|
|
||||||||
1 INSERM U553, Institut Universitaire dHématologie, Hôpital Saint-Louis/Bâtiment INSERM, 1 avenue Claude Vellefaux, 75010 Paris, France
2 INSERM U716, Institut Universitaire dHématologie, Hôpital Saint-Louis/Bâtiment INSERM, 1 avenue Claude Vellefaux, 75010 Paris, France
3 Unité INSERM 540, Montpellier, France
(Requests for offprints should be addressed to M Perrot-Applanat; Email: applanat{at}chu-stlouis.fr)
| Abstract |
|---|
|
|
|---|
or ERß after ER-mediated adenovirus infection. In contrast, Flk-1/KDR expression was up-regulated by VEGF itself, in a time- and dose-dependent manner, with the maximal response at 10 ng/ml. Thus, we suggest that E2 up-regulates Flk-1/KDR expression in vivo in endothelial cells mainly through the modulation of VEGF by a paracrine mechanism. It is currently unknown whether or not the endothelial origin might account for differences in the E2-modulation of VEGF receptor expression, particularly in relation to the vascular bed of sex steroid-responsive tissues. | Introduction |
|---|
|
|
|---|
In vivo, VEGF induces a potent angiogenic response in a variety of models and acts as a vascular permeability factor based on its ability to induce vascular leakage (see reviews by Ferrara & Davis-Smyth 1997, Ferrara et al. 2003). VEGF is also a survival factor for endothelial cells, preventing apoptosis induced by serum starvation. Molecular cloning of the human VEGF gene has revealed that differential exon splicing generates multiple tissue-and function-specific variants containing 121, 165, 189, and 206 amino acids (see review by Ferrara & Davis-Smyth 1997). In most systems, VEGF121 and VEGF165 are the major species expressed, while VEGF189 is only minimally present and VEGF206 is limited to embryonic tissue. In the human endometrium, E2 up-regulates all VEGF isoforms (Shifren et al. 1996, Bausero et al. 1998), while progesterone selectively increases the expression of the VEGF189 isoform (Ancelin et al. 2002). The role of these isoforms is still debated. Also, little is known about the effect of E2 on the endothelial cells and on VEGF signaling.
The angiogenic effects of VEGF are believed to be mediated by two tyrosine kinase receptors, Flt-1 (Fms-like tyrosine kinase-1 or VEGFR-1) and Flk-1/KDR (fetal liver kinase/kinase-insert domain receptor or VEGFR-2). These receptors initiate different signaling cascades in endothelial cells (Gille et al. 2001). Flk-1/KDR is now considered to be the main receptor involved in endothelial cell proliferation, migration and survival (Millauer et al. 1993, Ferrara et al. 2003). In contrast, Flt-1 has a decoy effect on VEGF signaling, possibly with variations related to the vascular bed type (Ferrara et al. 2003). Factors regulating Flk-1/KDR expression in vivo in endothelial cells are not clearly defined. In tumors, Flk-1/KDR appears to be regulated by hypoxia, an effect probably mediated by VEGF (Kremer et al. 1997). VEGF and its receptor, Flk-1/KDR, which are expressed in most tissues during embryonic development, are down-regulated in the adult in physiological conditions, except in the reproductive tract (Perrot-Applanat 2000, Ferrara et al. 2003). In the human endometrium, Flk-1/KDR expression in endometrial blood vessels seems to exhibit menstrual cycle-dependent changes, with higher expression in the proliferative and the early or early-mid secretory phases, suggesting that ovarian hormones influence the expression of this receptor in the uterus (Meduri et al. 2000). In vitro studies have shown that Flk-1/KDR expression is regulated by several growth factors (Shen et al. 1998, Ferrara et al. 2003) and by shear stress (Abumiya et al. 2002). Treatment of endothelial cells with E2 directly increases the proliferation and survival of these cells (Morales et al. 1995) through inhibition of apoptosis (Spyridopoulos et al. 1997). However, although E2 increases VEGF expression in the endometrium, the relationship between E2 and Flk-1/KDR expression involved in endothelial cell proliferation is poorly understood.
To better ascertain the role of E2 in Flk-1/KDR expression, we have examined the role of E2 and the mechanisms controlling Flk-1/KDR expression in a mouse model of angiogenesis. We have also analyzed the expression of the receptor in endothelial cells treated with E2 and VEGF.
| Materials and Methods |
|---|
|
|
|---|
Reagents for cell culture and PCR were from Gibco (Life Technologies, Cergy-Pontoise, France). Estradiol was purchased from Sigma (Sigma-Aldrich GmbH, Steinheim, Germany). TriZOL isolation kit, Moloney murine leukemia virus (MMLV) reverse transcriptase, and Taq polymerase were from Life Technologies (Cergy-Pontoise, France). Recombinant VEGF was provided by R&D Systems (Minneapolis, MN, USA).
Mice uteri
Mice were housed in the animal care facility at the National Institute of Environmental Health Sciences (NIEHS), Research Triangle Park, NC, USA. They were treated in accordance with NIH guidelines for the humane use of animals in research. The generation and characterization of the estrogen receptor
knockout (
ERKO) mice have previously been reported (Couse et al. 1995). Adult wild-type (WT) or
ERKO mice were ovariectomized and rested for two weeks to clear endogenous hormones before any treatment. Mice (4 animals/group) were implanted with a pellet of E2 (200 ng), progesterone (35 mg), E2 and progesterone or placebo over 21 days. Animals were killed by cervical dislocation and the uterus was removed, fixed in 4% paraformaldehyde and embedded in paraffin.
Uteri were also dissected out of C57BL6J/129 Svj mice (8- to 12-weeks-old, random cyclic females), fixed in Bouins and embedded in paraffin as previously described (Kurita et al. 2001).
Immunocytochemistry
Immunological detection of VEGF receptor Flk-1/KDR was performed using the polyclonal rabbit antibody CT128 directed against Flk-1/KDR (1:400 dilution; Millauer et al. 1993), as previously described (Meduri et al. 2000). This antibody has previously been characterized and does not cross-react with other protein kinase receptors. Immunocytochemical staining included overnight incubation at 4 °C with the primary antibody, followed by incubation with biotinylated anti-rabbit IgG and streptavidin-biotin peroxidase (LSAB2 immunostaining kit Dakopatts, Glostrup, Denmark). Controls included omission of the first antibody and incubation of tissue sections with irrelevant rabbit IgG immunoglobulins. Adjacent sections were incubated with a marker of vascular endothelial cells, the polyclonal anti-Von Willebrand factor (vWF) antibody (Dako, Glostrup, Denmark) (Meduri et al. 2000).
The number of Flk-1/KDR-stained capillaries in each section was determined after identification of the areas containing the highest number of stained capillaries at low power magnification, as previously described (Meduri et al. 2000). Counts of individual immunostained capillaries were performed at higher magnification (x16 objective, 0.322 mm2 per field), using a stereomicroscope (Leitz, Orthoplan) equipped with a CDD video camera. Five different fields in each section were digitized by image analysis and computerized using the Histolab program (Microvision, Evry, France). Capillary quantification was assessed blindly. The total number of capillaries in each biopsy was previously assessed by vessel counts in serial sections stained by anti-Von Willebrand factor using the same program. Values were expressed as means ± S.E.M.
Immunohistochemical detection of estrogen receptor (ER) ß was performed on mouse uteri using an anti-ERß sheep polyclonal antibody, as previously described (Kurita et al. 2001, Saunders et al. 2001).
Endothelial cell isolation and stimulation
Endothelial cells (human umbilical vein endothelial cells; HUVEC) were isolated from fresh human umbilical cords using digestion with Collagenase I according to the method of Jaffe et al.(1973). Cells were plated in 0.2% gelatin-coated flasks. They were grown in Medium 199 supplemented with 20% fetal calf serum (FCS) and 2 mM glutamine, 100 µg/ml penicillin/streptomycin, 15 mM HEPES and sodium bicarbonate. Cells were cultured in 5% CO2 at 37 °C and the media were replaced at 2-day intervals. Immunostaining with Von Willebrand factor antibody (Dako) confirmed their endothelial origin. The presence of Flk-1/KDR was detected by immunostaining of paraformaldehydefixed cells with CT128 antibodies, as described above. Second passaged cells were used for experiments. Prior to steroid stimulation, endothelial cells were cultured overnight in a 6-cm Petri dish until confluence in M199 containing 1% FCS in the absence of steroid (charcoal-stripped serum) and phenol red. For stimulation, the medium was replaced with the same phenol red-free medium containing 5% serum in the presence of E2 (1010 to 107 M) for 372 h. Control cells were incubated in phenol red-free medium without hormone.
Cell culture and infection
Infectious viral particles adr5 (backbone virus), ad-hER
and ad-hERß were generated by in vivo recombination of pACsk12 CMV5-hER plasmid with pJM17 in HEK-293 cells, as previously described (Lazennec et al. 2001; Viraquest Inc., North Liberty, IA, USA). Titered virus stock was used to infect HUVEC and HMEC-1 (human microvascular endothelial cells from dermis) using a previously described protocol (Lazennec et al. 2001). Briefly, 106 HUVEC or HMEC-1 were seeded in a 60-mm diameter petri dish in 10% SVF M199 or MCDB 131 respectively. Cells were infected by an adenovirus at a concentration of 100 or 200 pock formit unit/cell for HUVEC and HMEC respectively at 37 °C in 5% CO2. Cells were rinsed in PBS and 10% stripped SVF-containing medium was added. Cells were treated with various concentrations of E2 for 7 or 24 h at 37 °C.
RNA extraction and RT-PCR analysis
Total RNA was isolated from treated or stimulated confluent cultures of human endothelial cells with TriZOL according to the manufacturers instructions. For the reverse transcription stage, single-stranded cDNA was synthesized from 1 µg total RNA in the MMLV reverse transcriptase and hexamers primers. The presence of mRNA encoding the VEGF receptors and estrogen receptors (ER) in endothelial cells was determined using reverse transcriptase-polymerase chain reaction (RT-PCR) and specific oligonucleotide primers.
Detection of estradiol receptors
PCR amplification was performed using 5% RT product and primers chosen at positions 598623 and 13921416 in human ER
cDNA and positions 124146 and 498519 in human ERß cDNA (Bausero et al. 2000). The PCR products are 395 and 818 bp for ERß and ER
respectively. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control (450 bp). Amplification was performed using standard Gibco-BRL PCR buffer with 100 nM dNTP, 50 pmoles primers, 1.5 mM MgCl2 and 1.2 U Taq polymerase, in a 20 µl final volume. The parameters for amplification were: 4 min at 94 °C, 40 cycles of 30 s at 94 °C, 1 min at 57 °C, 1 min at 72 °C and a 10 min final extension at 72 °C. Products were separated and visualized in ethidium bromide-stained agarose gels. Quantitative RT-PCR (qPCR) of ER
and ERß was also performed using Taqman apparatus, according to a method previously described (Bieche et al. 2001).
Quantification of Flk-1/KDR expression by real time RT-PCR All PCRs for the detection of Flk-1/KDR were performed using the real-time fluorescence detection method with the LightCycler System and a FirstStart DNA Master SYBR Green I kit (Roche Diagnostic, Meylan, France). The primer sequences for Flk-1/KDR were as follows: forward, 5' TCTCAATGTGGTCAACCTTCTAG; reverse, 5' TTTAAACGTCTTAAGGGTGTTAGTG. To avoid amplification of contaminating genomic DNA, two primers were chosen in two different exons. The cycling conditions were as follows: initial denaturation at 95 °C for 10 min, followed by 40 amplification cycles at 95 °C for 15 s, 55 °C for 5 s, and 72 °C for 20 s. A negative control without the cDNA template was performed to assess the overall specificity. Expression levels were normalized to ß2-microglobulin, which was unaffected in the different treatment groups. Results are expressed as the mean of 5 independent experiments assayed in duplicate.
Statistical analysis
Students t-test was used to determine the significance between treated and untreated cells, and P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
We have previously described the presence and modulation of VEGF and its Flk-1/KDR receptor in the human cyclic endometrium (Meduri et al. 2000). The expression of this receptor, deduced from the semi-quantitative analysis of capillaries immunostained for Flk-1/KDR, was maximal in the proliferative and in the mid-secretory periods. This observation suggests a possible effect of E2 on the expression of Flk-1/KDR in the endometrium.
In order to assess the possible effect of E2 on Flk-1/KDR expression in vivo, we have chosen the mouse uterus model. Ovariectomized mice were treated with E2 or vehicle, as described in Materials and Methods, and uterine sections were immunostained for Flk-1/KDR (Fig. 1AD
). Quantification of VEGF receptor was examined using a protocol previously described by Meduri et al.(2000). Morphometric analysis showed a significant increase in the number of Flk-1/KDR-stained vascular structures expressed per unit area in the uteri of E2-treated (4.1-fold induction, P < 0.05) or E2+progesterone-treated (4.3-fold induction, P < 0.05) mice as compared with controls. In contrast, there was no change in the expression of Flk-1/KDR in wild-type progesterone-treated mice (Fig. 1E
).
|
gene (
ERKO mice) (Fig. 1C,D
ERKO mice as compared with E2-treated wild-type mice (P < 0.05), suggesting that ER
could be involved in this regulation process. However, the number of Flk-1/KDR stained vascular structures was also lower in untreated
ERKO mice versus untreated wild-type mice (P < 0.05) (Fig. 1E
ERKO mice (P < 0.06), suggesting that ERß could also be involved in this regulation. As shown in Fig. 2
or ß) activation. Comparative experiments using immunostaining with anti-vWF (a marker of endothelial cells) indicate that E2-treatment of mice results in an increase in the total number of blood vessels, but not in an increase in the number of blood vessels expressed per unit area (not shown). Therefore, the increase in Flk-1/KDR-positive blood vessels of E2-treated mice does not result from an overall increase in blood vessels.
|
VEGF, but not estradiol, increases Flk-1/KDR expression in endothelial cells (HUVEC)
VEGF levels have previously been shown to increase in human uterine cells in response to E2 stimulation (Shifren et al. 1996, Bausero et al. 1998). In order further to analyze the possible effects of E2 and VEGF on Flk-1/KDR expression in vitro, we used endothelial cells prepared from umbilical cord (HUVEC). As shown by immunofluorescence and RT-PCR analysis, these cells expressed Flk-1/KDR receptor (Fig. 3A,B
).
|
Treatment of HUVEC endothelial cells with E2 (1010 to 107 M) for 7 h (Fig. 3C
) or with 108 M for 0 72 h (not shown) did not induce significant Flk-1/KDR expression. Using quantitative RT-PCR analysis (Bieche et al. 2001), ER
was absent in all HUVEC samples (n=7), while ERß was present in very low amounts (not shown) with values always set below the lowest range (below the first tertile) found using the same method in a series of 131 primary breast cancer tumors (Bieche et al. 2001). The absence of an effect of E2 on Flk-1/KDR expression in HUVEC could be explained by a loss of ER expression in the primary endothelial cells when isolated from the umbilical cord. Therefore, we have overexpressed ER
or ERß in macro- (HUVEC) and micro- (HMEC-1) vascular cells, using adenovirus infection as described in Materials and Methods (see Fig. 4D
) and have analyzed the modulation of Flk-1/KDR in these cells (Fig. 4A
C). Results indicate that E2 does not affect the Flk-1/KDR expression in endothelial cells, whether E2 was used at 108 M (Fig. 4A,B
) or at various concentrations (Fig. 4C
).
|
| Discussion |
|---|
|
|
|---|
In vivo regulation of Flk-1/KDR expression by E2 in the uterus
Endometrial cyclical growth depends on capillary proliferation and increased blood flow caused by vasodilatation and changes in vascular permeability (Giudice 1996). These changes are regulated by E2 and progesterone through activation of their respective nuclear receptors (Perrot-Applanat et al. 1994, Lecce et al. 2001). E2 directly modulates VEGF expression in the human endometrium in vivo (Shifren et al. 1996, Bausero et al. 1998). Preliminary observations suggest that E2 also modulates endometrial Flk-1/KDR (Meduri et al. 2000), essential for the development of the uterine vasculature during physiological angiogenesis (Heryanto et al. 2003). However, the mechanisms controlling E2-induced Flk-1/KDR expression are unclear. As functional ERs are essential for the E2-induced increase in angiogenesis, wild-type and
ERKO mice (Couse et al. 1995) provide a valuable model to examine the ER-mediated estrogenic effect on uterine Flk-1/KDR expression. We quantified Flk-1/KDR expression in ovariectomized wild-type or
ERKO E2-treated mice using an established protocol (Meduri et al. 2000). Our data show that E2 induces Flk-1/KDR expression through functional ER
activation in the mouse uterus, as previously suggested for the human endometrium (Meduri et al. 2000). From our data, ER
does not seem to be the only mediator for Flk-1/KDR expression. Since ERß is also expressed in uterine endothelial cells, we can anticipate a possible role for ERß in E2-induced Flk-1/KDR expression in the absence of ER
. This hypothesis could be strengthened by the study of Kurita et al.(2001), who has previously described a role for ERß in E2 induction of progesterone receptor in
ERKO mice. Further experiments using mice with ERß invalidation are required to elucidate the respective roles of ER
and ERß in Flk-1/KDR induction.
We have shown that progesterone modulates VEGF secretion in decidual cells (Ancelin et al. 2002). While adjunction of progesterone does not modify the E2 effect on Flk-1/KDR expression in wild-type and
ERKO mice, progesterone alone increases Flk-1/KDR expression only in
ERKO but not in wild-type mice (see Fig. 1
). We do not know why progesterone has an effect only in the absence of ER
. Previous studies have demonstrated the presence of progesterone receptors in
ERKO mice; progesterone is able to induce a decidual reaction and to regulate gene expression in these animals (Curtis et al. 1999). Our data on the role of progesterone in Flk-1/KDR expression in the mouse uterus need to be confirmed on a larger series of animals.
E2 and in vitro regulation of Flk-1/KDR expression in endothelial cells
Experimental studies show that E2 exerts direct effects on endothelial cells, including up-regulation of endothelial nitric oxide synthase activity, modulation of adhesion molecule expression, angiogenic activity and proliferation in vitro after 6 days of culture (Morales et al. 1995). However, it is unclear whether these effects are mediated through modulation of VEGF receptors. In our study, E2 did not increase significantly Flk-1/KDR expression in HUVEC samples from early passages (P1 to P2). A small increase in Flk-1/KDR expression with E2 was observed in one of the 7 samples analyzed (not shown), which could be mediated by ERß, as suggested by the presence of low levels of ERß. The presence of ERß, but not of ER
mRNA, was previously described in HUVEC (Enmark et al. 1997, Stefano et al. 2000). Our results could be interpreted by the fact that the response could vary among different subjects, or by a loss of ER expression in most samples. Gargett et al.(2002) report a moderate increase in Flk-1/KDR expression in E2-treated myometrial endothelial cells, mediated primarily by ER
. These discrepancies may reflect differences in endothelial cell origin and/or conditions of culture such as the number of passages. We and others have detected only ERß and not ER
in human and mouse endothelial cells in vivo (Critchley et al. 2001, Kurita et al. 2001, Lecce et al. 2001, as shown in this study). To counteract the loss of ER expression in our primary endothelial cells, HUVEC, we have overexpressed ER
or ERß in macro- (HUVEC) and micro- (HMEC-1) vascular cells. Our results show that E2 does not modulate Flk-1/KDR expression in endothelial cells. In our studies, we have also used transient transfection of ER
and ERß cDNA along with a Flk-1/KDR promoter-luciferase gene reporter in an umbilical cord cell line (HUV-E-C), which expresses low levels of Flk-1/KDR, as compared with primary HUVEC. E2 did not activate Flk-1/KDR in these cells but activated an estrogen response element luciferase construct (data not shown). Thus, E2 does not directly modulate Flk-1/KDR in endothelial cells; a direct effect of E2 could be limited to the vasculature of sex steroid-responsive tissues, such as the myometrium.
VEGF induces up-regulation of Flk-1/KDR in vitro and in vivo
Previous studies have demonstrated that E2 increases VEGF secretion in human and animal uterine cells (Cullivan-Bove & Koos 1993, Shifren et al. 1996, Bausero et al. 2000). The present study demonstrates a VEGF-induced up-regulation of Flk-1/KDR mRNA in endothelial cells (HUVEC), in agreement with a previous study on the capillary endothelium of bovine adrenal cortex (Shen et al. 1998). By qPCR we can barely detect VEGF mRNA in HUVEC (unpublished results). Altogether, these results suggest that VEGF cannot stimulate Flk-1/KDR via an autocrine mechanism. Up-regulation of Flk-1/KDR protein levels was also reported in other studies using either endothelial cells from human saphenous veins infected with an adenoviral vector encoding VEGF165 (Weisz et al. 2001), or mouse cerebral slices incubated with recombinant VEGF165 (Kremer et al. 1997). These data suggest that Flk-1/KDR is regulated by VEGF synergistically with other factors, such as transforming growth factor-ß, tumor necrosis factor-
and shear stress (Ferrara & Davis-Smyth 1997, Shen et al. 1998).
The up-regulation of VEGF expression by E2 has been established in vivo in the injured-carotid model of angiogenesis in which E2 increases re-endothelialization (Concina et al. 2000) while a direct modulation of Flk-1/KDR appears to be very inconsistently observed, suggesting that, in this model also, E2 regulates angiogenesis mainly through a paracrine VEGF action.
In conclusion, we describe the effects of E2 on the increase in Flk-1/KDR expression in a sex steroid-responsive tissue - the human and mouse uterus. The increase in Flk-1/KDR expression by E2 leading to an increase in angiogenesis is secondary to an E2 up-regulation of VEGF expression, previously observed in vivo, associated with VEGF-induced Flk-1/KDR expression in endothelial cells as shown in this study.
| Funding |
|---|
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Ancelin M, Buteau-Lozano H, Meduri G, Osborne-Pellegrin M, Sordello S, Plouet J & Perrot-Applanat M 2002 A dynamic shift of VEGF isoforms with a transient and selective progesterone-induced expression of VEGF189 regulates angiogenesis and vascular permeability in human uterus. PNAS 99 60236028.
Bausero P, Freitas S, Meduri G & Perrot-Applanat M 1998 Paracrine action of VEGF in the human endometrium: regulation by ovarian steroids. Angiogenesis 2 167182.[Medline]
Bausero P, Mazucatelli JP, Bloy C & Perrot-Applanat M 2000 Estradiol, tamoxifen and hypoxia modulate vascular endothelial growth factor in human vascular smooth muscle cells. American Journal of Physiology 20332042.
Bieche I, Parfait B, Nogues C, Andieu C, Vidaud D, Spyratos F, Lidereau R & Vidaud M 2001 The CGA gene as new predictor of the response to endocrine therapy in ER alpha-positive postmenopausal breast cancer patients. Oncogene 20 69556959.[CrossRef][Web of Science][Medline]
Concina P, Sordello S & Barbacanne MA 2000 The mitogenic effect of 17 beta-estradiol on in vitro endothelial cell proliferation and on in vivo re-endothelialization are both dependent on vascular endothelial growth factor. Journal of Vascular Research 37 202208.[CrossRef][Web of Science][Medline]
Couse JF, Curtis SW, Washburn TF, Eddy EM, Schomberg DW & Korach KS 1995 Disruption of the mouse oestrogen receptor gene: resulting phenotypes and experimental findings. Biochemical Society of Transplantation 23 929935.
Critchley HOD, Brenner RM, Henderson TA, Williams K, Nayak NR, Slayden OD, Millar MR & Saunders PTK 2001 Estrogen receptor beta, but not estrogen receptor alpha, is present in the vascular endothelium of the human and nonhuman primate endometrium. Journal of Clinical Endocrinology and Metabolism 86 13701378.
Cullivan-Bove K & Koos RD 1993 Vascular endothelial growth factor/vascular permeability factor expression in the rat uterus: rapid stimulation by estrogen correlates with estrogen-induced increases in uterine capillary permeability and growth. Endocrinology 133 829837.
Curtis S, Clark J, Myers P & Korach K 1999 Disruption of estrogen signaling does not prevent progesterone action in the estrogen receptor
knockout mouse uterus. PNAS 96 36463651.
Enmark E, Pelto-Huikko M, Grandien K, Lagercrantz S, Lagercrantz J, Fried G, Nordenskjöld M & Gustafsson 1997 Human estrogen receptor ß gene structure, chromosomal localisation, and expression pattern. Journal of Clinical Endocrinology 82 42584265.
Ferrara N & Davis-Smyth T 1997 The biology of vascular endothelial growth factor. Endocrinology Review 18 425.
Ferrara N, Gerber HP & LeCouter J 2003 The biology of VEGF and its receptors. Nature Medicine 9 669676.[CrossRef][Web of Science][Medline]
Gargett CE, Zaitseva M, Bucak K, Chu S, Fuller PJ & Rogers PA 2002 17-Beta-estradiol up-regulates vascular endothelial growth factor receptor-2 expression in human myometrial microvascular endothelial cells: role of estrogen receptor-alpha and -beta. Journal of Clinical Endocrinology and Metabolism 87 43414349.
Gille H, Kowalski J, Li B, LeCouter J, Moffat B, Zioncheck TF, Pelletier N & Ferrara N 2001 Analysis of biological effects and signaling properties of Flt-1 (VEGFR-1) and KDR (VEGFR-2). A reassessment using novel receptor-specific vascular endothelial growth factor mutants. Journal of Biological Chemistry 276 32223230.
Giudice L 1996 The endometrial cycle. In Reproductive Endocrinology, Surgery and Technology, pp 272300. Eds EY Adashi, JA Rock & Z Rosenwaks. Philadelphia: Lippincolt-Raven Publishers.
Heryanto B, Lipson KE & Rogers PA 2003 Effects of angiogenesis inhibitors on oestrogen-mediated endometrial endothelial cell proliferation in the ovariectomized mouse. Reproduction 125 337346.[Abstract]
Jaffe EA, Nachman RL, Becker CG & Minick CR 1973 Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. Journal of Clinical Investigation 52 27452756.[Web of Science][Medline]
Kremer C, Breier G, Risau W & Plate KH 1997 Up-regulation of Flk-1/vascular endothelial growth factor receptor 2 by its ligand in a cerebral slice culture system. Cancer Research 57 38523859.
Kurita T, Lee K, Saunders PT, Cooke PS, Taylor JA, Lubahn DB, Zhao C, Makela S, Gustafsson JA, Dahiya R & Cunha GR 2001 Regulation of progesterone receptors and decidualization in uterine stroma of the estrogen receptor-alpha knockout mouse. Biology of Reproduction 64 272283.
Lazennec G, Bresson D, Lucas A, Chauveau C & Vignon F 2001 ER beta inhibits proliferation and invasion of breast cancer cells. Endocrinology 142 41204130.
Lecce G, Meduri G, Ancelin M, Bergeron C & Perrot-Applanat M 2001 Presence of estrogen receptor beta in the human endometrium through the cycle: expression in glandular, stromal, and vascular cells. Journal of Clinical Endocrinology and Metabolism 86 13791386.
Meduri G, Bausero P & Perrot-Applanat M 2000 Expression of vascular endothelial growth factor receptors in the human endometrium: modulation during the menstrual cycle. Biology of Reproduction 62 439447.
Millauer B, Wizigmann-Voos S, Schnurch H, Martinez R, Moller NP, Risau W & Ullrich A 1993 High affinity VEGF binding and developmental expression suggest Flk-1 as a major regulator of vasculogenesis and angiogenesis. Cell 72 835846.[CrossRef][Web of Science][Medline]
Morales DE, McGowan KA, Grant DS, Maheshwari S, Bhartiya D, Cid MC, Kleinman HK & Schnaper HW 1995 Estrogen promotes angiogenic activity in human umbilical vein endothelial cells in vitro and in a murine model. Circulation 91 755763.
Perrot-Applanat M 2000 Hormonal regulation of vascular cell function: angiogenesis. In Encyclopedic Reference of Vascular Biology and Pathology pp 157162. Ed A Bikfalvi. Heidelberg: Springer Verlag.
Perrot-Applanat M, Deng M, Fernandez H, Lelaidier C, Meduri G & Bouchard P 1994 Immunohistochemical localization of estradiol and progesterone receptors in human uterus throughout pregnancy: expression in endometrial blood vessels. Journal of Clinical Endocrinology and Metabolism 78 216224.[Abstract]
Saunders PTK, Millar MR, Williams K, Macpherson S, Harkiss D, Anderson RA, Orr B, Groome NP, Scobie G & Fraser HM 2001 Differential expression of estrogen receptor ER
and ERß and androgen receptor in the ovaries of marmosets and humans. Biology of Reproduction 63 10981105.
Shen BQ, Lee DY, Gerber HP, Keyt BA, Ferrara N & Zioncheck TF 1998 Homologous up-regulation of KDR/Flk-1 receptor expression by vascular endothelial growth factor in vitro. Journal of Biological Chemistry 273 2997929985.
Shifren JL, Tseng JF & Zaloudek CJ 1996 Ovarian steroid regulation of vascular endothelial growth factor in the human endometrium: implications for angiogenesis during the menstrual cycle and in the pathogenesis of endometriosis. Journal of Clinical Endocrinology and Metabolism 81 31123118.
Spyridopoulos I, Sullivan AB, Kearney M, Isner JM & Losordo DW 1997 Estrogen receptor-mediated inhibition of human endothelial cell apoptosis. Estradiol as a survival factor. Circulation 95 15051514.
Stefano GB, Prevot V, Beauvillain JC, Cadet P, Fimiani C, Welters I, Fricchione GL, Breton C, Lassalle P, Salzet M & Bilfinger TV 2000 Cell-surface estrogen receptors mediate calcium-dependent nitric oxide release in human endothelia. Circulation 101 15941597.
Weisz A, Koren B, Cohen T, Neufeld G, Kleinberger T, Lewis BS & Flugelman Y 2001 Increased vascular endothelial growth factor 165 binding to kinase insert domain-containing receptor after infection of human endothelial cells by recombinant adenovirus encoding the VEGF165 gene. Circulation 103 18871892.
Received 16 September 2005
Accepted 17 October 2005
Made available online as an Accepted Preprint 3 November 2005
This article has been cited by other articles:
![]() |
J. E Girling and P. A W Rogers Regulation of endometrial vascular remodelling: role of the vascular endothelial growth factor family and the angiopoietin-TIE signalling system Reproduction, December 1, 2009; 138(6): 883 - 893. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C Caires, J. de Avila, and D. J McLean Vascular endothelial growth factor regulates germ cell survival during establishment of spermatogenesis in the bovine testis Reproduction, October 1, 2009; 138(4): 667 - 677. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-C. Hoffmann, K. D. Danenberg, H. Taubert, P. V. Danenberg, and P. Wuerl A Three-Gene Signature for Outcome in Soft Tissue Sarcoma Clin. Cancer Res., August 15, 2009; 15(16): 5191 - 5198. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Osol and M. Mandala Maternal Uterine Vascular Remodeling During Pregnancy Physiology, February 1, 2009; 24(1): 58 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Alvarez, I. Alonso-Muriel, G. Garcia, J. Crespo, J. Bellver, C. Simon, and A. Pellicer Implantation is apparently unaffected by the dopamine agonist Cabergoline when administered to prevent ovarian hyperstimulation syndrome in women undergoing assisted reproduction treatment: a pilot study Hum. Reprod., December 1, 2007; 22(12): 3210 - 3214. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Naciff, G. J. Overmann, S. M. Torontali, G. J. Carr, Z. S. Khambatta, J. P. Tiesman, B. D. Richardson, and G. P. Daston Uterine Temporal Response to Acute Exposure to 17{alpha}-Ethinyl Estradiol in the Immature Rat Toxicol. Sci., June 1, 2007; 97(2): 467 - 490. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Punyadeera, V.L. Thijssen, S. Tchaikovski, R. Kamps, B. Delvoux, G.A.J. Dunselman, A.F.P.M. de Goeij, A.W. Griffioen, and P.G. Groothuis Expression and regulation of vascular endothelial growth factor ligands and receptors during menstruation and post-menstrual repair of human endometrium Mol. Hum. Reprod., June 1, 2006; 12(6): 367 - 375. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |