines might impact on TIMP-1 expression. In the current study, we therefore examined the effect of the ß-adrenergic agonist isoproterenol on TIMP-1 synthesis in 3T3-L1 adipocytes in vitro. We demonstrate for the first time that isoproterenol induces TIMP-1 gene expression and secretion. Furthermore, we show that this stimulatory effect is mediated via ß-adrenergic receptors, protein kinase A (PKA) and adenylyl cyclase.
| Materials and Methods |
|---|
|
|
|---|
Oligonucleotides were purchased from MWG-Biotech (Ebersberg, Germany), cell culture reagents were from Life Technologies, Inc. Dexamethasone, dibutyryl-cAMP, forskolin, H89, insulin, isobutylmethylxanthine, isoproterenol, phentolamine and propranolol were obtained from Sigma Chemical Co.
Culture and differentiation of 3T3-L1 cells and immortalized brown preadipocytes
3T3-L1 cells (American Type Culture Collection, Rockville, MD, USA) and immortalized brown preadipocytes (Fasshauer et al. 2000) were differentiated as described (Kralisch et al. 2005a). Briefly, confluent preadipocytes were grown for 3 days in DMEM containing 25 mM glucose (DMEM-H), 10% fetal bovine serum and antibiotics (culture medium) further supplemented with 1 µM insulin, 0.5 mM isobutylmethylxanthine and 0.1 µM dexamethasone. Then, the cells were cultured for 3 days in culture medium with 1 µM insulin and for 36 more days in culture medium. Effectors were added to cells starved in DMEM-H for the indicated periods of time. At the time of the experiments at least 95% of the cells showed fat droplet accumulation.
Analysis of TIMP-1 secretion
TIMP-1 secretion into 3T3-L1 cell culture supernatants was quantified with a commercially available enzyme-linked immunoassay from RayBiotech Inc. (Norcross, GA, USA, USA) according to the manufacturers instructions.
Analysis of TIMP-1 and TIMP-2 mRNA
Expression of TIMP-1 and TIMP-2 mRNA was determined by quantitative real-time RT-PCR in a fluorescent temperature cycler (ABI Prism 7000; Applied Biosystems, Darmstadt, Germany) as described recently (Kralisch et al. 2005b). In brief, total RNA was isolated from 3T3-L1 adipocytes using TRIzol reagent (Life Technologies, Inc. One microgram of RNA was reverse transcribed using standard reagents (Life Technologies) and 2 µl of each RT reaction were amplified in a 26 µl PCR reaction using the following conditions: initial denaturation at 95 °C for 10 min followed by 40 PCR cycles consisting of 95 °C for 15 s, 60 °C for 1 min and 72 °C for 1 min. The following primer pairs were used for quantification: TIMP-1 (accession no. NM_011593 [GenBank] ) ctatagtgctggctgtggggtgtg (sense) and ttccgtggcaggcaagcaaagt (antisense); TIMP-2 (accession no. NM_011594 [GenBank] ) ggcctccctcccttactcc (sense) and gacttcatattccagcacgcacat (antisense); 36B4 (accession no. NM007475) aagcgcgtcctggcattgtct (sense) and ccgcagggg cagcagtggt (antisense). SYBR Green I fluorescence emissions were monitored after each cycle. TIMP-1, TIMP-2 and 36B4 mRNA were quantified using the second derivative maximum method of the ABI Prism 7000 software (Applied Biosystems), which determines the crossing points of individual samples by an algorithm identifying the first turning point of the fluorescence curve. TIMP-1 and TIMP-2 expression was calculated relative to 36B4, which was used as an internal control due to its resistance to hormonal regulation (Laborda 1991). Synthesis of specific transcripts was confirmed by melting curve profiles (cooling the sample to 68 °C and heating slowly to 95 °C with measurement of fluorescence) at the end of each PCR and by subjecting the amplification products to agarose gel electrophoresis. In each experiment and for each condition, RNA from one 6 cm plate was isolated and quantified for TIMP-1, TIMP-2 and 36B4 expression as indicated.
Statistical analysis
Results are shown as means ± S.E.M. Differences between various treatments were analyzed by unpaired Students t-tests. P values <0.01 were considered highly significant and <0.05 significant. The number of independent experiments performed for each condition is indicated in the Figure legends.
| Results |
|---|
|
|
|---|
TIMP-1 secretion into the medium was quantified in differentiated 3T3-L1 cells after 16 h of isoproterenol (10 µM) treatment. Interestingly, isoproterenol increased TIMP-1 protein in the cell culture supernatants from 28.3 ng/ml (basal) to 76.1 ng/ml (P<0.01) (Fig. 1
).
|
Next, we tested whether isoproterenol influences TIMP-1 mRNA synthesis in 3T3-L1 adipocytes. Interestingly, 10 µM isoproterenol induced TIMP-1 in a time-dependent fashion (Fig. 2
). Thus, a significant 1.6-fold stimulation could be seen as early as 1 h after effector addition (P<0.05), maximal 6.3-fold upregulation was observed after 4 h (P<0.01), and activation persisted for up to 24 h (P<0.01) (Fig. 2
). In contrast, TIMP-2 mRNA expression was not significantly altered by isoproterenol treatment (Fig. 2
).
|
|
We determined which proteins implicated in isoproterenol signaling are potential mediators of its positive effect on TIMP-1. To this end, 3T3-L1 cells were pretreated with specific pharmacological inhibitors of ß-adrenergic receptors (propranolol, 100 µM),
-adrenergic receptors (phentolamine, 100 µM) and PKA (H89, 10 µM) for 1 h before isoproterenol (10 µM) was added for another 16 h. Treatment of 3T3-L1 fat cells with propranolol, phentolamine and H89 alone for 17 h did not significantly influence basal TIMP-1 expression (Fig. 4
). Again, isoproterenol significantly stimulated TIMP-1 mRNA 4.1-fold (P<0.05) (Fig. 4
). This induction was almost completely reversed by pretreatment with either propranolol or H89, to 106 and 112% of untreated control cells respectively (P<0.05) (Fig. 4
). In contrast, phentolamine did not significantly alter isoproterenol-stimulated TIMP-1 synthesis (Fig. 4
).
|
We determined whether a cellular increase in cAMP induced by the adenylyl cyclase stimulator forskolin or the stable cAMP analogue dibutyryl-cAMP would be sufficient to upregulate TIMP-1 mRNA. Again, addition of 10 µM isoproterenol for 16 h significantly induced TIMP-1 synthesis 5.8-fold (P<0.01) (Fig. 5
). Treatment of 3T3-L1 adipocytes with 5 and 50 µM forskolin for 16 h significantly stimulated TIMP-1 mRNA expression 24.6-fold and 20.4-fold respectively (P<0.01) (Fig. 5
). Similarly, dibutyryl-cAMP at 100 and 1000 ng/ml significantly induced TIMP-1 synthesis 2.9-fold and 21.2-fold respectively (P<0.05) (Fig. 5
).
|
We tested whether insulin, which decreases intracellular cAMP levels, might influence basal and forskolin-induced TIMP-1 mRNA expression. Interestingly, insulin alone significantly increased TIMP-1 mRNA 3.8-fold (P<0.05) (Fig. 6
). Again, forskolin significantly stimulated TIMP-1 synthesis 35.9-fold (P<0.01) (Fig. 6
). This effect of forskolin on TIMP-1 mRNA was not significantly influenced by insulin co-treatment (Fig. 6
).
|
We tested whether isoproterenols effect on TIMP-1 mRNA is specific for 3T3-L1 adipocytes. For this purpose, differentiated immortalized brown adipocytes were treated with 10 µM isoproterenol for different periods of time. As shown in Fig. 7
, isoproterenol time-dependently stimulated TIMP-1 mRNA expression with a significant 1.6-fold stimulation first seen after 4 h of effector addition and a maximal 1.7-fold upregulation observed after 8 h of treatment (P<0.01).
|
| Discussion |
|---|
|
|
|---|
and interleukin (IL)-6 also induce TIMP-1 synthesis in 3T3-L1 adipocytes in vitro (Kralisch et al. 2005c). Since TIMP-1 deficiency protects from nutritionally induced obesity (Lijnen et al. 2003), whereas TIMP-1 overexpression accelerates adipocyte differentiation in vivo and in vitro (Alexander et al. 2001), this adipocytokine might actively maintain adipose tissue mass, at least in rodents. Potential mechanisms by which TIMP-1 promotes fat accumulation have been better elucidated. Thus, this adipocytokine has growth-promoting activity in a wide range of cells and appears as a novel serum growth factor (Hayakawa et al. 1992). Another independent study shows significant suppression of apoptosis in B cells after TIMP-1 treatment (Guedez et al. 1998). Furthermore, both studies suggest that the effects of TIMP-1 are not due to metalloproteinase inhibition and cannot be mimicked by another family member, TIMP-2 (Hayakawa et al. 1992, Guedez et al. 1998). These findings are of special interest, since pharmacological inhibition of MMPs, in contrast to TIMP-1 addition, leads to reduced adipogenesis in vitro and in vivo (Lijnen et al. 2002, Maquoi et al. 2002, Chavey et al. 2003, Demeulemeester et al. 2005). Taking these studies into consideration, TIMP-1 might maintain adipose tissue mass independently of MMP inhibition, possibly via increased proliferation and/or decreased apoptosis, at least in rodents. However, it has to be pointed out that data on potential pro-adipogenic effects of TIMP-1 in humans are not available so far. Clearly, additional work is needed to better understand the mechanisms by which TIMP-1 might promote fat accumulation.
In the current study, we present evidence that induction of TIMP-1 by isoproterenol can be almost completely reversed by ß-adrenergic blockade, as well as pharmacological PKA inhibition. In contrast, the
-adrenergic antagonist phentolamine is without any effect. Furthermore, stimulation of adenylyl cyclase with forskolin and elevation of cAMP levels with dibutyryl-cAMP are sufficient to mimic isoproterenols positive effect, i.e. an increase of TIMP-1 synthesis. These results are in accord with the classic view of isoproterenol activating GS-protein-coupled ß-adrenergic receptors leading to activation of adenylyl cyclase and PKA (Collins & Surwit 2001). Surprisingly, however, stimulation of 3T3-L1 adipocytes with forskolin or high concentrations of dibutyryl-cAMP increases TIMP-1 expression significantly more, as compared with isoproterenol. The reasons for this stronger effect are unclear and remain speculative. Thus, available intracellular cAMP levels in 3T3-L1 adipocytes might be higher after addition of forskolin or high concentrations of dibutyryl-cAMP as compared with isoproterenol. Alternatively, isoproterenol in contrast to forskolin and dibutyryl-cAMP might activate cAMP-independent pathways that negatively interact with the cAMP-dependent increase in TIMP-1 synthesis.
We show for the first time that insulin significantly upregulates TIMP-1 mRNA but does not influence forskolin-induced TIMP-1. These results suggest that insulin and forskolin induce TIMP-1 synthesis most probably via independent signaling pathways. Furthermore, reduction of intracellular cAMP concentrations by insulin does not appear to be sufficient to overcome forskolins stimulatory effect.
The current study extends previous data from our group demonstrating that various adipocytokines are regulated by ß-adrenergic activation in 3T3-L1 adipocytes. Thus, we have recently shown downregulation of resistin (Fasshauer et al. 2001b), adiponectin (Fasshauer et al. 2001a) and visfatin (Kralisch et al. 2005a), whereas IL-6 is induced by isoproterenol (Fasshauer et al. 2003).
Taken together, we demonstrate for the first time that TIMP-1 expression and secretion are selectively upregulated in fat cells by ß-adrenergic activation. Further studies are needed to more clearly define the mechanisms by which TIMP-1 might promote adipose tissue accumulation.
| Funding |
|---|
| References |
|---|
|
|
|---|
Beaudeux JL, Giral P, Bruckert E, Foglietti MJ & Chapman MJ 2004 Matrix metalloproteinases, inflammation and atherosclerosis: therapeutic perspectives. Clinical and Chemical Laboratory Medicine 42 121131.[CrossRef][Web of Science][Medline]
Chavey C, Mari B, Monthouel MN, Bonnafous S, Anglard P, Van Obberghen E & Tartare-Deckert S 2003 Matrix metalloproteinases are differentially expressed in adipose tissue during obesity and modulate adipocyte differentiation. Journal of Biological Chemistry 278 1188811896.
Collins S & Surwit RS 2001 The beta-adrenergic receptors and the control of adipose tissue metabolism and thermogenesis. Recent Progress in Hormone Research 56 309328.[Abstract]
Crandall DL, Hausman GJ & Kral JG 1997 A review of the microcirculation of adipose tissue: anatomic, metabolic, and angiogenic perspectives. Microcirculation 4 211232.[Web of Science][Medline]
Demeulemeester D, Collen D & Lijnen HR 2005 Effect of matrix metalloproteinase inhibition on adipose tissue development. Biochemical and Biophysical Research Communications 329 105110.[CrossRef][Web of Science][Medline]
Facchini FS, Stoohs RA & Reaven GM 1996 Enhanced sympathetic nervous system activity. The linchpin between insulin resistance, hyperinsulinemia, and heart rate. American Journal of Hypertension 9 10131017.[CrossRef][Web of Science][Medline]
Fasshauer M, Klein J, Ueki K, Kriauciunas KM, Benito M, White MF & Kahn CR 2000 Essential role of insulin receptor substrate-2 in insulin stimulation of Glut4 translocation and glucose uptake in brown adipocytes. Journal of Biological Chemistry 275 2549425501.
Fasshauer M, Klein J, Neumann S, Eszlinger M & Paschke R 2001a Adiponectin gene expression is inhibited by beta-adrenergic stimulation via protein kinase A in 3T3-L1 adipocytes. FEBS Letters 507 142146.[CrossRef][Web of Science][Medline]
Fasshauer M, Klein J, Neumann S, Eszlinger M & Paschke R 2001b Isoproterenol inhibits resistin gene expression through a G(S)-protein-coupled pathway in 3T3-L1 adipocytes. FEBS Letters 500 6063.[CrossRef][Web of Science][Medline]
Fasshauer M, Klein J, Lossner U & Paschke R 2003 Interleukin (IL)-6 mRNA expression is stimulated by insulin, isoproterenol, tumour necrosis factor alpha, growth hormone, and IL-6 in 3T3-L1 adipocytes. Hormone and Metabolic Research 35 147152.[CrossRef][Web of Science][Medline]
Guedez L, Stetler-Stevenson WG, Wolff L, Wang J, Fukushima P, Mansoor A & Stetler-Stevenson M 1998 In vitro suppression of programmed cell death of B cells by tissue inhibitor of metalloproteinases-1. Journal of Clinical Investigation 102 20022010.[Web of Science][Medline]
Hayakawa T, Yamashita K, Tanzawa K, Uchijima E & Iwata K 1992 Growth-promoting activity of tissue inhibitor of metalloproteinases-1 (TIMP-1) for a wide range of cells. A possible new growth factor in serum. FEBS Letters 298 2932.[CrossRef][Web of Science][Medline]
Hoieggen A, Fossum E, Nesbitt SD, Palmieri V & Kjeldsen SE 2000 Blood viscosity, plasma adrenaline and fasting insulin in hypertensive patients with left ventricular hypertrophy. ICARUS, a LIFE Substudy. Insulin CARotids US Scandinavica. Blood Pressure 9 8390.[CrossRef][Web of Science][Medline]
Kahn BB & Flier JS 2000 Obesity and insulin resistance. Journal of Clinical Investigation 106 473481.[Web of Science][Medline]
Kralisch S, Klein J, Lossner U, Bluher M, Paschke R, Stumvoll M & Fasshauer M 2005a Hormonal regulation of the novel adipocytokine visfatin in 3T3-L1 adipocytes. Journal of Endocrinology 185 R1R8.
Kralisch S, Klein J, Lossner U, Bluher M, Paschke R, Stumvoll M & Fasshauer M 2005b Interleukin-6 is a negative regulator of visfatin gene expression in 3T3-L1 adipocytes. American Journal of Physiology. Endocrinology and Metabolism 289 E586E590.
Kralisch S, Klein J, Lossner U, Bluher M, Paschke R, Stumvoll M & Fasshauer M 2005c Proinflammatory adipocytokines induce TIMP-1 expression in 3T3-L1 adipocytes. FEBS Letters 579 64176422.[CrossRef][Web of Science][Medline]
Laborda J 1991 36B4 cDNA used as an estradiol-independent mRNA control is the cDNA for human acidic ribosomal phosphoprotein PO. Nucleic Acids Research 19 3998.
Lijnen HR, Maquoi E, Hansen LB, Van Hoef B, Frederix L & Collen D 2002 Matrix metalloproteinase inhibition impairs adipose tissue development in mice. Arteriosclerosis, Thrombosis, and Vascular Biology 22 374379.
Lijnen HR, Demeulemeester D, Van Hoef B, Collen D & Maquoi E 2003 Deficiency of tissue inhibitor of matrix metalloproteinase-1 (TIMP-1) impairs nutritionally induced obesity in mice. Thrombosis and Haemostasis 89 249255.[Web of Science][Medline]
Maison P, Byrne CD, Hales CN & Wareham NJ 2000 Hypertension and its treatment influence changes in fasting nonesterified fatty acid concentrations: a link between the sympathetic nervous and the metabolic syndrome? Metabolism 49 8187.[CrossRef][Web of Science][Medline]
Maquoi E, Munaut C, Colige A, Collen D & Lijnen HR 2002 Modulation of adipose tissue expression of murine matrix metalloproteinases and their tissue inhibitors with obesity. Diabetes 51 10931101.
Reaven GM, Lithell H & Landsberg L 1996 Hypertension and associated metabolic abnormalities the role of insulin resistance and the sympathoadrenal system. New England Journal of Medicine 334 374381.
Received in final form 28 February 2006
Accepted 17 March 2006
Made available online as an Accepted Preprint 24 March 2006
This article has been cited by other articles:
![]() |
S. Weise, S. Kralisch, G. Sommer, U. Lossner, M. Bluher, M. Stumvoll, and M. Fasshauer Tissue inhibitor of metalloproteinase-1 mRNA production and protein secretion are induced by interleukin-1{beta} in 3T3-L1 adipocytes J. Endocrinol., July 1, 2008; 198(1): 169 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Jensen, B. Sloth, I. Krog-Mikkelsen, A. Flint, A. Raben, T. Tholstrup, N. Brunner, and A. Astrup A low-glycemic-index diet reduces plasma plasminogen activator inhibitor-1 activity, but not tissue inhibitor of proteinases-1 or plasminogen activator inhibitor-1 protein, in overweight women Am. J. Clinical Nutrition, January 1, 2008; 87(1): 97 - 105. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kralisch, M. Bluher, A. Tonjes, U. Lossner, R. Paschke, M. Stumvoll, and M. Fasshauer Tissue inhibitor of metalloproteinase-1 predicts adiposity in humans Eur. J. Endocrinol., February 1, 2007; 156(2): 257 - 261. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |