|
|
||||||||
Departamento de Bioquímica y Biología Molecular, Facultad de Medicina, Universidad Complutense, Ciudad Universitaria, 28040 Madrid, Spain
(Requests for offprints should be addressed to Elvira Alvarez; Email: eao513{at}med.ucm.es)
| Abstract |
|---|
|
|
|---|
435) increased the internalisation rate by 268%, and the replacement of EVQ408410 by alanine (GLPR A408410) increased this process to 296%. In both receptors, the efficacy in stimulating adenylate cyclase was decreased. All the receptors studied were internalised by coated pits, except for the receptor with a deletion of the last 44 amino acids, which also had a faster resensitisation rate. Our findings indicate that the neighbouring trans-membrane domain of the carboxyl-terminal tail of the GLP-1 receptor contains sequence elements that regulate agonist-dependent internalisation and transmembrane signalling. | Introduction |
|---|
|
|
|---|
Receptor desensitisation is a regulatory process through which cells attenuate their biological response (Lohse 1993, Freedman & Lefkowitz 1996, Böhn et al. 1997b). G-protein-coupled receptors are desensitised by two mechanisms: homologous desensitisation, which is an agonist-specific response, and heterologous desensitisation, which is a process dependent on the activation of a different receptor. Desensitisation is mediated by receptor phosphorylation and arrestins may bind to phosphorylated receptors and cause uncoupling from G-proteins (Böhn et al. 1997b). This process may be followed by internalisation in acidified endosomes (Ferguson et al. 1996, Goodman et al. 1996). Following this, receptors are dephosphorylated, recycling to the cell surface being necessary for resensitisation (Pipping et al. 1995, Garland et al. 1996).
Recently, the presence of anchoring and scaffold proteins bound to subcellular structures and associated with protein kinases, protein phosphatases and adaptor proteins has been reported. This may facilitate the action of these proteins involved in the signalling process (Pawson & Scott 1997).
The glucagon-like peptide-1 (GLP-1) receptor is a member of the G-protein-coupled receptor subfamily (Dillon et al. 1993, Thorens 1993, Thorens et al. 1993, Alvarez et al. 1996), which includes secretin, calcitonin, parathyroid hormone (PTH), vasoactive intestinal peptide, glucose-dependent insulinotrophic polypeptide, glucagon-like peptide-2 (GLP-2), and glucagon receptors. GLP-1 receptors mediate the effects of GLP-1(736)amide or GLP-1(737) on peripheral tissues, such as the stimulation of glucose-induced insulin secretion (Kreymann et al. 1987, Weir et al. 1989), arterial blood pressure, and pulmonary surfactant production (Barragán et al. 1994, Benito et al. 1998), and in the central nervous system they exert an inhibitory effect on food and water intake (Navarro et al. 1996, Tang-Christensen et al. 1996, Turton et al. 1996, Rodriguez de Fonseca et al. 2000). GLP-1 has a therapeutic potential in patients with type 2 diabetes. Treatment with this peptide lowers plasma glucose in diabetic subjects (Toft-Nielsen et al. 1999). It has been reported that the internalisation of the GLP-1 receptor is mainly mediated by clathrin-coated pits (Widmann et al. 1995), and that it can be prevented through use of a mutant receptor lacking 33 amino acids from the C-terminal tail containing three phosphorylation sites (Widmann et al. 1996, 1997). We attempted to use a GLP-1 receptor lacking the 44 amino acids from the C-terminal tail and we found only a 47% slower internalisation rate than with wild-type receptors. In an effort to gain a better understanding of the molecular events involved in the internalisation and signal transduction generated through GLP-1 receptors, here we characterised different mutants of GLP-1 receptors, allowing us to study the relationship between signal transduction and receptor internalisation. Thus, we tested the effect of deletions and also point mutations of the amino acids E408, V409 and Q410 within the cytoplasmic tail of the GLP-1 receptor. Our results indicate that the domain close to transmembrane region VII of the cytoplasmic tail of GLP-1 receptors also has sequence elements involved in the regulation of agonist-dependent internalisation and in the transmembrane signalling process.
Investigation of the signalling and desensitisation of the GLP-1 receptor is of considerable physiological and pathological importance. The activation of signalling through these receptors and the overexpression of the GLP-1 receptor have been proposed as therapeutic strategies for the treatment of neurodegenerative processes and to improve glucose-dependent insulin synthesis and secretion.
| Materials and Methods |
|---|
|
|
|---|
A HindIII-XbaI fragment of rat GLP-1 receptor cDNA (Thorens 1993) was subcloned into PUC 18. Site-directed mutagenesis was carried out using the Transformer site-directed mutagenesis kit from Clontech (Palo Alto, CA, USA). A silent mutation strategy was used to create a BfrI restriction site at nucleotide 1322, using a mutagenic primer (5' CCCCTTAAGTGTCCCACCAGC 3') and a selection primer (5' GTGTATCTTATGCCAAGTACG 3') to eliminate a unique NdeI restriction site in the vector. A clone (BfrI) was selected and mutation was confirmed by sequencing, using an automated LKB ALF DNA sequencer (Amersham Pharmacia Biotech, Barcelona, Spain).
PUC18-GLPR BfrI was used to eliminate residues 436463. The plasmid was cleaved with BfrI and PstI, followed by treatment with mung bean nuclease to generate blunt ends, after which the plasmid was religated. PUC 18-GLPR BfrI was also used to eliminate residues 419435. In this case, the plasmid was cleaved with BfrI, followed by fill-in of 5' overhangs to generate blunt ends. After Eco47 III digestion, the plasmid was religated. The sequence was confirmed by sequencing, using an automated LKB ALF DNA sequencer. HindIII-XbaI mutant cDNAs were then cloned into the expression vector pcDNA3 (pcDNA3-GLPR 435R and pcDNA3-GLPR 419
435).
pcDNA3-GLPR was digested with Eco47 III and PstI, and this was followed by treatment with mung bean nuclease to eliminate single-stranded extensions. Finally, the plasmid was religated (pcDNA3-GLPR 418R). The sequence was confirmed by sequencing, using an automated LKB ALF DNA sequencer.
For substitution of amino acids E408, V409, and Q410 by alanine, PCR site-directed mutagenesis was used, employing standard procedures. The following primers were used: two flanking primers - GLPR-1 oligonucleotide, corresponding to nucleotides 969993 and GLPR-2 oligonucleotide, corresponding to nucleotides 13841411 (Thorens 1993); the specific mutation primers GLPR-3 (5' TGTCAACAATGCGGCCGCGATGGAGTTTCG 3') and GLPR-4 (5' TCCATCGCGGCCGCATTGTT GACAAAG 3') were used to mutate EVQ into alanine residues. Mutation identity was verified by sequence analysis using an automated LKB ALF DNA sequencer. The fragments containing the mutated gene were sub-cloned into the SacI/PstI restriction sites of pcDNA3-GLPR to create (pcDNA3-GLPR A408410). GLP-1 receptors were expressed in CHO cells by transfection, using the calcium phosphate method (Chen & Okayama 1987). Transfected cells were selected by incubation with neomycin (400 mg/l) (geneticin, GIBCO, Life Technologies, Barcelona, Spain). Stable colonies were isolated using cloning rings.
Binding of 125I-GLP-1(736)amide to cell surface receptors
GLP-1(736)amide was radiolabelled with 125I by the Chloramine T method and mono 125I-GLP-1(736)amide was isolated by reverse-phase HPLC (Calvo et al. 1995). Specific activity was between 3500 and 4000 d.p.m./fmol. Cells grown in 24-well plates (2x105/well) were washed with serum-free medium and incubated for 30 min at 37°C in KRH (118 mM NaCl, 5 mM KCl, 1.2 mM MgSO4, 2.5 mM CaCl2, 25 mM HEPES, pH 7.4) with 0.5% bovine serum albumin (BSA). Then, cells were chilled on ice, and 125I-GLP-1(736)amide (0.1 nM) and unlabelled GLP-1(736)amide (0500 nM) were added for 16 h at 4 °C. Following this, cells were washed three times with cold medium and solubilised with 1 M NaOH. Non-specific binding of 125I-GLP-1(736)amide was estimated in the presence of 500 nM unlabelled ligand, and this value was subtracted from the total binding values. For covalent cross-linking analysis, 125I-GLP-1(736)amide was bound as described above. The cells were washed twice with cold medium, washed in the same medium without BSA, and cross-linking was initiated by the addition of 0.5 mM disuccinimidyl suberate (DSS) for 15 min at 4 °C. The reaction was quenched with 10 mM TrisHCl, pH 7.4, and 1 mM EDTA and solubilised with Laemmli sample buffer (Laemmli 1970), and samples were analysed by SDS-PAGE and autoradiography.
cAMP production assays
cAMP levels were measured with the cAMP Biotrack enzyme immunoassay system (Amersham Pharmacia Bio-tech) following the manufacturers instructions. Briefly, untransfected CHO cells and cells expressing wild-type and mutant GLP-1 receptors were grown in 12-well plates in F-12 medium supplemented with 5% FBS. CHO cells were washed and incubated in F-12 medium containing 0.1% FBS overnight. Cells were then washed with HBS medium (130 mM NaCl, 0.9 mM NaH2PO4, 0.8 mM MgSO4, 5.4 mM KCl, 1.8 mM CaCl2, 20 mM HEPES, pH 7.4, plus 25 mM glucose) and incubated in HBS containing 1 mM IBMX and 0.1% BSA in the presence or absence of different concentrations of GLP-1(736)amide (0.001 100 nM) for 8 min. Then, cells were washed with HBS, treated with lysis buffer, and immediately processed for immunoassay. In parallel experiments, the binding of 125I-GLP-1(736)amide to cell surface receptors was determined at 4 °C. Agonist-stimulated cAMP production was normalised by 125I-GLP-1(736)amide bound to cell surface receptors.
Detection of phospho ERK1/ERK2
CHO cells expressing wild-type and mutant GLP-1 receptors were washed and incubated in F-12 medium containing 0.2% FBS overnight. Cells were treated in the absence or presence of 10 nM GLP-1(736)amide for different times and were subsequently lysed in 25 mM HEPES (pH 7.4), 1% Triton X-100, 1% deoxycholate, 0.1% SDS, 5 mM EDTA, 500 mM NaCl, 50 mM NaF, 5 mM pyrophosphate, 1 mM orthovanadate, 10 µM leupeptin and 1 mM PMSF. Proteins from each sample (50 µg) were resolved by SDS-PAGE and electrotrans-ferred onto a nitrocellulose filter. After blocking in TBS (20 mM Tris, pH 7.4, and 150 mM NaCl) containing 0.1% Tween-20 and 5% non-fat dry milk overnight at 4 °C, the filter was incubated in TBS 2% non-fat dry milk 0.1% Tween-20 with a polyclonal (1: 1000) phospho-specific anti-ERK antibody obtained from New England Biolabs (Beverly, MA, USA) for 12 h at room temperature. After washing off excess antibody, the filters were incubated with an anti-rabbit horseradish peroxidase-conjugated secondary antibody (1: 3000) (Amersham Pharmacia Biotech) for 1 h at room temperature. Chemiluminescence detection was carried out using the ECL reagents.
Internalisation of the GLP-1 receptor
The internalisation rate was measured as previously described (Alvarez et al. 1990). Briefly, CHO cells were incubated in KRH with 0.5% BSA at 37 °C for 30 min. Then, cells were incubated with 0.1 nM 125I-GLP-1(736)amide, and 125I-GLP-1(736)amide binding was determined at different times. Intracellular 125I-GLP-1(736)amide was measured as cell-associated radioactivity resistant to acid wash by incubation of the cells for 3 min at 4 °C with 50 mM NaCl, 150 mM glycine (pH 3.0). Cell surface-bound 125I-GLP-1(736)amide was calculated by subtraction of the intracellular bound 125I-GLP-1(736)amide from the total binding.
Redistribution of cell surface GLP-1 receptors
CHO cells were seeded in 24-well plates and incubated with 10 nM GLP-1(736)amide for different times (3, 6, 10, 15, 30 and 60 min). Then, cells were washed at 0 °C and subsequently incubated for 3 min at 0 °C with 50 mM NaCl, 150 mM glycine (pH 3.0) to remove ligand bound to the cell surface and washed with KRH containing 0.5% BSA. Cell surface receptors were then measured as described above.
Effect of metabolic inhibitors and hypertonic medium on the internalisation process
For metabolic depletion, CHO cells were washed twice with glucose-free HBS buffer and incubated in the same buffer containing 20 mM 2-deoxyglucose and 10 mM sodium azide. Hypertonic treatment was performed as previously described (Heuser & Anderson 1989, Hansen et al. 1993). Briefly, cells were washed twice with HBS containing 0.45 M sucrose and incubated in the same medium for 30 min at 37 °C. Then, cells were incubated with 0.1 nM 125I-GLP-1(736)amide and after a 6-min incubation cell-associated radioactivity and acid wash-resistant radioactivity were measured as previously described.
Data analysis
Data for competition experiments were analysed by nonlinear regression with the GraphPad Prism computer program (GraphPad Software, San Diego, CA, USA). Dissociation constants (Kd) and concentrations of receptor sites (Bmax) were calculated from IC50 values using the method of Cheng and Prusoff (1973). Data are expressed as means±S.E.M. Statistical comparisons were performed using the Students t-test and Newman-Keuls test with at least three separate experiments performed in duplicate.
| Results |
|---|
|
|
|---|
A series of mutant receptors containing deletions and point mutations within the cytoplasmic tail of GLP-1 receptors was constructed (Fig. 1
).
|
|
|
CHO cells expressing wild-type or mutant receptors were used to analyse their binding properties with GLP-1(736)amide. The data from the competition binding assays are shown in Fig. 3A
. The Kd and Bmax calculated from the IC50 values are shown in Table 2
and revealed a similar pattern of displacement of the radioactive peptide by increasing amounts of the unlabelled peptide in the wild-type, GLPR 435R- and GLPR 418R- expressing cell lines. The competition binding data of wild-type and mutant receptors best fitted a single-site model.
|
|
Activation of adenylate cyclase
Agonist binding to the GLP-1 receptor resulted in the stimulation of adenylate cyclase, as determined by the increase in intracellular cAMP contents. The doseresponse curve after GLP-1(736)amide treatment of CHO cells expressing wild-type receptors is shown in Fig. 4
. The agonist stimulated cAMP production in a dose-dependent manner in CHO cells expressing wild-type receptors; the EC50 of GLP-1(736)amide was 0.18± 0.04, maximal stimulation (Rmax) being observed at 10 nM dose of agonist (Table 2
). CHO cells expressing GLPR 435R and GLPR 418R showed a similar potency and efficacy in stimulating cAMP production (Fig. 4
, Table 2
). Similar results were obtained using a pool of clones expressing the wild-type and mutant GLP-1 receptors.
|
The stimulation of mitogen-activated protein (MAP) kinase pathways by the GLP-1 receptor has been reported. We therefore investigated the ability of wild-type and mutant receptors to interact with this pathway by determining the level of ERK1/ERK2 phosphorylation after GLP-1(736)amide treatment (Fig. 5
). Stimulation of CHO cells expressing wild-type receptors with 10 nM agonist produced an increase in the phosphorylated forms of ERK1/ERK2, the maximum effect being observed after 5-min treatment, thereafter decreasing progressively after longer exposure times.
|
Characterization of GLP-1 receptors with a deletion of amino acids 419435 and effect of the substitution of E408, V409, and Q410 by alanine
The effect of the deletion of amino acids 419435 on the rate of GLP-1 receptor internalisation was measured after the determination of total cell-associated and acid wash-resistant radioactivity as a function of time. As shown in Fig. 2
the apparent first-order endocytic rate constant was 0.46±0.023 min1 and the substitution of E408, V409, and Q410 by alanine also caused an increase in the rate of endocytosis: 0.58±0.08 min1 compared with 0.196±0.016 min1, the value for wild-type receptors. In contrast, deletion of amino acids 419435 and substitution by alanine at residues 408410 did not modify the potency in stimulating cAMP production (Fig. 4
, Table 2
). However, the mutant receptors showed a decreased efficacy as compared with the wild-type receptor (Table 2
). The data from studies designed to analyse the agonist-binding properties are shown in Fig. 3A
. The Kd and Bmax calculated from the IC50 values are shown in Table 2
. These data indicate that both mutations produce minor effects on agonist affinity, but the number of cell surface receptors is dramatically reduced as compared with wild-type receptors (Table 2
).
Redistribution of GLP-1 receptors in the presence of agonist
The continued exposure to the agonist produces desensitisation, with a progressive decrease in the cell surface numbers of GLP-1 receptors. Accordingly, the effect of 10 nM GLP-1(736)amide pretreatment on the number of cell surface GLP-1 receptors was measured (Fig. 6A
). In cells expressing wild-type receptors, receptor numbers at the cell surface decreased to 46.6±4.5% of the initial values during the first 15 min of incubation, thereafter continuing to fall slowly to 36±3.9% after 1 h. However, the number of cell surface receptors in cells expressing GLPR 435R and GLPR 418R decreased much more slowly, with only a 1520% reduction after 15 min, while treatment with GLP-1(736)amide for only 3 min decreased cell surface receptors to 37% in cells expressing GLPR 419
435 and to 20% in cells expressing GLPR A408410.
|
To study whether wild-type and mutant GLP-1 receptors are internalised by clathrin-coated pits, the rate of internalisation was also measured on metabolically depleted cells to analyse whether this process was energy-dependent, and also in the presence of hypertonic medium, which prevents membrane-associated clathrin lattices from being formed and the formation of clathrin-coated vesicles. Under both experimental conditions - metabolic depletion and hypertonic treatment - a similar degree of inhibition of internalisation in cells expressing wild-type (86.5%, 88%), GLPR 419
435 (75.4%, 80.7%) and GLPR A408410 (75%, 72%) receptors was observed (Fig. 6B
). The effect of metabolic inhibitors and hypertonic medium was lower in cells expressing GLPR 435R receptors (41.5% and 46.5%), while in cells expressing GLPR 418R receptors the inhibitory effect of metabolic depletion was 54.3% and the presence of hypertonic medium elicited a reduction of 31%.
| Discussion |
|---|
|
|
|---|
Truncated GLPR 435R and GLPR 418R mutant receptors bound the agonist with similar affinity to that of the wild-type receptors, but in cells expressing GLPR 435R the number of cell surface receptors was increased. The cross-linking assay also revealed that GLP-1(736)amide was specifically bound to those receptors.
To investigate the relationship between internalisation and signal transduction, we explored the ability of the different mutants of the GLP-1 receptor to stimulate adenylyl cyclase as well as the MAP kinase pathway. Our data revealed that receptors with a deletion of the last 27 or 44 amino acids of the cytoplasmic tail conserved a similar potency and efficacy in stimulating adenylyl cyclase. These data agree with the results reported using a mutant receptor lacking 33 amino acids from the C-terminal tail (Widmann et al. 1996) and similar results have been reported for glucagon receptors with C-terminal deletions (Buggy et al. 1997). The effect on the MAP kinase pathway was observed as an increase in phosphorylated forms of ERK-1/ERK-2 promoted by agonist stimulation in cells expressing wild-type GLP-1 receptors. Similar results have been reported previously in both RIN and CHO-GLPR cells (Montrose-Rafizadeh et al. 1999). Other members of this family of G-protein-coupled receptors, such as PTH receptors, also undergo increases in the phospho-ERK-1 form following agonist stimulation (Verheijen & Defize 1997). The effect observed in cells expressing GLPR 435R and GLPR 418R mutant receptors was similar, but the increase in phosphorylated forms of ERK-1/ERK-2 persisted longer. It has previously been reported that stimulation of the MAP kinase pathway by ß-adrenergic receptors requires the interaction of the ligandreceptor complex with adaptor proteins involved in the endocytic process, such as ß-arrestins (Barlic et al. 2000). In our studies, we failed to observe any correlation between the phosphorylation of MAP kinases and the rate of internalisation.
Our data suggest an inhibitory role of the region containing amino acids 419435 in the internalisation process. In further experiments, we analysed the effect of deletion of amino acids 419435 and we also checked the effect of substitution by alanine of the three amino acids, E408, V409 and Q410, close to transmembrane region VII, which are conserved in several members of this G-protein-coupled receptor subfamily. Mutant GLPR 419
435 and GLPR A408410 receptors internalised faster (between 2.3 and 2.96 times) and showed a reduced cAMP production as compared with wild-type receptors. Deletion of residues 419435 and substitution of EVQ by alanines in the GLP-1 receptors decreased the efficacy in stimulating adenylate cyclase activity by approximately 1.8- and 3-fold respectively. These results are in conflict with the notion that the production of this second messenger constitutes the switch to initiate the internalisation process (Widmann et al. 1995). Also, mutant receptors that fail to stimulate G-proteins show internalisation deficiencies (Behya et al. 1994, Moro et al. 1994). Our data are consistent with the results found for mutant receptors that interact with Gs and Gq but that show deficiencies in the internalisation process or those that do not interact with Gs and Gq and are internalised correctly (Cheung et al. 1990, Hunyady et al. 1994). Our data also suggest that endocytosis of the ligandreceptor complex favours its uncoupling from G proteins. Mutant receptors that internalised faster had a reduced cAMP production with a similar EC50 potency. Our data also indicate a correlation between the rate of internalisation and the number of cell surface receptors. Thus, the highest level of GLP-1 receptors at the cell surface was found in cells expressing receptors deficient in internalisation (GLPR 435R), and cells expressing receptors that internalised faster than the wild-type (GLPR A408410 and GLPR 419
435) expressed a reduced number of cell surface receptors.
The effects observed in the internalisation and signalling of mutant GLPR 419
435 and GLPR A408410 receptors might be due to conformational changes in the C-terminal region of the receptor, promoting the interaction of these mutant receptors with adaptor proteins and a faster internalisation. A conformational change of the C-terminal tail has also been proposed to explain the results obtained after mutation of a small region in the proximal portion of the carboxyl tail in ß-adrenergic receptors (Hausdorff et al. 1991). However, in that case the substitution of residues in this region blocked the sequestration and phosphorylation of these receptors. The region of receptor amino acids from 419435 contains Ser431/432, the consensus sequence for protein kinase C. The absence of these residues might regulate the phosphorylation of three doublets involved in the internalisation process: Ser441/442, Ser444/445 and Ser451/452. However, we have previously reported that substitution of Ser431/432 by alanine did not modify either the rate of endocytosis or the potency or efficacy of these receptors in stimulating adenylate cyclase (Vázquez et al. 2005).
The differences in the rate of internalisation also affected the redistribution promoted by agonist exposure. After 15-min exposure with GLP-1(736)amide, cells expressing wild-type receptors conserved 4550% of their cell surface receptors. These data are comparable to the results reported for glucagon receptor internalisation: 4050% of cell surface receptors were internalised in 10 min (Buggy et al. 1997). Cells expressing the truncated mutant receptors GLPR 435R and GLPR 418R, in contrast to cells expressing the wild-type, preserved 8085% of the initial cell surface receptor numbers. However, cells expressing GLPR 419
435 and GLPR A408410 conserved only 37% and 20% of their cell surface receptors respectively after 3-min exposure to the agonist. All these data indicate that, after agonist exposure, cell surface receptors are essentially dependent on the rate of endocytosis, although our findings also suggest differences in the recycling time. Cells expressing GLPR 418R receptors maintained a number of cell surface receptors after exposure to the agonist, similar to cells expressing GLPR 435R receptors; however, the rate of endocytosis was twofold slower for the latter type of receptor.
The data concerning internalisation for receptors lacking the 44 amino acids of the C-terminal tail led us to investigate whether these receptors were internalised through coated pits or through a different pathway. This region contains all the phosphorylation sites so far identified for GLP-1 receptors and previously described to mediate the process of endocytosis by coated pits. The results obtained after hypertonic medium treatment revealed that GLP-1 receptors are mainly internalised by coated pits in cells expressing wild-type and mutant receptors, except in those expressing GLPR 418R, and that 1525% of the rate of endocytosis measured was not dependent on metabolic energy. In the endocytosis experiments, intracellular-associated radioactivity was measured after an acid wash, a procedure that in all cases eliminated 8090% of the radioactivity bound to the cell surface. The percentage of internalisation not dependent on metabolic energy was higher for cells expressing truncated receptors. It is possible that some of these receptors could enter the cell through a pathway that is not dependent on metabolic energy. The presence of hypertonic medium in cells expressing GLPR 418R receptors did not disturb the internalisation of 30% of the receptors, suggesting that these receptors might be internalised by both coated and uncoated pits. Similar results have been reported previously for cells expressing truncated PTH receptors (Huang et al. 1995). These data could also explain the faster rate of resensitisation in cells expressing GLPR 418R receptors. The cholecystokinin A receptor has been reported to be internalised through coated pits and uncoated pits and the authors of that paper suggested that the uncoated pit pathway might be involved in the rapid resensitisation of those receptors (Roettger et al. 1995).
Our results show that the proximal portion of the carboxyl tail of GLP-1 receptors contains sequence elements that regulate agonist-dependent internalisation. Mutations in this GLP-1 receptor region might change the conformation of the cytoplasmic tail and hence alter its functional activity.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Alvarez E, Roncero I, Chowen JA, Thorens B & Blázquez E 1996 Expression of the glucagon-like peptide-1 receptor gene in rat brain. Journal of Neurochemistry 66 920927.[Web of Science][Medline]
Barlic J, Andrews JD, Kelvin AA, Bosinger SE, Dobransky T, Feldman RD, Fergusson SSG & Kelvin DJ 2000 Regulation by Cxcr1 of tyrosine kinase activation and granule release through ß-arrestin. Nature Immunology 1 227233.[CrossRef][Web of Science][Medline]
Barragán JM, Rodriguez R & Blázquez E 1994 Changes in arterial blood pressure and heart rate induced by glucagon-like peptide-1(736)amide in rats. American Journal of Physiology 266 E459E466.
Behya RV, Akeson M, Mrozinssk J, Jensen RT & Battey JF 1994 Internalisation of the gastrin-releasing peptide receptor is mediated by both phospholipase C-dependent and -independent processes. Molecular Pharmacology 46 495501.[Abstract]
Benito E, Blázquez E & Bosch M 1998 Glucagon-like peptide-1(736)amide increases pulmonary surfactant secretion through a cyclic adenosine 3',5'-monophosphate-dependent protein kinase mechanism in rat type II pneumocytes. Endocrinology 139 23632368.
Benya RV, Fathi Z, Battey JF & Jensen RT 1993 Serines and threonines in the gastrin-releasing peptide receptor carboxyl terminus mediate internalisation. Journal of Biological Chemistry 268 2028520290.
Böhn SK, Khitin LM, Smeekens SP, Grady EF, Payan DG & Bunnett NW 1997a Identification of potential tyrosine-containing endocytic motifs in the carboxyl-tail and seventh transmembrane domain of the neurokinin 1 receptor. Journal of Biological Chemistry 272 23632372.
Böhn SK, Grady EF & Bunnett NW 1997b Regulatory mechanisms that modulate signalling by G-protein. Biochemical Journal 322 118.
Buggy JJ, Heurich RO, MacDougall M, Kelly KA, Livingston JN, Yoo-Warren H & Rossomando AJ 1997 Role of the glucagon receptor COOH-terminal domain in glucagon-mediated signalling and receptor internalisation. Diabetes 46 14001405.[Abstract]
Calvo JC, Yusta B, Mora F & Blázquez E 1995 Structural characterization by affinity cross-linking of glucagon-like peptide-1(736)amide receptor in rat brain. Journal of Neurochemistry 64 299306.[Web of Science][Medline]
Chang MP, Mallet WG, Mostov KE & Brodsky FM 1993 Adaptor self-aggregation, adaptor-receptor recognition and binding of alpha-adaptin subunits to the plasma membrane contribute to recruitment of adaptor (AP2) components of clathrin-coated pits. EMBO Journal 12 21692180.[Web of Science][Medline]
Chen C & Okayama H 1987 High-efficiency transformation of mammalian cells by plasmid DNA. Molecular and Cellular Biology 7 27452752.
Cheng Y & Prusoff WH 1973 Relationship between the inhibition constant (KI) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochemical Pharmacology 22 30993108.[CrossRef][Web of Science][Medline]
Cheung AH, Dixon RA, Hill WS, Sigal IS & Strader CD 1990 Separation of the structural requirements for agonist-promoted activation and sequestration of the beta-adrenergic receptor. Molecular Pharmacology 37 775779.[Abstract]
Clague MJ 1998 Molecular aspects of the endocytic pathway. Biochemical Journal 336 271282.
Dillon JS, Tanizawa Y, Wheeler MB, Leng X-H, Ligon BB, Rabin DU, Yoo-Warren H, Permutt MA & Boyd AE III 1993 Cloning and functional expression of the human glucagon-like peptide-1 (GLP-1) receptor. Endocrinology 133 19071910.
Ferguson SSG 2001 Evolving concepts in G-protein-coupled receptor endocytosis: the role in receptor desensitization and signalling. Pharmacological Reviews 53 124.
Ferguson SSG, Downey III WJ, Colapietro A-M, Barak LS, Ménard L & Caron MG 1996 Role of ß-arrestin in mediating agonist-promoted G-protein-coupled receptor internalisation. Science 271 363366.[Abstract]
Freedman NJ & Lefkowitz RJ 1996 Desensitization of G-protein-coupled receptors. Recent Progress in Hormone Research 51 319353.
Garland AM, Grady EF, Lovett M, Vigna SR, Frucht MM, Krause JE & Bunnett NW 1996 Mechanism of desensitization and resensitization of G-protein-coupled neurokinin 1 and neurokinin 2 receptors. Molecular Pharmacology 49 438446.[Abstract]
Ghinea N, Vu Hai MT, Groyer-Picard MT, Houllier A, Schoevaert D & Milgrom E 1992 Pathways of internalisation of the hCG/LH receptor: immunoelectron microscopic studies in Leydig cells and transfected L-cells. Journal of Cell Biology 118 13471358.
Goodman OB, Krupnick JG, Santini F, Gurevich W, Penn RB, Gagnon AW, Keen JH & Benovic JL 1996 Beta-arrestin acts as a clathrin adaptor in endocytosis of the ß2-adrenergic receptor. Nature 383 447450.[CrossRef][Medline]
Hansen SH, Sandvig K & van Deurs B 1993 Clathrin and HA2 adaptors: effects of potassium depletion, hypertonic medium, and cytosol acidification. Journal of Cell Biology 121 6172.
Hausdorff WP, Campbell PT, Ostrowski J. Yu SS, Caron MG & Lefkowitz RJ 1991 A small region of the ß-adrenergic receptor is selectively involved in its rapid regulation. PNAS 88 29792983.
Heuser JE & Anderson RG 1989 Hypertonic media inhibit receptor-mediated endocytosis by blocking clathrin-coated pit formation. Journal of Cell Biology 108 389400.
Hoxie JA, Ahuja M, Belmonte E, Pizarro S, Parton R & Brass LF 1993 Internalisation and recycling of activated thrombin receptors. Journal of Biological Chemistry 268 1375613763.
Huang Z, Chen Y & Nissenson RA 1995 The cytoplasmic tail of the G-protein-coupled receptor for parathyroid hormone and parathyroid hormone-related protein contains positive and negative signals for endocytosis. Journal of Biological Chemistry 270 151156.
Hunyady L, Baukal AJ, Balla T & Catt KJ 1994 Independence of type I angiotensin II receptor endocytosis from G protein coupling and signal transduction. Journal of Biological Chemistry 269 2479824804.
Kreymann B, Williams G, Ghatei MA & Bloom SR 1987 Glucagon-like peptide-1(736): a physiological incretin in man. Lancet 2 13001304.[Web of Science][Medline]
Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 680685.[CrossRef][Medline]
Lohse MJ 1993 Molecular mechanism of membrane receptor desensitization. Biochimica et Biophysica Acta (BBA) 1179 171188.[Medline]
Montrose-Rafizadeh C, Avdonin P, Garant MJ, Rodgers BD, Kole S, Yang H, Levine MA, Schwindinger W & Bernier M 1999 Pancreatic glucagon-like peptide-1 receptor couples to multiple G proteins and activates mitogen-activated protein kinase pathways in Chinese hamster ovary cells. Endocrinology 140 11321140.
Moro O, Shockley MS, Lameh J & Sadée W 1994 Overlapping multi-site domains of the muscarinic cholinergic Hm 1 receptor involved in signal transduction and sequestration. Journal of Biological Chemistry 269 66516655.
Navarro M, Rodriguez de Fonseca F, Alvarez E, Chowen JA, Zueco JA, Gómez R, Eng J & Blázquez E 1996 Colocalization of glucagon-like peptide-1 (GLP-1) receptors, glucose transporter GLUT-2, and glucokinase mRNAs in rat hypothalamic cells: evidence for a role of GLP-1 receptor agonists as an inhibitory signal for food and water intake. Journal of Neurochemistry 67 19821991.[Web of Science][Medline]
Ohno H, Stewart J, Fournier M-C, Bosshart H, Rhee I, Miyatake J, Saito T, Galluser A, Kirchhausen T & Bonifacino JS 1995 Interaction of tyrosine-based sorting signals with clathrin-associated proteins. Science 269 18721875.
Pawson T & Scott JD 1997 Signalling through scaffold, anchoring and adaptor proteins. Science 278 20752080.
Pipping S, Andexinger S & Lohse MJ 1995 Sequestration and recycling of ß2-adrenergic receptors permit receptor resensitization. Molecular Pharmacology 47 666676.[Abstract]
Raposo G, Dunia I, Delavier-Klutchko C, Kaveri S, Strosberg AD & Benedetti EL 1989 Internalisation of beta-adrenergic receptor in A431 cells involves non-coated vesicles. European Journal of Cell Biology 50 340352.[Web of Science][Medline]
Rodriguez de Fonseca F, Navarro M, Alvarez E, Roncero I, Chowen JA, Maestre O, Gómez R, Muñoz RM, Eng J & Blázquez E 2000 Peripheral versus central effects of glucagon-like peptide-1 on satiety and body weight loss in Zucker obese rats. Metabolism 49 110.
Roettger BF, Rentsch RU, Pinon D, Holicky E, Hadac E, Larkin JM & Miller LJ 1995 Dual pathways of internalisation of the cholecystokinin. Journal of Cell Biology 128 10291041.
Sorkin A & Carpenter G 1993 Interaction of activated EGF receptors with coated pit adaptins. Science 261 612615.
Tang-Christensen M, Larsen PJ, Goke R, Fink-Jensen A, Jessop D, Moller M & Sheikh SP 1996 Central administration of GLP-1(736)amide inhibits food and water intake in rats. American Journal of Physiology 271 R848R856.
Thomas WG, Baker KM, Motel TJ & Thekkumkara TJ 1995 Angiotensin II receptor endocytosis involves two distinct regions of the cytoplasmic tail. Journal of Biological Chemistry 270 2215322159.
Thorens B 1993 Expression cloning of the pancreatic ß cell receptor for the gluco-incretin hormone glucagon-like peptide-1. PNAS 89 86418645.
Thorens B, Porret A, Bühler L, Deng S-P, Morel P & Widmann C 1993 Cloning and functional expression of the human islet GLP-1 receptor: demonstration that exendin-4 is an agonist and exendin(939) an antagonist of the receptor. Diabetes 42 16781682.[Abstract]
Toft-Nielsen MB, Madsbad S & Holst JJ 1999 Continuous subcutaneous infusion of glucagon-like peptide-1 lowers plasma glucose and reduces appetite in type 2 diabetic patients. Diabetes Care 22 11371143.
Trowbridge IS, Collawn JF & Hopkins CR 1993 Signal-dependent membrane protein trafficking in the endocytic pathway. Annual Review of Cell and Developmental Biology 9 129161.[CrossRef][Web of Science]
Turton MD, OShea D, Gunn I, Beak SA, Edwards CMB, Meeran K, Choi SJ, Taylor GM, Heath MM, Lambert PD, Wilding JPH, Smith DM, Ghatei MA, Herbert J & Bloom SR 1996 A role for glucagon-like peptide-1 in the central regulation of feeding. Nature 379 6972.[CrossRef][Medline]
Vázquez P, Roncero I, Blázquez, & Alvarez E 2005 Substitution of the cysteine 438 residue in the cytoplasmic tail of the glucagon-like peptide-1 receptor alters signal transduction activity. Journal of Endocrinology 185 3544.
Verheijen MJ & Defize LH 1997 Parathyroid hormone activates mitogen-activated protein kinase via a cAMP-mediated pathway independent of Ras. Journal of Biological Chemistry 272 34233429.
Von Zastrow M & Kobilka BK 1992 Ligand-regulated internalisation and recycling of human beta 2-adrenergic receptors between the plasma membrane and endosomes containing transferrin receptor. Journal of Biological Chemistry 267 35303538.
Von Zastrow M, Link R, Daunt D, Barsh G & Kobilka BK 1993 Subtype-specific differences in the intracellular sorting of G-protein-coupled receptors. Journal of Biological Chemistry 268 763766.
Weir GC, Mojsov S, Hendrich GK & Habener JF 1989 Glucagon-like peptide-1(737) actions on endocrine pancreas. Diabetes 38 338342.[Abstract]
Widmann CH, Dolci W & Thorens B 1995 Agonist-induced internalisation and recycling of the glucagon-like peptide-1 receptor in transfected fibroblasts and in insulinomas. Biochemical Journal 310 203214.
Widmann CH, Dolci W & Thorens B 1996 Desensitization and phosphorylation of the glucagon-like peptide-1 (GLP-1) receptor by GLP-1 and 4-phorbol 12-myristate 13-acetate. Molecular Endocrinology 10 6275.
Widmann CH, Dolci W & Thorens B 1997 Internalisation and homologous desensitization of the GLP-1 receptor dependent on phosphorylation of the receptor carboxyl tail at the same three sites. Molecular Endocrinology 11 10941102.
Received 22 April 2005
Accepted 28 April 2005
This article has been cited by other articles:
![]() |
W. Kim and J. M. Egan The Role of Incretins in Glucose Homeostasis and Diabetes Treatment Pharmacol. Rev., December 1, 2008; 60(4): 470 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. Kumar, L. O. Byerley, J. Volaufova, D. J. Drucker, G. A. Churchill, R. Li, B. York, A. Zuberi, and B. K. S. Richards Genetic variation in Glp1r expression influences the rate of gastric emptying in mice Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2008; 294(2): R362 - R371. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |