|
|
||||||||
Liggins Institute, University of Auckland, Private Bag 92019, Auckland, New Zealand
(Requests for offprints should be addressed to F H Bloomfield; Email: f.bloomfield{at}auckland.ac.nz)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Placental insufficiency is a major contributing factor to many cases of IUGR in the developed world, limiting delivery of nutrients and growth factors to the fetus. We have therefore utilised amniotic fluid, a fetal compartment accessed regularly by clinicians, as a route for administering potential therapies to the IUGR fetus. Insulin-like growth factor (IGF)-I is a major fetal growth factor in late gestation (Oliver et al. 1999), is present in amniotic fluid (Merimee et al. 1984), is nutritionally regulated (Oliver et al. 1996) and circulating levels are correlated with birthweight (Verhaeghe et al. 1993). We have recently reported the effects of chronic, 10-day supplementation of amniotic fluid with a low dose of IGF-I (20 µg/day) in late gestation growth-restricted fetal sheep (Bloomfield et al. 2002a). We found a significant increase in gut weight, with histological evidence of increased gut growth and increased numbers of mitotic bodies in the intestinal crypts. However, there was no increase in fetal body weight or fetal growth rate. In contrast, fetal liver weight was actually 11% lower than that of saline-treated IUGR fetuses, and circulating concentrations of IGF-I were reduced by 3040% (Bloomfield et al. 2002a). This was despite the fact that amniotic fluid IGF-I levels were increased up to fivefold, and that 125I-labelled IGF-I given into amniotic fluid is swallowed by the fetus and is taken up intact across the gut and into the portal venous system and thence into the systemic circulation (Bloomfield et al. 2002b).
The aims of this study were to investigate whether these apparently paradoxical results could be explained by tissue-specific changes in mRNA and protein levels of IGF-I and the type 1 IGF receptor (IGF-1R) in fetal gut tissues, and also in liver, muscle and placenta, which are the sources of circulating IGF-I and of IGF-I clearance in the ovine fetus (Iwamoto et al. 1992, Kind et al. 1995), and of mRNA levels of the IGF-binding proteins (IGFBP)-1, -2 and -3, as the IGFBPs influence IGF-I bioavailability and clearance (Clemmons 1998, Baxter 2000).
| Materials and Methods |
|---|
|
|
|---|
Approval for animal studies was obtained from the institutional animal ethics committee. The experimental protocol for the animal studies has been reported previously in detail (Bloomfield et al. 2002a). In brief, 29 ewes carrying singleton fetuses underwent surgery at 110 days of gestation (term 145 days) for implantation of chronic indwelling vascular and amniotic catheters. After surgery, ewes were housed in individual cages with free access to water and ad libitum quantities of a standard laboratory diet of chaff and pelleted stock feed. Ewes were randomly assigned to one of three groups: a control group (n=9) and two growth-restricted groups. Growth restriction was induced by uteroplacental embolisation using microspheres from 113 to 120 days of gestation, and growth-restricted fetuses were then treated with once daily intra-amniotic injections of 2 ml saline (n=9) or 20 µg human recombinant IGF-I (Pharmacia and Upjohn, Peapack, NJ, USA) mixed with 2 ml fresh amniotic fluid (n=11) for 10 days, from 120 to 130 days of gestation. We calculated that this dose would increase amniotic fluid IGF-I levels tenfold, but the actual increase was approximately fivefold (Bloomfield et al. 2002a). Control fetuses were unembolised and untreated. At 131 days of gestation ewes were killed with an overdose of pentobarbitone and the uterus and contents were rapidly removed. The fetus and placenta were weighed, and samples of fetal liver, muscle (biceps femoris), placenta (type B placentome) and gut (samples collected as follows: stomach, half way along the length of the abomasum; duodenum, first 20 cm of small intestine; jejunum, 20 cm distal to duodeno-jejunal junction; ileum, 20 cm proximal to ileo-caecal valve; colon 20 cm distal to ileo-caecal valve) were snap frozen in liquid nitrogen and stored at 80 °C until analysis. Tissue suitable for mRNA and protein extraction was obtained from nine fetuses in each group.
Measurement of IGF-I and IGF-1R mRNA levels by RT-PCR
Total RNA was extracted by the Trizol method (Gibco BRL, Life Technologies, Auckland, New Zealand). The final concentration of RNA was quantified using spectrophotometric OD260 measurements and purity was assessed by OD260/OD280 ratio, with values > 1.9 being of acceptable purity. RNA integrity was electrophoretically verified on 1.2% formaldehyde agarose gels followed by ethidium bromide staining. RNA were stored at 80 °C until analysis. Following cDNA synthesis from 2.5 µg total RNA, IGF-I and IGF-1R mRNA expression was analysed by relative quantitative RT-PCR. Three RT reactions were performed for each sample and the product pooled, and amplification of each target was then performed in duplicate. Averages of the duplicates were used for analysis. 18s ribosomal RNA was used as an internal control with over-expression curbed by using Ambions quantum Universal 18s rRNA primers and competimers (Ambion Inc., Austin, TX, USA). The optimum ratio of 18s primer to competimer for each gene was determined by serial multiplex PCR reactions containing different 18s rRNA primer:competimer ratios and either the IGF-I or IGF-1R primer. The ratio for which the 18s band was of equal intensity to the target band on subsequent electrophoresis was taken as the optimum ratio. To determine the linear range for amplification of primers, serial multiplex PCR reactions from 18 to 38 cycles were performed for each gene and 18s rRNA. Following gel electrophoresis as described below, individual gene expression was normalised to 18s RNA expression and the arbitrary densitometric units plotted against the number of cycles. The mid-point of the linear part of the curve was selected as the optimum number of cycles; this was 30 for IGF-I and 32 for IGF-1R. Optimum annealing temperatures for both primers were determined by serial PCR reactions at different temperatures keeping other parameters constant, and was 58 °C for both primers. For the 18s primer, the manufacturers recommend an annealing temperature of between 55 and 68 °C. In all reactions, both optimisation and actual experiments, the digoxygenin-labelled nucleotide, dig dUTP (Roche Diagnostics NZ Ltd, Auckland, New Zealand), was incorporated during the PCR reaction. PCR products were electrophoresed through 2% agarose gel, transferred onto a membrane (Roche Diagnostics NZ Ltd) and detected using an alkaline phosphatase (ALP) conjugated anti-digoxygenin antibody (Roche Diagnostics NZ Ltd). CPD Star (Roche Diagnostics NZ Ltd) was used as a chemiluminescent substrate for ALP. Chemiluminescent signals were captured with LabWorks software (UVP BioImaging Systems, Upland, CA, USA) and bands were analysed densitometrically (Scion Image; Scion Corporation, Frederick, MD, USA). All signals are expressed as optical densities relative to the signal for 18s rRNA.
Measurement of IGFBP -1, -2 and -3 mRNA levels by real-time RT-PCR
After performing the above RT-PCR, we acquired a real-time PCR machine and therefore performed analysis of IGFBP mRNA levels using real-time PCR. RNA was extracted as described above. Expression levels were quantitated using a one-step PCR reaction. Briefly, RNA samples were treated with RNase-free DNase I (Invitrogen NZ Ltd, Auckland, New Zealand) before RT-PCR to eliminate any potential genomic DNA. First-strand cDNA was synthesised using SuperScript First-Strand Synthesis System (Invitrogen NZ Ltd) according to the manufacturers instructions. All reactions were treated with RNase H before real-time PCR. PCR amplification was performed in triplicate on an ABI Prism 7900HT Sequence Detector (Applied Biosystems, Foster City, CA, USA) using the standard cycling conditions recommended by the manufacturer (50 °C for 2 min, 95 °C for 10 min, followed by 50 cycles of 95 °C for 15s and 60 °C for 1 min). Singleplex amplification was carried out in 384-well plates with a total reaction volume of 20 µl, containing 10 µl of TaqMan Universal PCR Master Mix (Applied Biosystem), 1 µl cDNA template, 200 nM probe and 900 nM forward and reverse primers. A standard curve of the target gene and 18s were included in each plate, consisting of twofold serial dilutions of cDNA synthesised from stock fetal muscle of identical gestational age. Real-time PCR efficiencies (E) were calculated from the slopes of the standard curves for each target gene (E=101/slope). Samples from the control group were selected as a calibrator. Gene expression in the saline- and IGF-I-treated groups were expressed relative to the calibrator and as a ratio to 18s rRNA using the formula (Pfaffl 2001):
![]() |
Where Etarget is the real-time PCR amplification efficiency of target gene transcript; E18s is the real-time PCR amplification efficiency of 18s;
CPtarget(control treated) and
CP18s(control treated) are the cycle threshold differences between the calibrator (the control group) and the treated group (calculated separately for the IGF-I- and saline-treated groups) for the target gene and 18s rRNA respectively.
Data for real-time PCR are therefore expressed as relative expression ratios to the control group with 95% confidence intervals (CI).
Oligonucleotide primers and probe design
For RT-PCR of IGF-I and IGF-1R, sequences of oligonucleotide primers for IGF-I were selected to cover the end of the 2nd exon and the entire 3rd exon and were designed to include an intron to discriminate products from genomic DNA and cDNA (forward GT GCA TGC TCT CCA GTT CGT and reverse CTT CTG AGC CTT GGG CAT GT (228 bp)). Primers for IGF-1R were specific for the ß-subunit of the IGF-1R gene (forward GCC TCG AAC TTT GTC TTT GC and reverse GCT CAA ATA CTC CGG GTT CA (498 bp)). For real-time RT-PCR, the available ovine sequences for IGFBP-1, -2 and -3 in GenBank were analysed using the Primer Express software (Applied Biosystems) to determine optimum primer and probe locations. A BLAST search was conducted to ensure that primers and probes were not constructed from any homologous regions that would encode for other proteins, and the specificity of the PCR product was confirmed by high-resolution gel electrophoresis to verify that the transcripts were of the predicted molecular size. Each probe was labelled at the 5' end with fluorescein (for the IGFBPs) or VIC (for ribosomal 18s RNA) and at the 3' end with a minor groove-binder non-fluorescent quencher. Primers and probes for target genes were manufactured by Invitrogen NZ Ltd and Applied Biosystems respectively. The probe and primer for ribosomal 18s RNA (18s rRNA) were obtained from Applied Biosystems (Assay-on-Demand). IGFBP-1 (285 bp; accession AF327650 [GenBank] ) forward and reverse primers were constructed from bp 210221 with a sequence of GCCAAACTGCAACAAGAATGG and from bp 242261 with a sequence of TCCGTCCAGCGAAGTCTCA respectively. The probe for IGFBP-1 was located between bp 223 and 241 with a sequence of TTCTATCACAG CAAACAGT. IGFBP-2 (1396 bp; accession S44612 [GenBank] ) forward and reverse primers were constructed from bp 816836 with a sequence of TGACAAGCATGGCCT GTACAA and from bp 858874 with a sequence of CACGCTGCCCGTTCAGA respectively. The probe for IGFBP-2 was located between bp 840 and 856 with a sequence of CAAACAGTGCAAGATGT. IGFBP-3 (360 bp; accession AF327651 [GenBank] ) forward and reverse primers were constructed from bp 5978 with a sequence of GCCAGCGCTACAAGGTTGAC and from bp 104126 with a sequence of CTTGGACTCGGAGGAGAAG TTCT respectively. The probe for IGFBP-1 was located between bp 80 and 95 with a sequence of ACGAGTCT CAGAGCAC.
Measurements of IGF-I and IGF-1R protein by Western blotting
Tissue was homogenised in the presence of Complete Mini EDTA-free protease inhibitors (Roche Diagnostics NZ Ltd), 100 µM sodium orthovanadate and radio immunoprecipitation assay lysis buffer (Sigma Chemical Co.). After centrifugation at 8 000 g at 4 °C for 15 min, protein content was assayed in duplicate by the Bradford protein assay (BioRad New Zealand, Auckland, New Zealand). Protein standards (Invitrogen NZ Ltd) and 30 µg protein were separated by electrophoresis on 15% (IGF-I) or 6% (IGF-1R) SDS polyacrylamide gels at 80 volts for 5 min, then 200 volts until the dye front reached the bottom of the gel. As there were too many samples to fit on one gel, a control pool of protein extracted from fetal liver was included in each gel. Proteins were transferred to nitrocellulose membranes (BioRad New Zealand) at 350 mA for 1.5 h at 4 °C. Equal loading and transfer were visually confirmed by staining with S-Ponceau (Sigma Chemical Co., St Louis, MO, USA). Non-specific binding was blocked by overnight incubation at 4 °C with 5% (w/v) skimmed milk and 0.1% Tween-20 in phosphate-buffered saline (PBS). Blots were then incubated with rabbit anti-human primary antibodies, diluted in blocking solution, for 1 h at room temperature (IGF-I poylclonal, dilution 1:1000 (Abcam Ltd, Cambridge, Cambs, UK), IGF-1R polyclonal to the
-subunit, dilution 1:500 (Chemicon International Inc., Boronia, Australia)). Following PBS/0.1% Tween-20 washes, blots were incubated with secondary antibody (mouse monoclonal anti-rabbit horseradish peroxidase (HRP) conjugate (Sigma Chemical Co.)) at a 1:10 000 dilution in blocking solution for 1 h at room temperature. Specific protein bands were detected by SuperSignal chemiluminescence using SuperSignal West Dura Extended Duration Substrate (Pierce Biotechnology, Rockford, IL, USA) and the signal detected with LabWorks software (UVP Bio-Imaging Systems). Membranes were then stripped and processed for detection of ß-actin in a similar way (primary mouse anti-human monoclonal antibody, dilution 1:2500 (Abcam Ltd), secondary antibody polyclonal rabbit anti-mouse HRP conjugate, dilution 1:10 000 (Abcam Ltd)). Images were analysed using Scion Image (Scion Corporation). All signals are expressed as optical densities relative to the signal for ß-actin. The relative optical densities (ROD) for the control pool were compared between gels of the same tissue to ensure comparable loading and transfer and to enable comparison between gels.
Localisation of IGF-1R protein by immunohistochemistry
Longitudinal sections of jejunum were fixed in 10% buffered formalin, paraffin embedded and mounted onto poly-L-lysine-coated glass slides. Slides were deparaffinised in xylene and rehydrated through a series of ethanol solutions with a final rinse in PBS. All sections were blocked for non-specific reactivity for 2 h at room temperature with 2% normal goat serum in PBS containing 0.5% bovine serum albumin. Sections were then incubated with the primary antibody (mouse monoclonal to IGF-IR (Chemicon International Inc.)) diluted 1:300 in the blocking solution and incubated for 1 h at room temperature. After three washes in PBS, slides were incubated for 1 h at room temperature with the secondary antibody (anti-mouse alkaline phosphatase (ALP) conjugated; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA; 1:300 dilution). After washes with PBS and then with 0.1 M TrisHCl buffer (pH 9.5), the slides were incubated in the dark for 2030 min with ALP substrate until colour developed. Endogenous ALP was blocked with 0.02% levamesole (Sigma Chemical Co.). The reaction was stopped by incubating the slides in 0.1 M Tris EDTA (pH 8.0) buffer for 5 min. Slides were then rinsed in water and mounted in aqua mount (glycerol 9 ml, 1,4-diazabicyclo(2,2,2)octane 233 g (Sigma Chemical Co.), Tris buffer (pH 8) 200 µl and distilled water 800 µl).
For negative controls, sections of each tissue were subjected to identical procedures with the exception of either (a) no primary antibody incubation or (b) replacement of the primary antibody with non-specific mouse IgG (Zymed Laboratories, Gymea, NSW, Australia) at the same dilution (1:300).
Statistical analyses
Data were analysed using one-way ANOVA. If there was a significant effect (P<0.05), differences between groups were compared with the Bonferroni-Dunn post-hoc test (Statview; SAS Institute, Cary, NC, USA). All data are expressed as mean (S.D.).
| Results |
|---|
|
|
|---|
IGF-I and IGF-1R mRNA and protein expression in fetal and placental tissues
For gut tissues, we present data from the stomach, jejunum and colon. Data from duodenum and ileum were similar to stomach and colon and are not shown. Placental embolisation did not alter IGF-I mRNA or protein levels in liver, placenta, muscle or most regions of the gut, although in the jejunum both mRNA and protein levels for IGF-I were reduced (Figs 1
and 2
). Intra-amniotic IGF-I treatment reduced IGF-I mRNA and protein levels in liver, muscle and placenta compared with both control and saline-treated fetuses by between 8 and 30% (Fig. 1
). However, IGF-I mRNA and protein levels in the gut were not altered by IGF-I treatment (Fig. 2
).
|
|
|
|
We performed immunohistochemistry of IGF-1R in the gut to localise the receptor to the luminal or basal aspect of the enterocytes. In sections of jejunum, IGF-1R signal was only detected on the luminal surface of the enterocytes (Fig. 5
).
|
Placental embolisation did not significantly alter mRNA levels of IGFBPs 13 in the liver (Table 1
). In the placenta, IGFBP-3 mRNA levels were increased twofold but there was no significant change in mRNA levels of IGFBP-1 or -2. In the jejunum, IGFBP-1 mRNA levels were decreased by approximately 60%; mRNA levels of IGFBP-2 and -3 were unaltered (Table 1
). Intra-amniotic IGF-I treatment increased mRNA levels of all three IGFBPs in the liver compared with control fetuses (Table 1
). In the placenta, IGFBP-3 mRNA levels were increased and IGFBP-1 mRNA levels were decreased compared with control fetuses. In the jejunum, a similar decrease to that in saline-treated fetuses was seen in IGFBP-1 mRNA levels, but IGFBP-2 and -3 mRNA levels were also decreased by 30% compared with controls. There were no statistically significant differences in mRNA levels of any of the IGFBPs compared with saline-treated fetuses (Table 1
).
|
| Discussion |
|---|
|
|
|---|
IGF-I mRNA and protein levels in the gut were not altered, despite direct exposure of the luminal aspect of the gut to swallowed IGF-I, which we have demonstrated is present in an intact form along the length of the gut (Bloomfield et al. 2002b). As the gut is exposed to both luminal and systemic influences, it may be that the unchanged IGF-I mRNA and protein levels in the gut reflect a balance of the effects of reduced circulating, but elevated local, levels of IGF-I. The developing gut also expresses IGFBP mRNA. In the fetal rat, levels of expression of the IGFBPs increase with advancing gestation (Shoubridge et al. 2001). Although IGF-I treatment enhanced gut growth in our study, morphological development of the small intestine appeared to be delayed with persistence of the apical endocytic complex (Bloomfield et al. 2002a). The reduced mRNA levels of IGFBP-1, -2 and -3 in the gut that we report here may be consistent with delayed functional maturation. IGFBP-2 produced by intestinal cells in vitro has been reported to attenuate the stimulatory effects of IGF-I on DNA synthesis in a dose-dependent manner (Park et al. 1992); the reduced levels of IGFBP-2 in the gut in the IGF-I-treated group would be consistent with enhanced action of the luminally delivered IGF-I and increased mitosis and growth in the gut.
Our finding of up-regulation of mRNA for the IGF-I-1R in the gut in the IGF-I-treated fetuses, confirmed by increased protein expression in the jejunum, may be consistent with the reduced circulating IGF-I concentrations in these fetuses, as IGF-1R mRNA levels are reported to be inversely regulated by IGF-I (Werner et al. 1989, Eshet et al. 1993, Kind et al. 1996, Hernandez-Sanchez et al. 1997). Since we found IGF-1R expression to be confined to the luminal aspect of the gut, where IGF-I concentrations were high, this might suggest that IGF-1R levels here are regulated by systemic factors rather than local factors. However, we did not find an increase in IGF-1R mRNA levels in liver, muscle or placenta after IGF-I treatment, despite the reduced circulating IGF-I concentrations. These results are therefore difficult to explain on the basis of a simple relationship between systemic IGF-I concentrations and tissue IGF-1R mRNA levels, although a concomitant increase in IGF-I and IGF-1R mRNA in the jejunum of fasted rats at the time of refeeding has been reported (Ziegler et al. 1995). IGF-I can act in a paracrine and autocrine fashion in peripheral tissues, including the gut (Jux et al. 1998, Simmons et al. 1999), and both IGF-I and IGF-1R mRNA expression is differentially regulated in a tissue-specific manner (Werner et al. 1989, Butler & LeRoith 2001, Fowden 2003). Our data suggested that, in fetal life, local IGF-I may have different effects on IGF-1R mRNA expression in different tissues, and also different effects from those seen in postnatal life.
We have previously reported reduced liver size and reduced circulating concentrations of IGF-I in these animals (Bloomfield et al. 2002a), and the current findings of reduced mRNA and protein levels of IGF-I in fetal liver, muscle and placenta are consistent with this. In fetal sheep, IGF-I mRNA levels are highest in liver and muscle, suggesting that these organs are the predominant source of circulating IGF-I (Kind et al. 1995). Levels of IGF-I mRNA in these tissues correlate positively with circulating IGF-I concentrations (Kind et al. 1995), and fetal sheep with growth restriction secondary to placental restriction (carunclectomy) have reduced levels of IGF-I mRNA in muscle, but not liver (Kind et al. 1995). It may therefore be surprising that we did not see greater effects on IGF-I mRNA levels in the tissues of embolised fetuses that were treated with saline. We did find a non-significant increase in hepatic IGFBP-1 and a significant increase in placental IGFBP-3 mRNA levels in embolised fetuses, but these changes were small. Circulating IGF-I concentrations fell acutely with embolisation, but had recovered in the saline-treated fetuses by the time of post mortem 10 days later (Bloomfield et al. 2002a). Therefore, any changes in IGF-I or IGFBP mRNA levels associated with a growth-restricting insult, either mediated by increased circulating fetal cortisol concentrations secondary to embolisation (Gagnon et al. 1994) or other mechanisms, may have resolved. Exogenous glucocorticoids have been reported to reduce both circulating IGF-I concentrations and tissue IGF-I mRNA levels (Luo & Murphy 1989, Jensen et al. 2002). However, other studies have reported no effect of glucocorticoids on circulating IGF-I concentrations or tissue IGF-I mRNA levels, but an increase in IGFBP expression, suggesting that IGF bioavailability may be decreased (Mosier et al. 1987, Price et al. 1992).
The decreased hepatic IGF-I mRNA level that we found in the IGF-I-treated fetuses was consistent with the effects of exogenous IGF-I treatment on hepatic IGF-I mRNA levels in malnourished rats (Schalch et al. 1989), growth hormone-deficient dwarf rats (Butler et al. 1994) and hypophysectomised rats (Gosteli-Peter et al. 1994), and also in healthy fetal sheep (Kind et al. 1996). However, we used a very low dose of IGF-I compared with these studies (20 µg/day, approximately 100-fold lower than that used in the study by Lok and colleagues (Kind et al. 1996, Lok et al. 1996)). Although this resulted in a fivefold increase in amniotic fluid IGF-I concentrations (Bloomfield et al. 2002a), portal venous concentrations of IGF-I were not increased, despite demonstrable portal venous uptake of 125I-IGF-I from amniotic fluid in another study (Bloomfield et al. 2002b). However, even if all the IGF-I administered into the amniotic fluid in this study was swallowed, and all the swallowed IGF-I was taken up into the portal vein, we calculate that any change in portal venous concentrations would be below the sensitivity of our assay to detect. Nevertheless, we presume that some exogenous IGF-I was delivered to the liver via the portal circulation. Whether these very small amounts of exogenous IGF-I are sufficient to explain the down-regulation of IGF-I mRNA and protein in the liver is less clear. Furthermore, it seems unlikely that this could explain their down-regulation in muscle, which is a more distal organ. Changes in placental mRNA and protein expression could conceivably occur through local feedback on the placenta of the elevated intra-amniotic IGF-I concentrations. There are some circumstantial data suggesting that the placenta may contribute to the regulation of circulating fetal IGF-I concentrations, taking up IGF-I from the placenta when levels are high (Bassett et al. 1990) and releasing it into the circulation when they are low (Iwamoto et al. 1992). Although the low circulating concentrations in this study may therefore have been expected to result in an increase in placental IGF-I expression, the very high amniotic levels may have had the opposite effect, acting through local receptors on membranes and/or placenta (Ryan et al. 1991).
An alternative explanation for the down-regulation of IGF-I mRNA and protein in distal organs following enteral exposure to IGF-I could be the release of a second messenger from the gut. Possibilities include the IGFBPs, other gut-derived hormones, or nutrient signalling. IGF-I acting at IGF-R1s in the gut can stimulate local release of IGF-I, IGF-II and IGFBPs (Park et al. 1992, Simmons et al. 1999). However, as IGFBP mRNA expression was reduced in the gut, this seems an unlikely signal to the liver.
Gut-derived hormones other than the IGFBPs could include ghrelin and the incretins such as the glucagon-like peptides (Kojima et al. 1999, Burrin et al. 2001). We have demonstrated the presence of ghrelin protein in the stomach of the fetal sheep in this study by immunohisto-chemistry (V Roelfsema, unpublished observation), but do not have quantitative measures of either protein levels in the gut or of circulating concentrations. Ghrelin and the incretins are nutritionally regulated intestinal peptides that are expressed in fetal life and have effects on the somato-trophic and glucose/insulin axes (Roberge & Brubaker 1993, Sjoholm et al. 2000, Petersen et al. 2001, Liu et al. 2002). Investigation into the role of these hormones in future studies of amniotic supplementation of IUGR fetuses with hormones and/or nutrients may provide mechanistic insights.
It is also possible that the effects of enteral IGF-I exposure on distal organs is mediated via effects on specific nutrients. Both IGF-I and the IGFBPs are nutritionally regulated in many species including the fetal sheep (Estivariz & Ziegler 1997, Lee et al. 1997, Clemmons 1991, Oliver et al. 1993, 1996). Furthermore, IGF-I treatment in fetal sheep alters placental nutrient transfer (Harding et al. 1994, Liu et al. 1994, Bloomfield et al. 2002c), although the same effects may not be present in IUGR sheep (Jensen et al. 1999). Furthermore, IGF-1R mRNA was reduced in the placenta following embolisation in this study and, in the IGF-I-treated fetuses, circulating IGF-I concentrations were reduced, suggesting that an effect of IGF-I on placental nutrient transfer is unlikely.
In contrast, local IGF-I concentrations in the lumen of the gut were presumably increased, and IGF-1R mRNA and protein levels were also increased in the jejunum following intra-amniotic IGF-I treatment. There may therefore have been a local effect on nutrient uptake by the gut, which may have had both local and systemic effects. There were no changes in circulating fetal amino acid concentrations, either in arterial or portal venous blood, or in amniotic fluid amino acid concentrations, with IGF-I treatment (Bloomfield et al. 2002d). However, we did find evidence of altered gastrointestinal glutamine metabolism with IGF-I treatment (Bloomfield et al. 2002d). Glutamine and IGF-I have been reported to have a synergistic effect on gut growth. Furthermore, in rats with short bowel syndrome (SBS) secondary to massive gastrointestinal resection, oral glutamine, but not subcutaneous IGF-I, supplementation prevented the reduction in hepatic IGF-I mRNA expression seen with SBS (Ziegler et al. 1996). Thus altered amino acid metabolism by the gut in response to swallowed IGF-I may have influenced hepatic gene expression of components of the IGF axis.
Several studies of growth restriction induced by different means in different species have reported a 1.7- to 10-fold upregulation of hepatic IGFBP-1 and/or BP-2 expression; for example, prolonged hypoxia in sheep (McLellan et al. 1992), maternal fasting (Straus et al. 1991), dexamethasone treatment (Price et al. 1992) and being small for gestational age in the rat (Unterman et al. 1990) and uterine artery ligation in the guinea pig (Carter et al. 2005). We found a 1.7-fold increase in IGFBP-1 expression in liver in the saline-treated fetuses but this was not statistically significant. However, in IGF-I-treated fetuses the increase was sevenfold, with lesser, but significant, increases in IGFBP-2 and IGFBP-3 mRNA levels also. Exogenous IGF administration to the ovine fetus has been reported to increase hepatic IGFBP-1 mRNA levels (Shen et al. 2001), and this is a possibility here also. Alternatively, the altered amino acid metabolism by the gut, as described above, may have contributed to altered nutritional regulation of hepatic IGFBP production.
In summary, we have demonstrated tissue-specific regulation of IGF-I and IGF-1R mRNA and protein levels with intra-amniotic IGF-I supplementation. Despite a fivefold increase in amniotic IGF-I concentrations, hepatic, muscle and placental IGF-I mRNA and protein levels were reduced, consistent with reduced circulating IGF-I concentrations. IGF-1R mRNA and protein levels were not altered by IGF-I treatment in these tissues, despite the reduced circulating IGF-I concentrations. In the gut, IGF-1R mRNA levels were increased, and were localised to the luminal aspect of the intestine where IGF-I concentrations were presumably increased. Furthermore, the reduced IGFBP mRNA levels in the gut in IGF-I-treated fetuses may also have contributed to the increased gut mitosis and growth. The mechanisms and physiological significance of this tissue-specific regulation of IGF-I and IGF-1R mRNA and protein remain uncertain.
| Funding |
|---|
| References |
|---|
|
|
|---|
Bassett NS, Breier BH, Hodgkinson SC, Davis SR, Henderson HV & Gluckman PD 1990 Plasma clearance of radiolabeled IGF-I in the late gestation ovine fetus. Journal of Developmental Physiology 14 7379.[Web of Science][Medline]
Baxter RC 2000 Insulin-like growth factor (IGF)-binding proteins: interactions with IGFs and intrinsic bioactivities. American Journal of Physiology Endocrinology and Metabolism 278 E967E976.
Bloomfield FH, Bauer MK, van Zijl PL, Gluckman PD & Harding JE 2002a Amniotic IGF-I supplements improve gut growth but reduce circulating IGF-I in growth-restricted fetal sheep. American Journal of Physiology Endocrinology and Metabolism 282 E259E269.[Web of Science]
Bloomfield FH, Breier BH & Harding JE 2002b The fate of 125I-IGF-I administered into the amniotic fluid of late gestation sheep. Pediatric Research 51 361369.[Web of Science][Medline]
Bloomfield FH, van Zijl PL, Bauer MK & Harding JE 2002c A chronic low dose infusion of IGF-I alters placental function but does not affect fetal growth. Reproduction, Fertility and Development 14 393400.[CrossRef][Medline]
Bloomfield FH, van Zijl PL, Bauer MK & Harding JE 2002d Effects of intrauterine growth restriction and intra-amniotic insulin-like growth factor-I treatment on blood and amniotic fluid concentrations and on fetal gut uptake of amino acids in late gestation ovine fetuses. Journal of Pediatric Gastroenterology and Nutrition 35 287297.[CrossRef][Web of Science][Medline]
Burrin DG, Petersen Y, Stoll B & Sangild P 2001 Glucagon-like peptide 2: a nutrient-responsive gut growth factor. Journal of Nutrition 131 709712.
Butler AA & LeRoith D 2001 Minireview: tissue-specific versus generalized gene targeting of the IGF1 and IGF1r genes and their roles in insulin-like growth factor physiology. Endocrinology 142 16851688.
Butler AA, Ambler GR, Breier BH, LeRoith D, Roberts CTJ & Gluckman PD 1994 Growth hormone (GH) and insulin-like growth factor-I (IGF-I) treatment of the GH-deficient dwarf rat: differential effects on IGF-I transcription start site expression in hepatic and extrahepatic tissues and lack of effect on type I IGF receptor mRNA expression. Molecular and Cellular Endocrinology 101 321330.[CrossRef][Web of Science][Medline]
Carter AM, Kingston MJ, Han KK, Mazzuca DM, Nygard K & Han VK 2005 Altered expression of IGFs and IGF-binding proteins during intrauterine growth restriction in guinea pigs. Journal of Endocrinology 184 179189.
Clemmons DR 1991 Insulin-like growth factor binding proteins: roles in regulating IGF physiology. Journal of Developmental Physiology 15 105110.[Web of Science][Medline]
Clemmons DR 1998 Role of insulin-like growth factor binding proteins in controlling IGF actions. Molecular and Cellular Endocrinology 140 1924.[CrossRef][Web of Science][Medline]
Eriksson JG, Forsen T, Tuomilehto J, Osmond C & Barker DJ 2001 Early growth and coronary heart disease in later life: longitudinal study. British Medical Journal 322 949953.
Eriksson JG, Forsen T, Tuomilehto J, Jaddoe VW, Osmond C & Barker DJ 2002 Effects of size at birth and childhood growth on the insulin resistance syndrome in elderly individuals. Diabetologia 45 342348.[CrossRef][Web of Science][Medline]
Eshet R, Werner H, Klinger B, Silbergeld A, Laron Z, LeRoith D & Roberts CT Jr 1993 Up-regulation of insulin-like growth factor-I (IGF-I) receptor gene expression in patients with reduced serum IGF-I levels. Journal of Molecular Endocrinology 10 115120.
Estivariz CF & Ziegler TR 1997 Nutrition and the insulin-like growth factor system. Endocrine 7 6571.[Web of Science][Medline]
Fowden AL 2003 The insulin-like growth factors and feto-placental growth. Placenta 24 803812.[CrossRef][Web of Science][Medline]
Gagnon R, Challis J, Johnstone L & Fraher L 1994 Fetal endocrine responses to chronic placental embolization in the late-gestation ovine fetus. American Journal of Obstetrics and Gynecology 170 929938.[Web of Science][Medline]
Gosteli-Peter MA, Winterhalter KH, Schmid C, Froesch ER & Zapf J 1994 Expression and regulation of insulin-like growth factor-I (IGF-I) and IGF-binding protein messenger ribonucleic acid levels in tissues of hypophysectomized rats infused with IGF-I and growth hormone. Endocrinology 135 25582567.[Abstract]
Harding JE & Bloomfield FH 2004 Prenatal treatment of intrauterine growth restriction: lessons from the sheep model. Pediatric Endocrinology Reviews 2 182192.[Medline]
Harding JE, Liu L, Evans PC & Gluckman PD 1994 Insulin-like growth factor 1 alters feto-placental protein and carbohydrate metabolism in fetal sheep. Endocrinology 134 15091514.
Hernandez-Sanchez C, Werner H, Roberts CT Jr, Woo EJ, Hum DW, Rosenthal SM & LeRoith D 1997 Differential regulation of insulin-like growth factor-I (IGF-I) receptor gene expression by IGF-I and basic fibroblastic growth factor. Journal of Biological Chemistry 272 46634670.
Iwamoto HS, Murray MA & Chernausek SD 1992 Effects of acute hypoxemia on insulin-like growth factors and their binding proteins in fetal sheep. American Journal of Physiology Endocrinology and Metabolism 263 E1151E1156.
Jensen EC, Harding JE, Bauer MK & Gluckman PD 1999 Metabolic effects of IGF-I in the growth retarded fetal sheep. Journal of Endocrinology 161 485494.[Abstract]
Jensen EC, Gallaher BW, Breier BH & Harding JE 2002 The effect of a chronic maternal cortisol infusion on the late-gestation fetal sheep. Journal of Endocrinology 174 2736.[Abstract]
Jux C, Leiber K, Hügel U, Blum W, Ohlsson C, Klaus G & Mehls O 1998 Dexamethasone impairs growth hormone (GH)-stimulated growth by suppression of local insulin-like growth factor (IGF)-I production and expression of GH- and IGF-I receptors in cultured rat chondrocytes. Endocrinology 139 32963305.
Kajantie E, Eriksson J, Osmond C, Wood PJ, Forsen T, Barker DJ & Phillips DI 2004 Size at birth, the metabolic syndrome and 24-h salivary cortisol profile. Clinical Endocrinology 60 201207.[CrossRef][Medline]
Kind KL, Owens JA, Robinson JS, Quinn KJ, Grant PA, Walton PE, Gilmour RS & Owens PC 1995 Effect of restriction of placental growth on expression of IGFs in fetal sheep: relationship to fetal growth, circulating IGFs and binding proteins. Journal of Endocrinology 146 2334.
Kind KL, Owens JA, Lok F, Robinson JS, Quinn KJ, Mundy L, Gilmour RS & Owens PC 1996 Intravenous infusion of insulin-like growth factor I in fetal sheep reduces hepatic IGF-I and IGF-II mRNAs. American Journal of Physiology Regulatory, Integrative and Comparative Physiology 271 R1632R1637.[Web of Science]
Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H & Kangawa K 1999 Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402 656660.[CrossRef][Medline]
Lee WH, Gaylord TD, Bowsher RR, Hlaing M, Moorehead H & Liechty EA 1997 Nutritional regulation of circulating insulin-like growth factors (IGFs) and their binding proteins in the ovine fetus. Endocrine Journal 44 163173.[Web of Science][Medline]
Liu L, Harding JE, Evans PC & Gluckman PD 1994 Maternal insulin-like growth factor-I infusion alters feto-placental carbohydrate and protein metabolism in pregnant sheep. Endocrinology 135 895900.[Abstract]
Liu YL, Yakar S, Otero-Corchon V, Low MJ & Liu JL 2002 Ghrelin gene expression is age-dependent and influenced by gender and the level of circulating IGF-I. Molecular and Cellular Endocrinology 189 97103.[CrossRef][Web of Science][Medline]
Lok F, Owens JA, Mundy L, Robinson JS & Owens PC 1996 Insulin-like growth factor-I promotes growth selectively in fetal sheep in late gestation. American Journal of Physiology Regulatory, Integrative and Comparative Physiology 270 R1148R1155.[Web of Science]
Luo JM & Murphy LJ 1989 Dexamethasone inhibits growth hormone induction of insulin-like growth factor-I (IGF-I) messenger ribonucleic acid (mRNA) in hypophysectomized rats and reduces IGF-I mRNA abundance in the intact rat. Endocrinology 125 165171.
McLellan KC, Hooper SB, Bocking AD, Delhanty PJ, Phillips ID, Hill DJ & Han VK 1992 Prolonged hypoxia induced by the reduction of maternal uterine blood flow alters insulin-like growth factor-binding protein-1 (IGFBP-1) and IGFBP-2 gene expression in the ovine fetus. Endocrinology 131 16191628.
Merimee TJ, Grant M & Tyson JE 1984 Insulin-like growth factors in amniotic fluid. Journal of Clinical Endocrinology and Metabolism 59 752755.
Mosier HD Jr, Spencer EM, Dearden LC & Jansons RA 1987 The effect of glucocorticoids on plasma insulin-like growth factor I concentration in the rat fetus. Pediatric Research 22 9295.[Web of Science][Medline]
Oliver MH, Harding JE, Breier BH, Evans PC & Gluckman PD 1993 Glucose but not amino acids regulates plasma insulin-like growth factor (IGF)-I concentrations in fetal sheep. Pediatric Research 34 6265.[Web of Science][Medline]
Oliver MH, Harding JE, Breier BH & Gluckman PD 1996 Fetal insulin-like growth factor (IGF)-I and IGF-II are regulated differently by glucose or insulin in the sheep fetus. Reproduction, Fertility and Development 8 167172.[CrossRef][Medline]
Oliver MH, Bloomfield FH, Harding JE, Breier BH, Bassett NS & Gluckman PD 1999 Endocrine control of perinatal programming in health and disease. Biochemical Society Transactions 27 6973.[Web of Science][Medline]
Osmond C & Barker DJ 2000 Fetal, infant, and childhood growth are predictors of coronary heart disease, diabetes, and hypertension in adult men and women. Environmental Health Perspectives 108 545553.
Ozanne SE 2001 Metabolic programming in animals. British Medical Bulletin 60 143152.
Park JHY, McCusker RH, Vanderhoof JA, Mahammadpour H, Harty RF & MacDonald RG 1992 Secretion of insulin-like growth factor II (IGF-II) and IGF-binding protein-2 by intestinal epithelial (IEC-6) cells: implication for autocrine growth regulation. Endocrinology 131 13591368.
Petersen YM, Burrin DG & Sangild PT 2001 GLP-2 has differential effects on small intestine growth and function in fetal and neonatal pigs. American Journal of Physiology Regulatory, Integrative and Comparative Physiology 281 R1986R1993.[Web of Science]
Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 e45.
Price WA, Stiles AD, Moats-Staats BM & DErcole AJ 1992 Gene expression of insulin-like growth factors (IGFs), the type 1 IGF receptor, and IGF-binding proteins in dexamethasone-induced fetal growth retardation. Endocrinology 130 14241432.
Resnik R 2002 Intrauterine growth restriction. Obstetrics and Gynecology 99 490496.[CrossRef][Web of Science][Medline]
Roberge JN & Brubaker PL 1993 Regulation of intestinal proglucagon-derived peptide secretion by glucose-dependent insulinotropic peptide in a novel enteroendocrine loop. Endocrinology 133 233240.
Ryan J, Mantle T & Costigan DC 1991 Comparison of type 1 insulin-like growth factor (IGF) receptor binding in ovine tissue and human placental membranes. Biochemical Society Transactions 19 63S.[Medline]
Schalch DS, Yang H, Ney DM & DiMarchi RD 1989 Infusion of human insulin-like growth factor I (IGF-I) into malnourished rats reduces hepatic IGF-I mRNA abundance. Biochemical and Biophysical Research Communications 160 795800.[CrossRef][Web of Science][Medline]
Shen WH, Yang X, Boyle DW, Lee WH & Liechty EA 2001 Effects of intravenous insulin-like growth factor-I and insulin administration on insulin-like growth factor-binding proteins in the ovine fetus. Journal of Endocrinology 171 143151.[Abstract]
Shoubridge CA, Steeb CB & Read LC 2001 IGFBP mRNA expression in small intestine of rat during postnatal development. American Journal of Physiology Gastrointestinal and Liver Physiology 281 G1378G1384.
Simmons JG, Pucilowska JB & Lund PK 1999 Autocrine and paracrine actions of intestinal fibroblast-derived insulin-like growth factors. American Journal of Physiology Gastrointestinal and Liver Physiology 276 G817GG827.
Sjoholm A, Sandberg E, Ostenson CG & Efendic S 2000 Peptidergic regulation of maturation of the stimulus-secretion coupling in fetal islet beta cells. Pancreas 20 282289.[CrossRef][Web of Science][Medline]
Straus DS, Ooi GT, Orlowski CC & Rechler MM 1991 Expression of the genes for insulin-like growth factor-I (IGF-I), IGF-II, and IGF-binding proteins-1 and -2 in fetal rat under conditions of intrauterine growth retardation caused by maternal fasting. Endocrinology 128 518525.
Unterman T, Lascon R, Gotway MB, Oehler D, Gounis A, Simmons RA & Ogata ES 1990 Circulating levels of insulin-like growth factor binding protein-1 (IGFBP-1) and hepatic mRNA are increased in the small for gestational age (SGA) fetal rat. Endocrinology 127 20352037.
Verhaeghe J, Van Bree R, Van Herck E, Laureys J, Bouillon R & Van Assche FA 1993 C-peptide, insulin-like growth factors I and II, and insulin-like growth factor binding protein-1 in umbilical cord serum: correlations with birth weight. American Journal of Obstetrics and Gynecology 169 8997.[Web of Science][Medline]
Werner H, Woloschak M, Adamo M, Shen-Orr Z, Roberts CT Jr & LeRoith D 1989 Developmental regulation of the rat insulin-like growth factor I receptor gene. PNAS 86 74517455.
Ziegler TR, Almahfouz A, Pedrini MT & Smith RJ 1995 A comparison of rat small intestinal insulin and insulin-like growth factor I receptors during fasting and refeeding. Endocrinology 136 51485154.[Abstract]
Ziegler TR, Mantell MP, Chow JC, Rombeau JL & Smith RJ 1996 Gut adaptation and the insulin-like growth factor system: regulation by glutamine and IGF-I administration. American Journal of Physiology Gastrointestinal and Liver Physiology 271 G866G875.
Received 4 April 2005
Accepted 15 April 2005
This article has been cited by other articles:
![]() |
A. Casillas-Ramirez, A. Zaouali, S. Padrissa-Altes, I. Ben Mosbah, A. Pertosa, I. Alfany-Fernandez, M. Bintanel-Morcillo, C. Xaus, A. Rimola, J. Rodes, et al. Insulin-Like Growth Factor and Epidermal Growth Factor Treatment: New Approaches to Protecting Steatotic Livers against Ischemia-Reperfusion Injury Endocrinology, July 1, 2009; 150(7): 3153 - 3161. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Eremia, H. A. de Boo, F. H. Bloomfield, M. H. Oliver, and J. E. Harding Fetal and Amniotic Insulin-Like Growth Factor-I Supplements Improve Growth Rate in Intrauterine Growth Restriction Fetal Sheep Endocrinology, June 1, 2007; 148(6): 2963 - 2972. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. H. Bloomfield, P. L. van Zijl, M. K. Bauer, H. H. Phua, and J. E. Harding Effect of pulsatile growth hormone administration to the growth-restricted fetal sheep on somatotrophic axis gene expression in fetal and placental tissues Am J Physiol Endocrinol Metab, August 1, 2006; 291(2): E333 - E339. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |