JOE
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2006) 189, 473-484       DOI: 10.1677/joe.1.06747
© 2006 Society for Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jeong, J-W
Right arrow Articles by DeMayo, F J
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jeong, J-W
Right arrow Articles by DeMayo, F J

Steroid hormone regulation of Clca3 expression in the murine uterus

J-W Jeong, K Y Lee, J P Lydon and F J DeMayo

Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030, USA

(Requests for offprints should be addressed to F J DeMayo; Email: fdemayo{at}bcm.tmc.edu)


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Progesterone (P4) and its cognate receptor, the progesterone receptor (PGR), have important roles in the establishment and maintenance of pregnancy in the murine uterus. In previous studies, using high-density DNA microarray analysis, we identified a subset of genes whose expression is repressed by chronic P4-PGR activation in the uterus. The Clca3 gene is one of the genes whose expression is the most significantly downregulated by P4 and PGR. In the present study, we performed real-time RT–PCR and in situ hybridization to investigate the regulation of Clca3 by P4 and determine the pattern of expression of Clca3 in the uterus during early pregnancy. This analysis shows that Clca3 mRNA transcripts were detected in the luminal and glandular epithelium of the pseudopregnant uterus at day 0.5 and that the expression of Clca3 was not detected after day 3.5. P4 represses Clca3 mRNA synthesis in the luminal epithelial and glandular epithelial cells of the uterus in ovariectomized wild-type mice, but not in Pgr knockout (PRKO) mice. Conversely, estrogen (E2) induces Clca3 expression in the luminal epithelium and glandular epithelium, and this induction was repressed by P4 in the murine uterus. Analysis of the promoter region of Clca3 by in silico and transient transfection analysis in HEC-1A cells identified the regulation of Clca3 by estrogen receptor-alpha (ESR1) within the first 528 bp of 5'-flanking region of the Clca3 gene. Our studies identified Clca3 as a novel downregulated gene of PGR that is a direct target of E2 regulation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The uterus consists of heterogeneous cell types that undergo dynamic changes to support embryo development and implantation. These phenomena are primarily dependent on coordinated interactions mediated by progesterone (P4) and estrogen (E2). E2 stimulates proliferation of both the uterine epithelial and stromal cells in neonatal mice. However, this proliferative action of E2 is restricted to epithelial cells in the adult mouse uterus (Martin et al. 1973b, Huet-Hudson et al. 1989). In contrast, while P4 inhibits E2-mediated proliferation of the luminal and glandular epithelial cells, P4, alone or in conjunction with E2, leads to uterine stromal cell proliferation (Martin et al. 1973a, Huet-Hudson et al. 1989, Paria et al. 1993).

The ovarian steroid hormone progesterone (P4) is an essential regulator of reproductive events associated with all aspects of the establishment and maintenance of pregnancy (Clarke & Sutherland 1990, Lydon et al. 1995). The physiologic affects of P4 are mediated through progesterone receptors (PGRs) that are expressed as two isoforms, PGR-A and PGR-B, that arise from the same gene (Mulac-Jericevic et al. 2000, Conneely et al. 2002). PGR is a transcription factor belonging to the nuclear receptor superfamily (Evans 1988, O’Malley & Conneely 1992, Tsai & O’Malley 1994). The fertility defects exhibited by the PRKO mice unequivocally demonstrated the critical importance of P4 and its receptor in establishment and maintenance of pregnancy (Lydon et al. 1995, 1996).

Although the impact of the P4-PGR axis on murine uterine function has been extensively investigated, only a few P4-PGR-regulated genes have been identified. These include genes encoding amphiregulin (Areg) (Das et al. 1995), histidine decarboxylase (Hdc) (Paria et al. 1998), homeo box A10 (Hoxa10) and homeo box A11 (Hoxa11) (Lim et al. 1999), calcitonin (Calca) (Kumar et al. 1998, Zhu et al. 1998), calbindin-D9K (Nie et al. 2000), Indian hedgehog (Ihh) (Takamoto et al. 2002), hypoxia-inducible factor 1 (Hif1a; Daikoku et al. 2003) and immune-responsive gene 1 (Irg1) (Cheon et al. 2003). These target genes have been identified by testing candidate genes (Das et al. 1995), by differential library screening (Zhu et al. 1998) and by DNA microarray approaches (Cheon et al. 2002, Takamoto et al. 2002). The advent of the last named, high-density DNA microarray technology, has immensely improved the ability to identify PGR-regulated genes in the uterus.

We recently used oligonucleotide microarrays to identify the genes with expression regulated by the P4-PGR axis in the mouse uterus (Jeong et al. 2005). PRKO and wild-type mice were ovariectomized and then treated with 1 mg P4 or vehicle (sesame oil) every 12 h. Groups of mice were killed 4 h after the first P4 injection (acute treatment) or 4 h after the fourth injection of P4 (chronic treatment). Using this methodology, we identified several genes regulated by PGR in the uterus in response to P4 (Jeong et al. 2005). Interestingly, we found that the expression of Clca3 (chloride channel calcium-activated 3) mRNA was suppressed significantly by P4 and PGR.

The calcium-activated chloride channels (CLCA) family appears to mediate a calcium-activated chloride conductance in a variety of tissues, including epithelium (Evans & Marty 1986, Huang et al. 1993, Arreola et al. 1996), smooth muscle (Amedee et al. 1990, Clapp et al. 1996), skeletal muscle (Hume & Thomas 1989) and neurons (Barnes & Hille 1989, Hallani et al. 1998). Six members of this family have been identified, cloned and partially characterized in the mouse: Clca1 (Gandhi et al. 1998, Romio et al. 1999), Clca2 (Lee et al. 1999), Clca3 (Komiya et al. 1999), Clca4 (Elble et al. 2002), Clca5 and Clca6 (Abdel-Ghany et al. 2003, Beckley et al. 2004, Evans et al. 2004). Structural analysis indicates significant similarities among different CLCA family members, including protein sizes of 902–943 amino acids and four or five transmembrane regions (Pauli et al. 2000, Jentsch et al. 2002). However, the tissue and cellular distribution patterns appear to be unique to each protein.

Clca3 (also termed gob-5) has been identified in goblet cells throughout the intestinal tract by in situ hybridization (Komiya et al. 1999). The Clca3 transcript was also detected by Northern blot in the murine trachea and uterus without identification of the respective cell types. However, the function and regulation of Clca3 have not been reported to date, and the biologic processes in which it is involved are unclear. In this study, we analyzed the spatiotemporal expression and regulation of Clca3 in the response to P4 and E2 in early pregnant uterus.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and tissue collection

Mice were maintained in the designated animal care facility at Baylor College of Medicine according to the institutional guidelines for the care and use of laboratory animals. Thirty-six wild-type and 12 PRKO mice at 6 weeks of age were ovariectomized. Two weeks later, ovariectomized wild-type mice were injected with one of the following: vehicle (sesame oil), P4 (1 mg/mouse), E2 (0.1 µg/mouse) or P4 plus E2. The injections were at 0 h and at 12-h intervals thereafter, the animals being killed at 4, 16, and 40 h (wild-type) or 4 and 40 h (PRKO) (n=3 animals per genotype per treatment). Hormone injection was repeated every 12 h for the 16- and 40-h samples to prevent the effect of hormone degradation by metabolism. The mice were anesthetized with Avertin (2,2,-tibromoethyl alcohol; Sigma-Aldrich) and killed by cervical dislocation under anesthetic at 4, 16 or 40 h (4 h after fourth injection) to collect the uteri. Multiple-timed pseudopregnant female mice were achieved by treating female mice with a superovulatory regimen of gonadotropin and mating with vasectomized male mice. Hormonal induction of ovulation was used to synchronize the cycle of mice for multiple-timed pregnant females. Briefly, wild-type females were administered 5 IU pregnant mare’s serum gonadotropin (VWR Scientific Products, West Chester, PA, USA), followed 48 h later by 5 IU human chorionic gonadotropin (Organon, West Orange, NJ, USA), and placed with a vasectomized male mouse. The morning of vaginal plug was designated as day 0.5. Uterine tissues were flash frozen at the time of dissection and stored at –80 °C for RNA or fixed with 10% (v/v) formalin for in situ hybridization.

Quantitative real-time PCR

RNA was extracted from uterine tissues with the RNeasy total RNA isolation kit (Qiagen). Expression levels of Clca3 mRNA were measured by real-time RT–PCR TaqMan analysis with the ABI Prism 7700 Sequence Detector System according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA, USA). Prevalidated probes and primers for Clca3 and 18S RNA were purchased from Applied Biosystems. RT–PCR was performed with One-Step RT–PCR Universal Master Mix reagent and TaqMan Gene Expression Assays (Applied Biosystems) according to the manufacturer’s instructions. Standard curves were generated by serial dilution of a preparation of total RNA isolated from whole mouse uterus. All real-time PCR was done with the three independent RNA sets. mRNA quantities were normalized against 18S RNA with ABI rRNA control reagents. Statistical analyses used one-way ANOVA followed by Tukey’s post hoc multiple range test with the Instat package from GraphPad (San Diego, CA, USA). P values of < 0.05 were considered statistically significant, and values of < 0.01 highly significant. In the figures, S.E.M. is indicated in all bar graphs.

In situ hybridization

The protocol for in situ hybridization was essentially as described previously by Simmons et al.(1989). Uterine tissues were fixed in 10% (v/v) formalin. After overnight fixation at room temperature, tissues were dehydrated through a series of ethanol and then processed for paraffin embedding. Paraffin sections were mounted onto poly-L-lysine-coated slides (VWR Scientific Products, West Chester, PA, USA), and used for in situ hybridization. The riboprobes were generated by in vitro transcription of amplified DNA products containing the T7 polymerase promoter sequence flanking the desired nucleotide primer sequence, using 35S-UTP (Promega). Slides were incubated for 7 min at room temperature in Proteinase K (20 µg/ml) in a buffer containing 50 mM Tris and 5 mM EDTA (pH 8). Slides were then acetylated with acetic anhydride, dehydrated and exposed to either denatured antisense or sense probes in hybridization buffer (50% (v/v) formamide, 10% (w/v) dextran sulfate, 5 Denhardt’s solution, 300 mM NaCl, 5 mM EDTA (pH 8), 20 mM Tris (pH 8) and 0.05 mg/ml yeast tRNA). Hybridization was performed at 55 °C overnight in a humidity chamber containing 5 SSC and 50% (v/v) formamide. Hybridized slides were exposed to 20 µg/ml RNase A for 30 min at 37 °C. Slides were washed in 50% (v/v) formamide, 2 SSC and 100 mM 2-mercaptoethanol, followed by 2 SSC at 55 °C for 30 min, dehydrated in a graded series of ethanol in 0.3 M ammonium acetate, and exposed to Biomax MR film overnight (Kodak). The following morning, slides were dipped in autoradiography emulsion (Amersham) and placed at 4 °C in a light-proof box for several days. After development, slides were counterstained with hematoxylin.

Construction of Clca3-luciferase-expression vectors

The 891 bp (–907 to –17) of 5'-flanking region of the Clca3 gene were PCR-amplified from mouse genomic DNA as a template, using the 5'-PCR primer, 5'-GAA GACCAAAAGGATGAAAATGAC-3', and the 3'-PCR primer, 5'- GGGAAGCTTTGGAAAGGGCTGGGTG TAGAAG -3'. The resulting PCR product was subcloned into the pCR II TA TOPO cloning vector (Invitrogen). The 891 bp Clca3 fragment was liberated from the pCR II TA TOPO vector and subcloned into the luciferase gene in the pGL3 Basic vector (Promega).

Two deletion constructs, 528 bp (–544 to –17) and 319 bp (–335 to –17) promoter, were generated via PCR with the same 3' PCR primer and two different 5' PCR primers: –544 (5'-GATGCTGAGGAGAAATGTGGA GTT-3'), and –335 (5'-TGAGGAACCAGATTAG GAT-3'). The resulting PCR product was subcloned into the luciferase gene in the pGL3 basic vector (Promega).

Transient transfection assay

HEC-1A cells were seeded in 24-well plates and cultured according to ATCC recommendations until they were approximately 60–70% confluent. Cell cultures were maintained in media containing charcoal-stripped fetal calf serum (FCS). The cells were transfected with Superfect (Qiagen) with 1 µg reporter gene, and 10 or 50 ng estrogen receptor alpha (Esr1) or estrogen receptor beta (Esr2). Cells were treated with either E2 (10–8 M), or vehicle (ethanol) for 24 h. Cells were harvested for luciferase assay 24 h after addition of the E2 or ethanol. Cell extracts were prepared after 24-h transfection and assayed by a luciferase reporter system (Promega). Protein concentration was used to correct for differences in transfection efficiencies. The data represent two independent experiments, each performed in triplicate. Statistical analyses were by one-way ANOVA followed by Tukey’s post hoc multiple-range test with the Instat package from GraphPad. P values of < 0.05 were considered statistically significant and values of < 0.01 highly significant. The S.E.M. is indicated in all bar graphs.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Downregulation of the Clca3 expression by P4 in the uterus

We previously identified Clca3 as a potential chronic P4-and PGR-regulated gene in the murine uterus by DNA microarray analysis (Jeong et al. 2005). In this study, we analyzed the P4 and PGR regulation of Clca3 in the murine uterus. For further determination of the reliance of Clca3 expression on PGR function, ovariectomized wild-type and PRKO mice were injected with P4 or vehicle (sesame oil). Uteri were collected from the mice after 4 h (acute treatment) or 40 h (chronic treatment) of hormone treatment, and the expression of Clca3 was investigated by real-time RT–PCR. As shown in Fig. 1Go, the mRNA transcript of Clca3 was detected in the uteri of wild-type ovariectomized mice. However, the Clca3 transcript was significantly decreased after chronic treatment with P4 in the wild-type mice (10%). To establish whether the P4 regulation of Clca3 is PGR dependent, we analyzed the expression of the Clca3 in the uteri of wild-type and PRKO mice. After chronic P4 treatment, downregulation of the Clca3 transcription was not detected in the PRKO mice (Fig. 1Go). We also did not detect any change of Clca3 expression in the wild-type mice after the acute P4 treatment, although a significant effect was seen at 16 h in the wild-type mice. These results were consistent with our microarray data identification of Clca3 gene as a late responsive gene. These results show that Clca3 mRNA expression is downregulated by both P4 and PGR in chronic treatment, but not in acute treatment.


Figure 1
View larger version (10K):
[in this window]
[in a new window]
 
Figure 1 The expression pattern of Clca3 from P4-treated wild-type (WT) and PRKO uteri by real-time RT–PCR. Total RNA used for the RT–PCR assays was prepared from wild-type or PRKO uteri that were treated with P4 or vehicle (Veh; sesame oil) for 40 h. The results represent the mean ± S.E.M. of three independent RNA sets. **P < 0.01.

 
To analyze the spatial expression of Clca3 by P4 in the uterus, we performed in situ hybridization in the P4-treated uterine samples. Uterine sections were hybridized with a 569 bp, 35S-labeled antisense RNA probe containing sequences from Clca3 cDNA. As shown in Fig. 2Go, using the antisense Clca3 probe, we observed a hybridization signal in the luminal and glandular epithelium cells of the uterine section obtained from vehicle-treated wild-type uterus. The observed signal was not uniform but indicated distinct regions of signal intensity in the luminal and glandular uterine epithelium. These signals were not detected in the chronic P4-treated, wild-type samples. To establish whether the P4 downregulation of the Clca3 gene is mediated through PGR, ovariectomized PRKO and wild-type female mice were treated with P4 or vehicle. After chronic P4 treatment, the uteri were collected, and in situ hybridization was performed. As expected, hybridizing signals for Clca3 transcripts were detected in the P4-treated PRKO uterine sections (Fig. 3Go). These results indicate that PGR is essential for Clca3 gene downregulation in luminal and glandular epithelium cells.


Figure 2
View larger version (31K):
[in this window]
[in a new window]
 
Figure 2 The localization pattern of Clca3 transcription by in situ hybridization in the P4-treated uterus. Tissue sections from wild-type uteri were treated with P4 or vehicle (Veh; sesame oil) for 4 and 40 h. Nuclei were lightly counterstained with hematoxylin. Magnification x20. Scale bar=100 or 50 µm (inset). LE, luminal epithelium; GE, glandular epithelium; ST, stroma cells; Myo, myometrium.

 

Figure 3
View larger version (30K):
[in this window]
[in a new window]
 
Figure 3 The localization pattern of Clca3 transcription by in situ hybridization in the PRKO mice. Tissue sections from wild-type (WT) or PRKO uteri were treated with P4 or vehicle (Veh; sesame oil) for 40 h. Nuclei were lightly counterstained with hematoxylin. Magnification x20. Bar=100 µm. LE, luminal epithelium; GE, glandular epithelium; ST, stroma cells; Myo, myometrium.

 
Regulation of Clca3 gene by E2 and P4 in the uterus

P4 antagonizes E2 actions, such as the stimulation of proliferation of the epithelial cells in the mouse uterus (Martin et al. 1973b, Huet-Hudson et al. 1989). To determine whether P4 antagonizes the effect of E2 in Clca3 expression, we treated ovariectomized female mice with E2 or E2 plus P4 for 4, 16, or 40 h. Real-time RT–PCR analysis was performed with uterine RNA after E2 or E2 plus P4 treatment. As shown in Fig. 4Go, P4 repressed Clca3 mRNA levels 16 and 40 h after treatment. The expression of Clca3 mRNA was increased 3.65-, 5.52- and 87.02-fold 4 and 16 h after E2 treatment and after 40 h of chronic E2 treatment respectively. The results suggest that E2 induces the expression of Clca3 in the uterus. Figure 4Go also shows that treatment of mice with E2 plus P4 significantly inhibited the induction of Clca3 by E2. These results indicate that the expression of Clca3 is induced by E2, but the induction of mRNA expression by E2 is inhibited by P4 in the uterus.


Figure 4
View larger version (14K):
[in this window]
[in a new window]
 
Figure 4 The expression pattern of Clca3 from E2- or E2 plus P4-treated uteri by real-time RT–PCR. Total RNA used for the RT–PCR assays was prepared from wild-type mice treated with P4, E2, E2 plus P4, or vehicle (Veh; sesame oil) for 4, 16 and 40 h. The results represent the mean ± S.E.M. of three independent RNA sets. *P < 0.05; **P < 0.01.

 
Next, we analyzed by in situ hybridization the spatial expression of the Clca3 transcription in the uterus after E2 treatment. As we expected, Clca3 mRNA was weakly detected in the luminal and glandular epithelial cell at 4 h (Fig. 5AGo). The signal of Clca3 was increased at 16 h, and then a significant induction of Clca3 mRNA was observed in the luminal epithelium and glandular epithelium cells at 40 h. To determine the spatial regulation between E2 and P4 in the Clca3 expression, we performed in situ hybridization on the E2 plus P4-treated uteri (Fig. 5BGo). The weak epithelial signals were detected at 4 h, and then the signals were increased at 16 h. However, we could not detect any signal at 40 h in uterine sections. These results suggest that P4 is a downregulator of Clca3 expression and E2 is a positive regulator in the luminal and glandular epithelium.


Figure 5
View larger version (45K):
[in this window]
[in a new window]
 
Figure 5 The localization pattern of Clca3 transcription by in situ hybridization in (A) E2- and (B) E plus P4-treated uteri. Tissue sections from wild-type uteri were treated with E2, E2 plus P4, or vehicle (sesame oil) for 4, 16 and 40 h. Nuclei were lightly counterstained with hematoxylin. Magnification x 20. Bar=100 µm. LE, luminal epithelium; GE, glandular epithelium; ST, stroma cells; Myo, myometrium.

 
The expression of the Clca3 gene during early pregnancy

The above analysis identified the pharmacologic regulation of Clca3 by the ovarian steroids E2 and P4. We next established the expression profile of Clca3 mRNA in mouse uteri during early pregnancy with real-time RT–PCR to measure levels of Clca3 and compare the expression to two other uterine P4-responsive genes, amphiregulin (Areg) (Das et al. 1995) and patched homolog 1 (Ptch1) (Takamoto et al. 2002) from pseudo-pregnant samples. As shown in Fig. 6AGo, the strong expression of Clca3 detected on day 0.5 declined sharply on days 1.5 and 2.5 (5.59% and 1.38% respectively) and was undetectable after day 3.5. The levels of P4 were elevated on day 2.5 during early pregnancy, as shown by the induction of P4-responsive genes Areg and Ptch1 (Fig. 6B and CGo respectively). These results suggest that strong downregulation of Clca3 expression occurs in the uterus on day 2.5 of gestation, presumably in response to P4.


Figure 6
View larger version (13K):
[in this window]
[in a new window]
 
Figure 6 The expression pattern of Clca3 by real-time RT–PCR in pseudopregnancy. The expression level of Clca3 (A), Areg (B) and Ptch1 (C) were measured in uteri of pseudopregnancy. Total RNA used for the RT–PCR assays was prepared from pseudopregnant uteri. The results represent the mean ± S.E.M. of three independent RNA sets. **P < 0.01.

 
Next, we analyzed by in situ hybridization the spatial expression profile of the Clca3 transcription in the uterus from pseudopregnant uterine samples (Fig. 7Go). Consistent with the real-time RT–PCR results, the Clca3 mRNA transcripts were strongly expressed in luminal and glandular epithelial cells at day 0.5. However, the specific hybridization signal was not observed in the epithelial cells of uterine sections obtained from day 2.5. These results further confirm that Clca3 transcription is repressed in the luminal and glandular epithelial cells of pregnant uteri. Moreover, these spatial patterns of Clca3 expression are similar to the ones observed in the uteri of ovariectomized mice in response to P4 treatment. These results suggest that the repression of Clca3 may be important during early pregnancy.


Figure 7
View larger version (112K):
[in this window]
[in a new window]
 
Figure 7 The localization pattern of Clca3 transcription by in situ hybridization during pseudopregnancy. The mice were killed to harvest uteri at indicated pseudopregnancy. Nuclei were lightly counterstained with hematoxylin. Magnification x20. Bar=100 µm. d, day; LE, luminal epithelium; GE, glandular epithelium; ST, stroma cells; Myo, myometrium.

 
Transcriptional regulation of the Clca3 promoter by estrogen

To investigate the molecular mechanisms underlying Clca3 gene expression regulation by P4 and E2, we examined the Clca3 promoter and 5'-flanking region for potential sequences that are recognized by PGR and estrogen receptor (ESR). Although no palindromic PRE (progesterone response element) could be identified in the 2 kb 5'-flanking region, this region contains one palindromic ERE (estrogen response element) and one half-ERE, the most proximal of which is present within the –420 (Fig. 8AGo). This palindromic ERE of Clca3 was shown to be conserved in mouse, rat, man, cow and dog (Fig. 8BGo).


Figure 8
View larger version (26K):
[in this window]
[in a new window]
 
Figure 8 Transcriptional regulation of the Clca3 promoter by estrogen. (A) Nucleotide sequence of the mouse Clca3 promoter. Nucleotides are numbered from the ATG site (+1) of the gene. The transcription initiation site is denoted by arrow. Exon 1 sequence is shown in boldface, and putative ER binding sites are boxed and in boldface. (B) Alignment of conserved ERE region for mouse, rat, human, cow and dog Clca3. The conserved ERE of the Clca3 gene was deduced from the University of California (Santa Cruz) Genome Browser (http://genome.ucsc.edu). The boxed regions indicate sequences in the promoter that are conserved ERE in the five species. (C) Transient transfection assays of the Clca3 promoter in HEC-1A cells. Luciferase reporter plasmids containing Clca3 promoter 891 bp fragments were transiently transfected into HEC-1A cells with Esr1 or Esr2. (D) Transient transfection assays of serial deletion of Clca3 promoter in HEC-1A cell lines. The 528 and 319 bp promoter fragments were subcloned into the polylinker region of the promoterless luciferase reporter vector pGL3-basic. The promoter deletion/luciferase reporter constructs were cotransfected with Esr1. These data represent two independent experiments, each performed in triplicate. Values shown are ± S.E.M. Student’s t-test was used for statistical analysis. *P < 0.05; **P < 0.01. +: 10 ng/well; ++: 50 ng/well; Et-OH, ethanol (vehicle); E2, 17ß-estradiol.

 
In order to determine whether the estrogen receptor directly regulates the expression of Clca3, cotransfection assays were performed in HEC-1A endometrial adenocarcinoma cells, with 891 bp of the 5' flanking region of the Clca3 promoter fused to the luciferase reporter, as described in Materials and methods. This region contains all putative ERE motifs. HEC-1A cells were transfected with the 891 bp promoter and different amounts of expression vectors containing Esr1 and Esr2 (10 and 50 ng). The data were represented as fold-induction where the value of luciferase activity for the construct with no treatment was set to 1.0 (Fig. 8C and DGo). Under these conditions, it was shown that Esr1, and not Esr2, activated, in a dose-dependent manner, the 891 bp promoter of Clca3 in HEC-1A cells (Fig. 8CGo). We could not detect regulation of the Clca3-luciferase reporter when cotransfected in HEC-1A cells with expression vectors for Pgr-A or Pgr-B (data not shown).

For further identification of the region of Esr1 regulation of the Clca3 promoter, cotransfection experiments in HEC-1A cells were conducted with deletion fragments of the Clca3 promoter fused to the luciferase reporter. These reporters contained 528 and 319 bp of the Clca3 promoter. The fragment containing 891 and 528 bp of the promoter region showed enhanced luciferase activity by E2. However, deletions to –335 bp, which eliminated the only full ERE site, resulted in 58% loss of E2 induction of luciferase activity. These results suggest that the conserved ERE region of Clca3 is important for Esr1 regulation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
P4 plays important roles through its nuclear receptors in the uterine functions associated with the establishment and maintenance of pregnancy (Conneely & Lydon 2000, Conneely et al. 2001, 2002, Conneely & Jericevic 2002). Studies of the mouse model carrying a null mutation of the Pgr gene (PRKO) showed essential roles that these receptors play in P4-mediated response (Lydon et al. 1995, 1996). Thus, the identification of P4-regulated pathways in the uterus is crucial for understanding the impairments that underlie the complex phenotype of PRKO mice. In previous studies, we have identified P4-regulated genes by PRKO and microarray analysis (Jeong et al. 2005). Two time points (4 and 40 h) were used to identify early-responsive genes (direct targets) and late-responsive genes (indirect targets). Clca3 was the strongest repressed gene as a potential indirect target of P4 regulation. In the present study, we provide clear evidence that Clca3 is a novel late-responsive gene of PGR regulation in the murine uterus.

The analysis of Clca3 in mouse uterus shows that the gene is expressed in the luminal and glandular compartments of the endometrium. The expression of this gene is not uniform throughout the epithelial compartments, but shows focal regions of intensity. This may reflect a cellular specificity to the expression of this gene. Although there is little information on the expression of cell specific markers in uterine epithelial cell types, Clca3 may represent a means of detecting subpopulations of uterine epithelial cell types.

Our results indicate that the expression of Clca3 is stimulated by E2 and repressed by P4. The expression studies during pregnancy show that Clca3 is highest at day 0.5, and its expression decreases as pregnancy progresses, when P4 levels are rising. This decrease in Clca3 is opposite to the expression of genes stimulated by P4, as well as the expression of Pgr (Tan et al. 1999, Takamoto et al. 2002), validating in vivo physiologic repression of this gene by P4. In silico analysis of the 10 kb region flanking 5' to the proximal promoter region of Clca3 could not detect any conserved PRE. However, one conserved ERE was detected at -418 ~ -407, and one half site was detected at –176 ~ –171 of the 5' region of the mouse gene (detection by TESS (Transcription Element Search System; www.cbil.upenn.edu/tess)). The consensus ERE motif is a palindromic repeat of the sequence GGTCA separated by three nucleotides (Klinge 2001). These palindromic repeats are separated by one nucleotide, but conserved in five different species, including mouse, rat, man, cow and dog (Fig. 8BGo). We show significant E2 induction of the 891 and 528 bp promoter reporter construct, while induction was significantly reduced in the 319 bp promoter-reporter construction. Even though the 319 bp promoter fragment did not contain a full ERE consensus site, E2 induction was still observed, albeit significantly reduced. This residual regulation by E2 may be through activation of the ERE half-site at –176 ~ –171, or it may be through a mechanism independent of DNA binding (Aronica et al. 1994, Tesarik & Mendoza 1995, Le Mellay et al. 1997, Simoncini et al. 2004). Interestingly, the 0.5 kb region displays higher luciferase activity than the 1.0 kb full-length promoter region. This region may contain potential repressive elements between –543 and –1006, relative to ATG. The above results demonstrate that E2 regulates, through its receptor, Clca3 transcription.

These results suggest that this estrogen response in Clca3 may serve as a direct docking site for the estrogen receptor and provide direct regulation by estrogen. Since no conserved PRE was found, repression of PGR may be through an indirect mechanism. Since P4 inhibits the expression of Esr in the uterine epithelium, the expression of Clca3 may be by P4 inhibiting Esr expression. However, this does not exclude other transcription factors being inhibited by P4.

Clca3 has been identified in goblet cells of the intestinal tract by in situ hybridization (Komiya et al. 1999). Increasing evidence suggests that members of the CLCA family play a role in diseases with epithelial secretory dysfunction (Hashimoto et al. 2004). By use of the murine model of bronchial asthma, Clca3 was found to be a key regulator of the induction of mucus overproduction. In this model, antisense Clca3 therapy effectively suppressed the asthma phenotype, whereas Clca3 overexpression exacerbated the condition (Nakanishi et al. 2001). Changes in MUC1 glycoform expression have been related to a phase of the menstrual cycle and endometrial receptivity in a number of studies (Meseguer et al. 1998, Lagow et al. 1999, Aplin et al. 2001). Failure of embryo implantation was associated with an abnormal endometrial expression of MUC1 mucin and retention of PGR, particularly in epithelial cells (Horne et al. 2005). Downregulation of Clca3 by P4 during early pregnancy may be a means of initiating the decrease in mucus production by the endometrial epithelial cells in the uterus. The decrease in mucus production may initiate the window of receptivity for embryo attachment and implantation.

In summary, this study demonstrated Clca3 mRNA to be expressed in murine uterine luminal and glandular epithelial cells, but not in stroma cells in ovariectomized mice. The levels of this mRNA in the uterine luminal and glandular epithelial cells were significantly downregulated by P4 and upregulated by E2. E2-mediated induction was inhibited by P4 when the ovariectomized mice were treated with E2 and P4. The expression of Clca3 was turned off on day 1.5 of pregnancy. These results suggest that steroid hormonal regulation of Clca3 may be important in the uterus of mouse during early pregnancy.


    Acknowledgements
 
We thank Jinghua Li, Bryan Ngo and Janet DeMayo, MS, for technical assistance; and Dr Yun Kyoung Kang for providing Esr1- and Esr2-luciferase plasmids.


   Funding

This work was supported by National Institutes of Health Grant DK59820 (to F J D), and RO1-CA77530, Department of Defense Breast Cancer Research Program IDEA Award DMAMD-17–01–0138 and the Susan G Komen Award BCTR0503763 (to J P L). The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abdel-Ghany M, Cheng HC, Elble RC, Lin H, DiBiasio J & Pauli BU 2003 The interacting binding domains of the beta(4) integrin and calcium-activated chloride channels (CLCAs) in metastasis. Journal of Biological Chemistry 278 49406–49416.[Abstract/Free Full Text]

Amedee T, Large WA & Wang Q 1990 Characteristics of chloride currents activated by noradrenaline in rabbit ear artery cells. Journal of Physiology 428 501–516.[Abstract/Free Full Text]

Aplin JD, Meseguer M, Simon C, Ortiz ME, Croxatto H & Jones CJ 2001 MUC1, glycans and the cell-surface barrier to embryo implantation. Biochemistry Society Transactions 29 153–156.[CrossRef]

Aronica SM, Kraus WL & Katzenellenbogen BS 1994 Estrogen action via the cAMP signaling pathway: stimulation of adenylate cyclase and cAMP-regulated gene transcription. PNAS 91 8517–8521.[Abstract/Free Full Text]

Arreola J, Park K, Melvin JE & Begenisich T 1996 Three distinct chloride channels control anion movements in rat parotid acinar cells. Journal of Physiology 490 351–362.[Abstract/Free Full Text]

Barnes S & Hille B 1989 Ionic channels of the inner segment of tiger salamander cone photoreceptors. Journal of General Physiology 94 719–743.[Abstract/Free Full Text]

Beckley JR, Pauli BU & Elble RC 2004 Re-expression of detachment-inducible chloride channel mCLCA5 suppresses growth of metastatic breast cancer cells. Journal of Biological Chemistry 279 41634–41641.[Abstract/Free Full Text]

Cheon YP, Li Q, Xu X, DeMayo FJ, Bagchi IC & Bagchi MK 2002 A genomic approach to identify novel progesterone receptor regulated pathways in the uterus during implantation. Molecular Endocrinology 16 2853–2871.[Abstract/Free Full Text]

Cheon YP, Xu X, Bagchi MK & Bagchi IC 2003 Immune-responsive gene 1 is a novel target of progesterone receptor and plays a critical role during implantation in the mouse. Endocrinology 144 5623–5630.[Abstract/Free Full Text]

Clapp LH, Turner JL & Kozlowski RZ 1996 Ca(2+)-activated Cl currents in pulmonary arterial myocytes. American Journal of Physiology 270 H1577–1584.

Clarke CL & Sutherland RL 1990 Progestin regulation of cellular proliferation. Endocrine Reviews 11 266–301.[Abstract/Free Full Text]

Conneely OM & Lydon JP 2000 Progesterone receptors in reproduction: functional impact of the A and B isoforms. Steroids 65 571–577.[CrossRef][Web of Science][Medline]

Conneely OM & Jericevic BM 2002 Progesterone regulation of reproductive function through functionally distinct progesterone receptor isoforms. Reviews in Endocrine and Metabolic Disorders 3 201–209.

Conneely OM, Mulac-Jericevic B, Lydon JP & De Mayo FJ 2001 Reproductive functions of the progesterone receptor isoforms: lessons from knock-out mice. Molecular and Cellular Endocrinology 179 97–103.[CrossRef][Web of Science][Medline]

Conneely OM, Mulac-Jericevic B, DeMayo F, Lydon JP & O’Malley BW 2002 Reproductive functions of progesterone receptors. Recent Progress in Hormone Research 57 339–355.[Abstract/Free Full Text]

Daikoku T, Matsumoto H, Gupta RA, Das SK, Gassmann M, DuBois RN & Dey SK 2003 Expression of hypoxia-inducible factors in the peri-implantation mouse uterus is regulated in a cell-specific and ovarian steroid hormone-dependent manner.Evidence for differential function of HIFs during early pregnancy. Journal of Biological Chemistry 278 7683–7691.[Abstract/Free Full Text]

Das SK, Chakraborty I, Paria BC, Wang XN, Plowman G & Dey SK 1995 Amphiregulin is an implantation-specific and progesterone-regulated gene in the mouse uterus. Molecular Endocrinology 9 691–705.[Abstract/Free Full Text]

Elble RC, Ji G, Nehrke K, DeBiasio J, Kingsley PD, Kotlikoff MI & Pauli BU 2002 Molecular and functional characterization of a murine calcium-activated chloride channel expressed in smooth muscle. Journal of Biological Chemistry 277 18586–18591.[Abstract/Free Full Text]

Evans MG & Marty A 1986 Calcium-dependent chloride currents in isolated cells from rat lacrimal glands. Journal of Physiology 378 437–460.[Abstract/Free Full Text]

Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240 889–895.[Abstract/Free Full Text]

Evans SR, Thoreson WB & Beck CL 2004 Molecular and functional analyses of two new calcium-activated chloride channel family members from mouse eye and intestine. Journal of Biological Chemistry 279 41792–41800.[Abstract/Free Full Text]

Gandhi R, Elble RC, Gruber AD, Schreur KD, Ji HL, Fuller CM & Pauli BU 1998 Molecular and functional characterization of a calcium-sensitive chloride channel from mouse lung. Journal of Biological Chemistry 273 32096–32101.[Abstract/Free Full Text]

Hallani M, Lynch JW & Barry PH 1998 Characterization of calcium-activated chloride channels in patches excised from the dendritic knob of mammalian olfactory receptor neurons. Journal of Membrane Biology 161 163–171.[CrossRef][Web of Science][Medline]

Hashimoto K, Graham BS, Ho SB, Adler KB, Collins RD, Olson SJ, Zhou W, Suzutani T, Jones PW, Goleniewska K et al. 2004 Respiratory syncytial virus in allergic lung inflammation increases Muc5ac and gob-5. American Journal of Respiratory Critical Care Medicine 170 306–312.[Abstract/Free Full Text]

Horne AW, Lalani EN, Margara RA, Ryder TA, Mobberley MA & White JO 2005 The expression pattern of MUC1 glycoforms and other biomarkers of endometrial receptivity in fertile and infertile women. Molecular Reproduction and Development 72 216–229.[CrossRef][Web of Science][Medline]

Huang SJ, Fu WO, Chung YW, Zhou TS & Wong PY 1993 Properties of cAMP-dependent and Ca(2+)-dependent whole cell Cl conductances in rat epididymal cells. American Journal of Physiology 264 C794–802.

Huet-Hudson YM, Andrews GK & Dey SK 1989 Cell type-specific localization of c-myc protein in the mouse uterus: modulation by steroid hormones and analysis of the periimplantation period. Endocrinology 125 1683–1690.[Abstract/Free Full Text]

Hume RI & Thomas SA 1989 A calcium- and voltage-dependent chloride current in developing chick skeletal muscle. Journal of Physiology 417 241–261.[Abstract/Free Full Text]

Jentsch TJ, Stein V, Weinreich F & Zdebik AA 2002 Molecular structure and physiological function of chloride channels. Physiology Reviews 82 503–568.[Abstract/Free Full Text]

Jeong JW, Lee KY, Kwak I, White LD, Hilsenbeck SG, Lydon JP & Demayo FJ 2005 Identification of murine uterine genes regulated in a ligand-dependent manner by the progesterone receptor. Endocrinology 146 3490–3505.[Abstract/Free Full Text]

Klinge CM 2001 Estrogen receptor interaction with estrogen response elements. Nucleic Acids Research 29 2905–2919.[Abstract/Free Full Text]

Komiya T, Tanigawa Y & Hirohashi S 1999 Cloning and identification of the gene gob-5, which is expressed in intestinal goblet cells in mice. Biochemical and Biophysical Research Communications 255 347–351.[CrossRef][Web of Science][Medline]

Kumar S, Zhu LJ, Polihronis M, Cameron ST, Baird DT, Schatz F, Dua A, Ying YK, Bagchi MK & Bagchi IC 1998 Progesterone induces calcitonin gene expression in human endometrium within the putative window of implantation. Journal of Clinical Endocrinology and Metabolism 83 4443–4450.[Abstract/Free Full Text]

Lagow E, DeSouza MM & Carson DD 1999 Mammalian reproductive tract mucins. Human Reproduction Update 5 280–292.[Abstract/Free Full Text]

Lee D, Ha S, Kho Y, Kim J, Cho K, Baik M & Choi Y 1999 Induction of mouse Ca(2+)-sensitive chloride channel 2 gene during involution of mammary gland. Biochemical and Biophysical Research Communications 264 933–937.[CrossRef][Web of Science][Medline]

Le Mellay V, Grosse B & Lieberherr M 1997 Phospholipase C beta and membrane action of calcitriol and estradiol. Journal of Biological Chemistry 272 11902–11907.[Abstract/Free Full Text]

Lim H, Ma L, Ma WG, Maas RL & Dey SK 1999 Hoxa-10 regulates uterine stromal cell responsiveness to progesterone during implantation and decidualization in the mouse. Molecular Endocrinology 13 1005–1017.[Abstract/Free Full Text]

Lydon JP, DeMayo FJ, Funk CR, Mani SK, Hughes AR, Montgomery CA Jr, Shyamala G, Conneely OM & O’Malley BW 1995 Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes and Development 9 2266–2278.[Abstract/Free Full Text]

Lydon JP, DeMayo FJ, Conneely OM & O’Malley BW 1996 Reproductive phenotypes of the progesterone receptor null mutant mouse. Journal of Steroid Biochemistry and Molecular Biology 56 67–77.[CrossRef][Web of Science][Medline]

Martin L, Das RM & Finn CA 1973a The inhibition by progesterone of uterine epithelial proliferation in the mouse. Journal of Endocrinology 57 549–554.[Abstract/Free Full Text]

Martin L, Finn CA & Trinder G 1973b Hypertrophy and hyperplasia in the mouse uterus after oestrogen treatment: an autoradiographic study. Journal of Endocrinology 56 133–144.[Abstract/Free Full Text]

Meseguer M, Pellicer A & Simon C 1998 MUC1 and endometrial receptivity. Molecular Human Reproduction 4 1089–1098.[Abstract/Free Full Text]

Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP & Conneely OM 2000 Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 289 1751–1754.[Abstract/Free Full Text]

Nakanishi A, Morita S, Iwashita H, Sagiya Y, Ashida Y, Shirafuji H, Fujisawa Y, Nishimura O & Fujino M 2001 Role of gob-5 in mucus overproduction and airway hyperresponsiveness in asthma. PNAS 98 5175–5180.[Abstract/Free Full Text]

Nie GY, Li Y, Wang J, Minoura H, Findlay JK & Salamonsen LA 2000 Complex regulation of calcium-binding protein D9k (calbindin-D(9k)) in the mouse uterus during early pregnancy and at the site of embryo implantation. Biology of Reproduction 62 27–36.[Abstract/Free Full Text]

O’Malley BW & Conneely OM 1992 Orphan receptors: in search of a unifying hypothesis for activation. Molecular Endocrinology 6 1359–1361.[Free Full Text]

Paria BC, Huet-Hudson YM & Dey SK 1993 Blastocyst’s state of activity determines the ‘window’ of implantation in the receptive mouse uterus. PNAS 90 10159–10162.[Abstract/Free Full Text]

Paria BC, Das N, Das SK, Zhao X, Dileepan KN & Dey SK 1998 Histidine decarboxylase gene in the mouse uterus is regulated by progesterone and correlates with uterine differentiation for blastocyst implantation. Endocrinology 139 3958–3966.[Abstract/Free Full Text]

Pauli BU, Abdel-Ghany M, Cheng HC, Gruber AD, Archibald HA & Elble RC 2000 Molecular characteristics and functional diversity of CLCA family members. Clinical Experiments in Pharmacology and Physiology 27 901–905.

Romio L, Musante L, Cinti R, Seri M, Moran O, Zegarra-Moran O & Galietta LJ 1999 Characterization of a murine gene homologous to the bovine CaCC chloride channel. Gene 228 181–188.[CrossRef][Web of Science][Medline]

Simmons DM, Arriza JL & Swanson LW 1989 A complete protocol for in situ hybridization of messanger RNAs in brain and other tissues with radiolabeled single-stranded RNA probes. Journal of Histotechnology 12 169–181.

Simoncini T, Mannella P, Fornari L, Caruso A, Varone G & Genazzani AR 2004 Genomic and non-genomic effects of estrogens on endothelial cells. Steroids 69 537–542.[CrossRef][Web of Science][Medline]

Takamoto N, Zhao B, Tsai SY & DeMayo FJ 2002 Identification of Indian hedgehog as a progesterone-responsive gene in the murine uterus. Molecular Endocrinology 16 2338–2348.[Abstract/Free Full Text]

Tan J, Paria BC, Dey SK & Das SK 1999 Differential uterine expression of estrogen and progesterone receptors correlates with uterine preparation for implantation and decidualization in the mouse. Endocrinology 140 5310–5321.[Abstract/Free Full Text]

Tesarik J & Mendoza C 1995 Nongenomic effects of 17 beta-estradiol on maturing human oocytes: relationship to oocyte developmental potential. Journal of Clinical Endocrinology and Metabolism 80 1438–1443.[Abstract]

Tsai MJ & O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annual Review of Biochemistry 63 451–486.[CrossRef][Web of Science][Medline]

Zhu LJ, Cullinan-Bove K, Polihronis M, Bagchi MK & Bagchi IC 1998 Calcitonin is a progesterone-regulated marker that forecasts the receptive state of endometrium during implantation. Endocrinology 139 3923–3934.[Abstract/Free Full Text]

Received in final form 21 February 2006
Accepted 2 March 2006
Made available online as an Accepted Preprint 13 March 2006




This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
I. Mercier, M. C. Casimiro, J. Zhou, C. Wang, C. Plymire, K. G. Bryant, K. M. Daumer, F. Sotgia, G. Bonuccelli, A. K. Witkiewicz, et al.
Genetic Ablation of Caveolin-1 Drives Estrogen-Hypersensitivity and the Development of DCIS-Like Mammary Lesions
Am. J. Pathol., April 1, 2009; 174(4): 1172 - 1190.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. Song, X. Zhang, Z. Qi, G. Sun, S. Chi, Z. Zhu, J. Ren, Z. Qiu, K. Liu, L. Myatt, et al.
Cloning and Characterization of a Calcium-Activated Chloride Channel in Rat Uterus
Biol Reprod, April 1, 2009; 80(4): 788 - 794.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jeong, J-W
Right arrow Articles by DeMayo, F J
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jeong, J-W
Right arrow Articles by DeMayo, F J


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS