|
|
||||||||
1 Life and Health Sciences Research Institute (ICVS), School of Health Sciences, University of Minho, Campus Gualtar, Braga, Portugal
2 Institute for Molecular and Cell Biology, Rua do Campo Alegre, Porto, Portugal
3 ICBAS, University of Porto, Largo Professor Abel Salazar, Porto, Portugal
4 Molecular Endocrinology Unit, Instituto de Investigaciones Biomédicas Alberto Sols, CSIC & UAM, Madrid, Spain
5 Department of Production & Systems Engineering, University of Minho, Campus Gualtar, Braga, Portugal
(Requests for offprints should be addressed to J A Palha, Life and Health Sciences Research Institute (ICVS), School of Health Sciences, University of Minho, Campus Gualtar, 4710-057 Braga, Portugal; Email: japalha{at}ecsaude.uminho.pt)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Thyroid hormones are essential for the proper development of the central nervous system and regulate many different functions both during development and in the adult organism. Among these is the regulation of basal cellular metabolism (Silva 2003). The majority of thyroid hormone actions are mediated by the transcriptional activation or repression of target genes. T3, the biologically active hormone, derived from circulating T3 or from local deiodination of T4 by deiodinases, interacts with nuclear receptors that bind to response elements in target genes (Ribeiro et al. 1995). Deiodinase enzymes are, therefore, important modulators of thyroid hormone action, and respond (both at the mRNA and protein and activity levels) in accordance with altered thyroid hormone availability (Bianco et al. 2002).
Exposure to cold induces a physiological adaptation of the basal cellular metabolism (Pecqueur et al. 2001), in which there is an increased rate of aerobic cellular metabolism and the production of heat by adaptive (or facultative) thermogenesis. Heat production is accomplished by the activation of uncoupling proteins that dissipate the proton gradient across the inner mitochondrial membrane (Nedergaard et al. 2001). In rodents, brown adipose tissue (BAT) is the major site of adaptive thermogenesis. BAT responsiveness to cold, initiated by norepinephrine (NE), elicits an increase in cAMP that results in the activation of several genes including those of uncoupling protein 1 (UCP1) (Bouillaud et al. 1984, Silva & Rabelo 1997) and deiodinase type 2 (DII) (Silva & Larsen 1983, Klingenspor 2003). Augmented T3 resulting from increased DII activity also contributes to regulation of heat production by uncoupling proteins, enzymes of the basal cell metabolism and elements of the NE signaling pathway (Silva & Larsen 1983, Ribeiro et al. 2000, Silva 2001, Klingenspor 2003).
Extreme thyroid hormone deficiency is induced by ablation of thyroid tissue. Thyroid hormone plasma content decreases to less than 5% of normal values in 15 days after thyroidectomy in rats, but T4 and T3 are still detected in tissues after 4 months (Obregon et al. 1981). It appears reasonable to assume that the circulating pool of hormone bound to a carrier protein, namely to TTR, contributes to the amount of serum thyroid hormones after thyroidectomy.
In order to investigate whether TTR has a storage/buffer role in thyroid hormone homeostasis, we challenged TTR-null mice to cold exposure and removal of the thyroid gland, conditions of moderate and extremely increased hormone demand respectively.
| Materials and Methods |
|---|
|
|
|---|
All experiments were conducted using 1-month-old wild-type or TTR-null mice (Episkopou et al. 1993), in accordance with National and European Union guidelines for the care and handling of laboratory animals. Mice, under 12 h light cycles, were given chow and tap water freely.
Exposure to cold
Control animals kept at 23 ± 1 °C and cold-exposed animals kept at 4 ± 2 °C were individually housed and provided with minimal bedding material. Daily body weight and food intake were registered. Animals, fasted overnight, were killed by rapid decapitation 1 month after the onset of exposure to cold; serum and tissue samples of liver, kidney, interscapular BAT and brain (excluding cerebellum and brainstem) were rapidly frozen in dry ice and stored at 80 °C until analysis. Separate aliquots of liver and BAT samples were collected for RNA extraction.
Thyroidectomy
Total thyroid gland removal or sham surgeries were performed under ketamine (150 mg/kg) plus medeto-midine (0.3 mg/kg) i.p. anesthesia. Since removal of thyroid follicles in adult rats by surgical thyroidectomy is not always totally successful, thyroidectomized animals received, 1 week later, 100 µCi 131I to ensure complete removal of thyroid tissue. One week was usually left between the surgery and the radio-thyroidectomy, so that plasma thyroid-stimulating hormone (TSH) had time to increase and to ensure maximal uptake by remnants of the radioiodine. This, however, imposes some restrictions on the experimental procedures, because destruction of thyroid remnants and excretion of 131I-labeled compounds from the body is not immediate and 131I in serum and tissues may interfere with later determinations by RIA. This is the reason for waiting until a week before killing the animals. Moreover, previous work (Obregon et al. 1981) indicates that disappearance of T4 and T3 from plasma at 2 weeks after thyroidectomy occurs rapidly, as expected from the short biological half-lives, but both iodothyronines may still be found in many tissues. Because the parathyroids were removed along with the thyroid gland, thyroidectomized animals received 2% calcium lactate in their drinking water. Either 1 or 2 weeks after 131I injection, animals were anesthetized as described above, and heparin 0.17% (2030 µl) was administered through the vena cava prior to blood withdrawal, followed by perfusion with 20 ml 0.05 M pH 7.4 phosphate buffer containing 0.9% NaCl. Samples of plasma, liver, kidney, heart, cortex and cerebellum were collected, frozen and stored as described above. To assess complete thyroid removal, animals subjected to this procedure were considered only if the weight gain between the iodine injection and the last day of experiment was less than 15% of their initial body weight, and if plasma TSH values were markedly increased.
TSH determination
TSH plasma levels were measured using the specific RIAs developed for the rat provided by the Rat Pituitary Agency of the National Institute of Diabetes, Digestive and Kidney Diseases (NIDDK, NIH, Bethesda, MD, USA). Results were expressed in weight equivalents of the NIDDK r-TSH RP-3 preparation.
Thyroid hormone determination
T4 and T3 were measured in all samples after extraction and purification of the iodothyronines, as previously described (Morreale de Escobar et al. 1985, 1994). In brief, methanol was added to the frozen sample and it was homogenized. Tracer amounts of [131I]T4, and [125I]T3, were added to each homogenate, followed by extraction of endogenous and added tracers with chloroformmethanol (2:1). The iodothyronines were then back-extracted into an aqueous phase and purified using AG 1 x 2 resin columns (Bio-Rad, Hercules, CA, USA). After a pH gradient, the iodothyronines were eluted with 70% acetic acid and evaporated to dryness. Each extract was counted to determine the recovery of the [131I]T4 and [125I]T3 added to each sample during the initial homogenization process. The samples were then used to determine T4 and T3 content. Each sample was processed in duplicate at two dilutions. Concentrations were calculated from the respective RIAs, taking into account the individual recovery and tissue sample weight.
In the case of the cold-exposure experiment, in which the animals were not perfused, during the calculations we took into consideration the plasma content of each tissue, as previously determined (Palha et al. 1997).
RNA extraction and semiquantative RT-PCR
Total RNA was isolated from liver and BAT using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturers instructions. cDNA synthesis was performed using the SupersScript First-Strand Synthesis System for RT-PCR (Invitrogen) and semiquantitative multiplex PCR reactions were performed as previously described (Wong et al. 1994). Briefly, each PCR cycle was composed of the following steps: 94 °C for 30 s, 60 °C for 45s and 72 °C for 60s. A sequential series of PCR reactions using each primer pair was performed initially to determine the number of cycles in which the amplification would reside within the exponential phase of the amplification curve for both the gene under study and the housekeeping gene, hypoxanthine guanine phosphoribosyl transferase (HPRT). In accordance we chose 27, 26, 30 and 25 cycles for deiodinase type 1 (DI), DII, TBG or UCP1 respectively. Using an established primer-dropping method (Wong et al. 1994), 21 cycles were used to amplify the HPRT gene in the same reaction in which the gene under study was amplified.
The oligonucleotide primers for DI, DII, TBG, UCP1 and HPRT were synthesized using the Primer3 software (Rozen & Skaletsky 2000) on the basis of the following GenBank sequences: AY575783 [GenBank] (TBG); NM007860 (DI); NM010050 (DII); U63419 [GenBank] (UCP1); XM356404 (HPRT). The sequences of oligonucleotide primers were: DI sense, CTGGAAAAGCTTTGCACTCC, DI anti-sense, AGGGTGACACTCTGGATTGG; DII sense, ATGGGACTCCTCAGCGTAGACTTGC, DII anti-sense, TGAACCAAAGTTGACCACCA; UCP1 sense, GTCCTAGGGACCATCACCA, UCP1 anti-sense, CCCGTGTAGCGGGGTTT; HPRT sense, GCTGG TGAAAAGGACCTCT, HPRT anti-sense CACAGG ACTAGAACACCTGC; TBG sense, CAACAGGGCT TCCAACATTT, TBG anti-sense, TGGTGCTCTTG TCCACTGAG.
Aliquots of the PCR products (10 µl) were separated by 2% agarose gel electrophoresis and stained with ethidium bromide. Gels were visualized with AlphaImager 2200 (AlphaInnotech, San Leandro, CA, USA) and analyzed densitometrically with the corresponding AlphaEase software. The expression level of the housekeeping gene HPRT was used as an internal standard, to which other PCR amplification products were normalized.
In another set of experiments, we confirmed the data obtained with the Quantum RNA 18S internal standards (Ambion, Austin, TX, USA) as housekeeping gene.
Statistics
Body weight and food intake comparisons were made using Students t-test with P < 0.05 considered as statistically significant. T4 and T3 levels were compared by two-way (strain and exposure to cold) ANOVA, after testing for homogeneity of variance by Levenes test. Logarithmic transformation ensured homogeneity of variance when this was not found with the raw data. The F statistic was considered significant at P < 0.05.
Because removal of the thyroid results in a drastic reduction of thyroid hormone levels, it is not possible to apply a parametric statistical test that includes both the results from the sham-operated animals and those of the thyroidectomized ones. Therefore, we chose to compare, independently, the effect of thyroid removal in each experimental group (TTR-null vs wild-type) and the two strains within each experimental condition (sham or thyroidectomy), using Students t-test.
All values presented are means ± S.D. from four to nine samples per group. Statistical analyses were performed with SPSS version 12.0 for Windows (SPSS, Inc., Chicago, IL, USA).
| Results |
|---|
|
|
|---|
Body weight and food intake We chose 1-month-old animals because they were expected to grow rapidly during the 1-month duration of the experiment, and an effect of the absence of TTR could be more easily disclosed. At the beginning of the experiment (day zero), wild-type and TTR-null mice had similar body weights both in the groups maintained at room temperature (20.4 ± 2.9 and 18.7 ± 3.2 g respectively) and in the cold (20.7 ± 2.4 and 19.7 ± 1.6 g respectively). Increase in body weight at the end of the experiment (day 30) was similar in the animals kept at room temperature (wild-type: 22.4 ± 2.9 g and TTR-null: 24.3 ± 1.9 g) and in the cold (wild-type: 22.9 ± 1.7 g and TTR-null: 23.7 ± 1.3 g) and was not influenced by the absence of TTR.
As expected, exposure to cold led to statistically significant increases in food intake for both wild-type (8.2 ± 0.4 g/day) and TTR-null (9.0 ± 0.4 g/day) mice when compared with food consumption at room temperature (3.3 ± 0.6 and 3.7 ± 0.4 g/day respectively).
Thyroid hormone concentrations
The effects of exposure to cold on thyroid hormone concentrations are presented in Fig. 1
.
|
TTR total serum T4 was strongly reduced in TTR-null mice both at room temperature and when mice were exposed to cold (F = 4.562, P = 0.05).
The slight difference in total T4 brain levels in animals kept at room temperature seemed to be attenuated by exposure to cold.
Exposure to cold resulted in increased T3 concentrations in all organs studied, and this was identical for both wild-type and TTR-null mice. However, in the serum this effect was not as pronounced in the TTR-null mice, since we observed a strain effect (F = 9.899, P < 0.01). T3 derives mainly from local T4 deiodination. Interestingly, and in accord with the lower T4 levels we found in the kidney of cold-exposed TTR-null mice, the increase in T3 induced by exposure to cold was less pronounced in the TTR-null mice (F = 4.996, P < 0.05).
A summary of the ANOVA is presented in Table 1
.
|
|
As seen on Fig. 2c
, after 1 month at 4 °C, a statistically significant increase in the mRNA for UCP1 was similarly observed in wild-type and TTR-null mice.
In order to investigate whether TBG could compensate for the absence of TTR in the cold, we measured the levels of liver TBG mRNA. TBG mRNA was similarly down-regulated (P < 0.05) by cold, in TTR-null and wild-type mice, five and four times respectively. No statistical differences were seen for the TBG expression levels between TTR-null and wild-type mice at room temperature or in the cold.
Effects of thyroidectomy on thyroid hormone metabolism in TTR-null mice
Thyroid hormone concentrations In the absence of thyroid, there is no synthesis or secretion of thyroid hormones, and in such animals we can assess the possible role of TTR in mobilizing existing hormone stores. The weight gain of the thyroidectomized mice between the radioiodine injection and the last day of experiment was less than 15% of their initial body weight; plasma TSH values were markedly increased (> 16 ng/ml) after thyroidectomy and were clearly indicative of a hypothyroid state.
Two (Fig. 3
) or 3 weeks (data not shown) after removal of the thyroid gland there was a drastic and similar reduction in T4 and T3 plasma and tissue levels, whether TTR was present or absent. While for the plasma T4, the strain effect continued to be present when the thyroid was ablated, for the heart, a smaller T3 decrease was observed in the TTR-null mice (F = 12.540, P < 0.01). A summary of the statistical analysis is presented on Table 2
.
|
|
| Discussion |
|---|
|
|
|---|
We have previously shown that TTR is not required for normal T4 tissue uptake or distribution, and its absence does not impair hormone tissue contents, despite the low circulating levels of total T4 (Palha et al. 1994, 1997). Even the absence of TTR from the choroid plexus, where it represents the major protein synthesized, does not influence the proper access and distribution of T4 within the brain (Palha et al. 2000). Considering that the TTR-null mice have normal free thyroid hormone levels, the data obtained so far from studying these mice are in agreement with the free hormone hypothesis (Mendel 1989), as previously discussed (Palha et al. 1994).
However, carrier proteins are believed to have buffer/reservoir roles (Schreiber 2002), and this should become apparent if conditions of increased hormone demand are imposed. Exposure to cold represents a physiological situation of increased cellular metabolic activity for which thyroid hormones are required.
We chose 1-month-old animals because they were expected to grow rapidly during the 1-month duration of the experiment, and an effect of the absence of TTR could be more easily observed. In the cold, part of the reducing equivalents derived from fuel oxidation are lost to produce heat. Therefore, adaptation to cold includes an increase in food intake and, at least in the initial phases, increased mobilization of stored energy. If TTR-bound T4 were important in the cold-induced increased demand for thyroid hormones, we would expect the TTR-null mice to adapt poorly or perhaps fail to survive at all in a cold environment. This was not the case. TTR-null mice adapted as well as the wild-type mice to a 1 month exposure to 4 °C: both genotypes responded with an increase in food intake and changes in serum and tissue thyroid hormone content. In addition, body weight gain was also similar in the two groups of animals.
The increased need for thyroid hormone induced by cold is reflected in the elevation of serum and tissue T3, which we show here to be similar for TTR-null and wild-type mice. T3, the biologically active thyroid hormone, derives mainly from the local deiodination of T4 (Silva & Larsen 1985, Bianco et al. 2002). This explains the observed decrease in T4 tissue content and increase in T3 content associated with exposure to cold, especially in the liver, which produces a major fraction of circulating T3 (Bianco et al. 2002). In accord, we observed an increase in the liver mRNA levels of DI after 1 month of cold exposure. The facts that kidney T3 did not increase in the TTR-null as much as in the wild-type and that circulating T3 mainly derives from thyroid and peripheral (liver and kidney) T4 deiodination might explain that in the cold-exposed animals the increase in serum T3 in the TTR-null was not as pronounced as in the wild-type mice.
Interestingly, exposure to cold did not induce changes in T4 brain content within each genotype, despite the increase seen for T3. There is controversy on the effect of cold on the activity of brain DII (Silva & Larsen 1983, Anguiano et al. 1995, Sullo et al. 2003). Whether the increase in T3 observed by exposure to cold results from increased T4 and/or T3 delivery to the brain or altered DII and/or DIII activities remains to be elucidated. In any case, it is interesting to note that the slight, but statistically significant lower T4 content found in the TTR-null brain at room temperature is not aggravated, but rather disappears, upon exposure to cold. It is possible that in the absence of a carrier/buffer protein such as TTR in the choroid plexus, and in conditions of increased hormone demand, T4 has more ready access to the brain via the bloodchoroid plexusCSF route.
Thyroid hormones are important for adaptive thermogenesis in BAT. Adaptation to cold is mediated by production of heat, a process that is accomplished by the dissipation of the protein gradient by the BAT-specific mitochondrial protein UCP1. By inducing the expression of UCP1, both T3 and NE (Bianco et al. 1988) contribute to the maintenance of a normal thermal condition. UCP1-induced activation by T3 is, in itself, indirectly dependent on sympathetic stimulation of DII (Klingenspor 2003). The absence of TTR did not influence the expected increase in BAT DII mRNA upon exposure to cold. With respect to UCP1, acute (Bianco et al. 2002) and chronic (Zaninovich et al. 2002, Liebig et al. 2004) exposure to cold is described as inducing mRNA levels and protein activity. In accord, in our experiment, the levels of UCP1 BAT mRNA were increased in both wild-type and TTR-null mice 1 month (chronic) after exposure to cold, although the increase is relatively mild compared with the changes described after acute exposure.
We expected that in such conditions of increased cellular metabolism as those required in adaptive thermogenesis, the absence of the major thyroid hormone carrier would trigger hypothyroidism and cold intolerance. In fact, hypothyroid rodents (Bianco et al. 2002, Zaninovich et al. 2002) and mice depleted of all thyroid hormone receptors (Golozoubova et al. 2004) are cold intolerant. With the present data we clearly show that TTR does not seem to play a buffer or storage role useful for conditions of increased hormone demand. Interestingly, exposure to cold in guinea pigs has been described as decreasing plasma T4-binding capacity, which was attributed to a decrease in circulating albumin (Yamada et al. 1969). Here we show that, in the cold, TBG mRNA levels are also down-regulated, similarly in TTR-null and wild-type mice. The lower plasma T4-binding capacity induced by cold would further aggravate impaired response to cold of TTR-null mice, if TTR were important for hormone delivery to tissues, which the present study excludes.
Total thyroidectomy induces marked hypothyroidism and may ultimately result in death. In such extreme situations, it is expected that viability might be prolonged by an increased availability of stored hormone. We chose thyroidectomy to evaluate the importance of TTR-bound T4 in an acute and extreme condition of thyroid hormone deprivation. Removal of the thyroid gland induces growth arrest (Evans et al. 1964) and both the TTR-null and the wild-type mice presented a marked decrease in body weight gain in comparison with their sham-operated counterparts. Two weeks after ablation of the thyroid, TTR-null and wild-type mice showed similar drastic reductions in T4 and T3 plasma and tissue levels, which were not further aggravated 3 weeks after thyroid ablation (data not shown). These observations are in accord with those previously reported in rats. In rats, thyroid hormones tissue levels are strongly reduced upon thyroidectomy and this decrease is not significantly aggravated up to 4 months after thyroidectomy (Obregon et al. 1981). In the present case, it is clear that the TTR-bound T4 does not delay and/or attenuate the decrease in tissue thyroid hormones, as measured at 2 and 3 weeks after removal of the thyroid gland. TBG mRNA levels, known to be up-regulated in hypothyroidism and to correlate with TBG serum levels (Vranckx et al. 1990), were similarly induced by thyroidectomy in TTR-null and wild-type mice. Therefore, as we have previously shown for TTR-null mice kept in normal housing conditions (Palha et al. 1994), TBG does not compensate for the absence of TTR.
Taken together, adaptation to a moderately or extremely increased need for thyroid hormone does not appear to be influenced by the presence of a TTR-bound T4 pool. Therefore, TTR does not seem to be important as a reservoir for thyroid hormones in conditions of increased hormone demand. This conclusion raises two major issues, namely, the redundancy of TTR as a plasma hormone carrier, and the importance of further investigating the function of TTR. Redundancy might be expected when other proteins fulfill identical carrier roles, as is the case for albumin and TBG for thyroid hormones. Studies in Nagase analbuminemic rats have excluded a major role for albumin in thyroid hormone homeostasis in normal conditions (Mendel et al. 1989). A single report indicates that analbuminemic rats when fasted and exposed to cold survive less than controls (Kawaguchi et al. 1986). However, since albumin is a carrier for many other ligands, including free fatty acids, known to influence survival in stressful situations such as exposure to cold, this is not the appropriate model to study the role of albumin as a thyroid hormone reservoir in conditions such as this. TBG is the major thyroid hormone carrier in man. There are cases of humans with partial or total TBG deficiency, which results in euthyroid hypothyroxinemia (Refetoff 1989, Bartalena 1993). Even though exposure to cold is known to induce alteration in thyroid hormone metabolism in humans (Solter et al. 1989, Sawhney et al. 1995, Do et al. 2004), to the best of our knowledge there are no reports on the ability of these individuals to adapt to cold. Because TTR-null mice are also euthyroid hypothyroxinemic, it is reasonable to believe that humans with TBG deficiency would normally adapt to cold.
It is also possible that in the absence of TTR a compensatory mechanism was developed to substitute TTR in hormone binding. It has been suggested that prostaglandin D2 synthase (L-PGDS) could be such a protein (Beuckmann et al. 1999); however, we have no evidence that L-PGDS is able to bind thyroid hormone in vivo (data not shown). Using electrophoretic and chromatographic approaches we see no other protein replacing TTR in T4 binding (Palha et al. 2000). It is interesting to note that TTR, also a carrier for retinol, does not seem to impair retinoid metabolism under basal conditions, despite the low retinol found in the serum of TTR-null mice (Wei et al. 1995).
Despite these considerations, it is difficult to accept that TTR, the major protein synthesized by the choroid plexus and whose expression is highly conserved throughout evolution and starts early during embryonic development, plays no more than a biologically redundant role. We therefore consider it important to further investigate the role of TTR. We rather believe that the biological relevance of TTR is more than that initially described in the literature, as a carrier for thyroid hormones. Recently it has been shown that TTR is involved in depression-like behavior and exploratory activity, possibly by modulating noradrenergic transmission in the limbic forebrain (Sousa et al. 2004), and that it acts as a cryptic protease (Liz et al. 2004).
| Acknowledgements |
|---|
| Funding |
|---|
This work was supported by the grant POCTI/NSE/37315/2001, from Fundação para a Ciência e Tecnologia (Portugal) and FEDER; J C S is a recipient of a PhD fellowship from Fundação para a Ciência e Tecnologia (Portugal). The authors declare that there is no conflict of interest that would prejudice the impartiality of this work.
| References |
|---|
|
|
|---|
Bartalena L 1993 Studies on thyroxine-binding globulin. Journal of Endocrinological Investigation 16 353371.[Medline]
Beuckmann CT, Aoyagi M, Okazaki I, Hiroike T, Toh H, Hayaishi O & Urade Y 1999 Binding of biliverdin, bilirubin, and thyroid hormones to lipocalin-type prostaglandin D synthase. Biochemistry 38 80068013.[CrossRef][Medline]
Bianco AC, Sheng XY & Silva JE 1988 Triiodothyronine amplifies norepinephrine stimulation of uncoupling protein gene transcription by a mechanism not requiring protein synthesis. Journal of Biological Chemistry 263 1816818175.
Bianco AC, Salvatore D, Gereben B, Berry MJ & Larsen PR 2002 Biochemistry, cellular and molecular biology, and physiological roles of the iodothyronine selenodeiodinases. Endocrine Reviews 23 3889.
Bouillaud F, Ricquier D, Mory G & Thibault J 1984 Increased level of mRNA for the uncoupling protein in brown adipose tissue of rats during thermogenesis induced by cold exposure or norepinephrine infusion. Journal of Biological Chemistry 259 1158311586.
Chanoine JP, Alex S, Fang SL, Stone S, Leonard JL, Korhle J & Braverman LE 1992 Role of transthyretin in the transport of thyroxine from the blood to the choroid-plexus, the cerebrospinal-fluid, and the brain. Endocrinology 130 933938.[Abstract]
Davis PJ, Spaulding SW & Gregerman RI 1970 The three thyroxine-binding proteins in rat serum: binding capacities and effects of binding inhibitors. Endocrinology 87 978986.[ISI][Medline]
Dickson PW, Aldred AR, Menting JG, Marley PD, Sawyer WH & Schreiber G 1987 Thyroxine transport in choroid plexus. Journal of Biological Chemistry 262 1390713915.
Do NV, Mino L, Merriam GR, LeMar H, Case HS, Palinkas LA, Reedy K & Reed HL 2004 Elevation in serum thyroglobulin during prolonged Antarctic residence: effect of thyroxine supplement in the polar 3,5,3'-triiodothyronine syndrome. Journal of Clinical Endocrinology and Metabolism 89 15291533.
Dratman MB, Crutchfield FL & Schoenhoff MB 1991 Transport of iodothyronines from bloodstream to brain: contributions by blood:brain and choroid plexus:cerebrospinal fluid barriers. Brain Research 554 229236.[CrossRef][ISI][Medline]
Episkopou V, Maeda S, Nishiguchi S, Shimada K, Gaitanaris GA, Gottesman ME & Robertson EJ 1993 Disruption of the transthyretin gene results in mice with depressed levels of plasma retinol and thyroid-hormone. PNAS 90 23752379.
Evans ES, Rosenberg LL, Evans AB & Koneff AA 1964 Relative sensitivity of different biological responses to small quantities of thyroxine and triiodothyronine. Endocrinology 74 770779.
Golozoubova V, Gullberg H, Matthias A, Cannon B, Vennstrom B & Nedergaard J 2004 Depressed thermogenesis but competent brown adipose tissue recruitment in mice devoid of all hormone-binding thyroid hormone receptors. Molecular Endocrinology 18 384401.
Hagen GA & Solberg LA Jr 1974 Brain and cerebrospinal fluid permeability to intravenous thyroid hormones. Endocrinology 95 13981410.[ISI][Medline]
Harms PJ, Tu GF, Richardson SJ, Aldred AR, Jaworowski A & Schreiber G 1991 Transthyretin (prealbumin) gene-expression in choroid-plexus is strongly conserved during evolution of vertebrates. Comparative Biochemistry and Physiology. B, Comparative Biochemistry 99 239249.
Kawaguchi T, Shimode M, Matsushita H & Nagase S 1986 Frequent administration of uric acid extends survival of fasting analbuminemic rats under cold environment. Japanese Journal of Physiology 36 295303.[Medline]
Klingenspor M 2003 Cold-induced recruitment of brown adipose tissue thermogenesis. Experimental Physiology 88 141148.[Abstract]
Liebig M, von Praun C, Heldmaier G & Klingenspor M 2004 Absence of UCP3 in brown adipose tissue does not impair nonshivering thermogenesis. Physiological and Biochemical Zoology 77 116126.[CrossRef][Medline]
Liz MA, Faro CJ, Saraiva MJ & Sousa MM 2004 Transthyretin, a new cryptic protease. Journal of Biological Chemistry 279 2143121438.
Mendel CM 1989 The free hormone hypothesis: a physiologically based mathematical model. Endocrine Reviews 10 232274.[Abstract]
Mendel CM, Cavalieri RR, Gavin LA, Pettersson T & Inoue M 1989 Thyroxine transport and distribution in Nagase analbuminemic rats. Journal of Clinical Investigation 83 143148.
Morreale de Escobar G, Pastor R, Obregon MJ & Escobar del Rey F 1985 Effects of maternal hypothyroidism on the weight and thyroid hormone content of rat embryonic tissues, before and after onset of fetal thyroid function. Endocrinology 117 18901900.[Abstract]
Morreale de Escobar G, Calvo R, Escobar del Rey F & Obregon MJ 1994 Thyroid hormones in tissues from fetal and adult rats. Endocrinology 134 24102415.[Abstract]
Nedergaard J, Golozoubova V, Matthias A, Asadi A, Jacobsson A & Cannon B 2001 UCP1: the only protein able to mediate adaptive non-shivering thermogenesis and metabolic inefficiency. Biochimica et Biophysica Acta 1504 82106.[Medline]
Obregon MJ, Mallol J, Escobar del Rey F & Morreale de Escobar G 1981 Presence of L-thyroxine and 3,5,3'-triiodo-L-thyronine in tissues from thyroidectomized rats. Endocrinology 109 908913.[Abstract]
Palha JA 2002 Transthyretin as a thyroid hormone carrier: function revisited. Clinical Chemistry and Laboratory Medicine 40 12921300.[Medline]
Palha JA, Episkopou V, Maeda S, Shimada K, Gottesman ME & Saraiva MJM 1994 Thyroid-hormone metabolism in a transthyretin-null mouse strain. Journal of Biological Chemistry 269 3313533139.
Palha JA, Hays MT, Morreale de Escobar G, Episkopou V, Gottesman ME & Saraiva MJM 1997 Transthyretin is not essential for thyroxine to reach the brain and other tissues in transthyretin-null mice. American Journal of Physiology 35 E485E493.
Palha JA, Fernandes R, Morreale de Escobar G, Episkopou V, Gottesman M & Saraiva MJ 2000 Transthyretin regulates thyroid hormone levels in the choroid plexus, but not in the brain parenchyma: study in a transthyretin-null mouse model. Endocrinology 141 32673272.
Palha JA, Nissanov J, Fernandes R, Sousa JC, Bertrand L, Dratman MB, Morreale de Escobar G, Gottesman M & Saraiva MJ 2002 Thyroid hormone distribution in the mouse brain: the role of transthyretin. Neuroscience 113 837847.[CrossRef][ISI][Medline]
Pecqueur C, Couplan E, Bouillaud F & Ricquier D 2001 Genetic and physiological analysis of the role of uncoupling proteins in human energy homeostasis. Journal of Molecular Medicine 79 4856.[CrossRef][ISI][Medline]
Resetoss S 1989 Inherited thyroxine-binding globulin abnormalities in man. Endocrine Reviews 10 215293.
Ribeiro RC, Apriletti JW, West BL, Wagner RL, Fletterick RJ, Schaufele F & Baxter JD 1995 The molecular biology of thyroid hormone action. Annals of the New York Academy of Sciences 758 366389.[ISI][Medline]
Ribeiro MO, Lebrun FL, Christoffolete MA, Branco M, Crescenzi A, Carvalho SD, Negrao N & Bianco AC 2000 Evidence of UCP1-independent regulation of norepinephrine-induced thermogenesis in brown fat. American Journal of Physiology. Endocrinology and Metabolism 279 E314E322.
Rozen S & Skaletsky H 2000 Primer3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology 132 365386.
Sawhney RC, Malhotra AS, Nair CS, Bajaj AC, Rajan KC, Pal K, Prasad R & Basu M 1995 Thyroid function during a prolonged stay in Antarctica. European Journal of Applied Physiology and Occupational Physiology 72 127133.[Medline]
Schreiber G 2002 The evolutionary and integrative roles of transthyretin in thyroid hormone homeostasis. Journal of Endocrinology 175 6173.[Abstract]
Schreiber G, Aldred AR, Jaworowski A, Nilsson C, Achen MG & Segal MB 1990 Thyroxine transport from blood to brain via transthyretin synthesis in choroid plexus. American Journal of Physiology 258 R338R345.
Silva JE 2001 The multiple contributions of thyroid hormone to heat production. Journal of Clinical Investigation 108 3537.[CrossRef][ISI][Medline]
Silva JE 2003 The thermogenic effect of thyroid hormone and its clinical implications. Annals of Internal Medicine 139 205213.
Silva JE & Larsen PR 1983 Adrenergic activation of triiodothyronine production in brown adipose-tissue. Nature 305 712713.[CrossRef][Medline]
Silva JE & Larsen PR 1985 Potential of brown adipose tissue type II thyroxine 5'-deiodinase as a local and systemic source of triiodothyronine in rats. Journal of Clinical Investigation 76 22962305.
Silva JE & Rabelo R 1997 Regulation of the uncoupling protein gene expression. European Journal of Endocrinology 136 251264.[Abstract]
Solter M, Brkic K, Petek M, Posavec L & Sekso M 1989 Thyroid hormone economy in response to extreme cold exposure in healthy factory workers. Journal of Clinical Endocrinology and Metabolism 68 168172.[Abstract]
Sousa JC, Grandela C, Fernandez-Ruiz J, de Miguel R, de Sousa L, Magalhaes AI, Saraiva MJ, Sousa N & Palha JA 2004 Transthyretin is involved in depression-like behaviour and exploratory activity. Journal of Neurochemistry 88 10521058.[CrossRef][ISI][Medline]
Sullo A, Brizzi G & Maffulli N 2003 Serotonin effect on deiodinating activity in the rat. Canadian Journal of Physiology and Pharmacology 81 747751.[Medline]
Vranckx R, Rouaze M, Savu L, Nunez EA, Beaumont C & Flink IL 1990 The hepatic biosynthesis of rat thyroxine binding globulin (TBG): demonstration, ontogenesis, and up-regulation in experimental hypothyroidism. Biochemical and Biophysical Research Communications 167 317322.[CrossRef][ISI][Medline]
Wei S, Episkopou V, Piantedosi R, Maeda S, Shimada K, Gottesman ME & Blaner WS 1995 Studies on the metabolism of retinol and retinol-binding protein in transthyretin-deficient mice produced by homologous recombination. Journal of Biological Chemistry 270 866870.
Wong H, Anderson WD, Cheng T & Riabowol KT 1994 Monitoring mRNA expression by polymerase chain reaction: the primer-dropping method. Analytical Biochemistry 223 251258.[CrossRef][ISI][Medline]
Yamada T, Fukuda H, Takemura Y & Shichijo K 1969 Effect of cold on plasma protein-thyroxine interaction in the guinea pig. Metabolism 18 339347.[Medline]
Zaninovich AA, Raices M, Rebagliati I, Ricci C & Hagmuller K 2002 Brown fat thermogenesis in cold-acclimated rats is not abolished by the suppression of thyroid function. American Journal of Physiology. Endocrinology and Metabolism 283 E496E502.
Received in final form 23 August 2005
Accepted 23 August 2005
Made available online as an Accepted Preprint 9 September 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |