JOE
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2005) 185, R1-R8       DOI: 10.1677/joe.1.06211
© 2005 Society for Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kralisch, S.
Right arrow Articles by Fasshauer, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kralisch, S.
Right arrow Articles by Fasshauer, M.

RAPID COMMUNICATION

Hormonal regulation of the novel adipocytokine visfatin in 3T3-L1 adipocytes

Susan Kralisch, Johannes Klein1, Ulrike Lossner, Matthias Bluher, Ralf Paschke, Michael Stumvoll and Mathias Fasshauer

University of Leipzig, Department of Internal Medicine III, 04103 Leipzig, Germany
1 University of Lübeck, Department of Internal Medicine I, 23538 Lübeck, Germany

(Requests for offprints should be addressed to M Fasshauer, Ph.-Rosenthal-Str.27, 04103 Leipzig, Germany; Email: mathias.fasshauer{at}medizin.uni-leipzig.de)


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recently, visfatin was characterized as a novel adipo-cytokine that is upregulated in obesity and exerts insulin-mimetic effects in various tissues. To clarify expression and regulation of this adipocytokine, visfatin mRNA was measured by quantitative real-time reverse transcription-polymerase chain reaction in 3T3-L1 adipocytes during adipogenesis and after treatment with various hormones known to alter insulin sensitivity. Visfatin expression was about 6-fold higher in 3T3-L1 adipocytes in vitro as compared with epididymal fat in vivo and increased during adipogenic conversion more than 3-fold. Interestingly, 100 nM dexamethasone significantly increased visfatin mRNA by almost 1.5-fold. In contrast, 500 ng/ml growth hormone (GH), 10 ng/ml tumor necrosis factor (TNF) {alpha}, and 10 µM isoproterenol downregulated visfatin expression by 45%, 36%, and 43% respectively. Insulin did not influence synthesis of this adipocytokine. The effects of dexamethasone, GH, TNF{alpha} and isoproterenol were time- and dose-dependent. Furthermore, activation of Gs-protein-coupled pathways by forskolin and cholera toxin was sufficient to significantly downregulate visfatin mRNA. Taken together, our results show a differential regulation of visfatin mRNA by insulin resistance-inducing hormones, supporting the view that this adipo-cytokine might be an interesting novel candidate linking core components of the metabolic syndrome such as obesity and insulin resistance.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
About 150 million people are currently affected by type 2 diabetes mellitus worldwide, which is characterized by insulin resistance of peripheral tissues such as liver, muscle, and fat that cannot be compensated for by increased insulin secretion from pancreatic ß-cells (Matthaei et al. 2000). Insulin resistance and type 2 diabetes are frequently associated with obesity and a better understanding of the connection between increased adiposity and impaired insulin sensitivity has been obtained recently (Lazar 2005). Thus, various fat cell-secreted proteins, so-called adipo-cytokines, including tumor necrosis factor (TNF) {alpha}, interleukin (IL)-6, and resistin are upregulated in obesity and induce insulin resistance. In contrast, the adipocytokine adiponectin is downregulated in states of impaired insulin sensitivity and appears as an endogenous insulin sensitizer (Fasshauer & Paschke 2003).

Most recently, by using a differential display method, visfatin was isolated as a novel adipocytokine implicated in the development of obesity-associated insulin resistance and diabetes mellitus (Fukuhara et al. 2005). The authors demonstrated that visfatin, which is identical to pre-B cell colony-enhancing factor (PBEF), is preferentially expressed in visceral as compared with subcutaneous fat (Fukuhara et al. 2005). Furthermore, plasma visfatin concentrations correlated strongly with the amount of visceral fat in human subjects (Fukuhara et al. 2005). Most interestingly, visfatin had insulin-mimetic effects in various rodent models of insulin resistance and obesity in vivo (Fukuhara et al. 2005). Consistent with these effects, visfatin addition to 3T3-L1 adipocytes and L6 myocytes increased basal glucose uptake, whereas glucose release was suppressed from H4IIEC3 hepatocytes in vitro (Fukuhara et al. 2005). Further experiments indicated that visfatin directly binds to and stimulates the insulin receptor, however, the binding site appeared to be different from insulin (Fukuhara et al. 2005).

Thus, the data accumulated so far suggest that visfatin is a novel adipocyte-secreted factor that strongly correlates to visceral obesity and has insulin-mimetic effects. A number of factors have been shown to alter glucose tolerance although the underlying cellular mechanisms are not always understood. It is possible that some of these mechanisms are indirect and involve alterations in visfatin expression in adipocytes. To test this hypothesis, we examined the effect of various insulin resistance-inducing hormones on visfatin expression in 3T3-L1 adipocytes in vitro. We demonstrate for the first time that dexamethasone induces visfatin mRNA whereas growth hormone (GH), TNF{alpha}, and the ß-adrenergic agonist isoproterenol significantly suppress synthesis of this adipocytokine. Furthermore, we present first evidence that intracellular cAMP accumulation is sufficient to downregulate visfatin mRNA.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

Cell culture reagents were obtained from Life Technologies Inc. (Grand Island, NY, USA), oligonucleotides from MWG-Biotech (Ebersberg, Germany). Cholera toxin, dexamethasone, forskolin, GH, insulin, isobutyl-methylxanthine, isoproterenol and TNF{alpha} were obtained from Sigma Chemical Co. (St Louis, MO, USA).

Culture and differentiation of 3T3-L1 cells

3T3-L1 adipocytes (American Type Culture Collection, Rockville, MD, USA) were cultured and differentiated as described recently (Fasshauer et al. 2004a). In brief, after reaching confluence, preadipocytes were cultured for three days in Dulbecco’s Modified Eagle Medium (DMEM) containing 25 mM glucose (DMEM-H), 10% fetal bovine serum and antibiotics (culture medium) further supplemented with 1 µM insulin, 0.5 mM iso-butylmethylxanthine (IBMX) and 0.1 µM dexamethasone. Then, cells were kept for three more days in culture medium with 1 µM insulin (without IBMX, dexamethasone) and three to six days in culture medium (without insulin, IBMX, dexamethasone) after which about 95% of the cells had accumulated fat droplets. All stimulations were carried out after culturing the cells in DMEM-H without any additions for the time periods indicated.

Animals and tissue collection

Random-fed (n=6) 3-month-old male C57BL/6 mice (Taconic, Borup, Denmark) were sacrificed. Epididymal and subcutaneous fat pads were removed, immediately frozen in liquid nitrogen, and stored at –70 °C. Animals were housed in virus-free facilities on a 12 h light/dark cycle (07:00 h on-19:00 h off), fed a standard rodent chow and allowed water ad libitum. All protocols for animal use and euthanasia were in accordance with the ‘Principles of laboratory animal care’ (NIH Guidelines), approved by the Animal Care Committee of the University of Leipzig and followed the current version of the German Law on the Protection of Animals.

Analysis of visfatin gene expression

Visfatin mRNA synthesis was determined by quantitative real-time RT-PCR in a fluorescent temperature cycler (Taqman, Applied Biosystems, Darmstadt, Germany) as described previously (Fasshauer et al. 2004a). Briefly, total RNA was isolated from 3T3-L1 adipocytes with TRIzol (Life Technologies Inc.) and 1 µg RNA was reverse transcribed using standard reagents (Life Technologies Inc.). 2 µl of each RT reaction was amplified in a 26 µl PCR. Samples were incubated in the Taqman for an initial denaturation at 95 °C for 10 min, after which 40 PCR cycles were performed, each cycle consisting of 95 °C for 15 s, 60 °C for 1 min, and 72 °C for 1 min. The following primers specific for mouse visfatin and mouse 36B4 were used: Visfatin (accession no. NM021524) 5'–TCGGTTCTGGTGGCGCTTTGCTAC–3' (sense) and 5'–AAGTTCCCCGCTGGTGTCCTATGT–3' (anti-sense); 36B4 (accession no. NM007475) 5'–AAGCGC GTCCTGGCATTGTCT–3' (sense) and 5'–CCGCAG GGGCAGCAGTGGT–3' (antisense). SYBR Green I fluorescence emissions were monitored after each cycle. Synthesis of visfatin and 36B4 mRNA was quantified using the second derivative maximum method of the Taqman Software (Applied Biosystems, Darmstadt, Germany) which determines the crossing points of individual samples by an algorithm identifying the first turning point of the fluorescence curve. Visfatin synthesis was expressed relative to 36B4, which was used as an internal control due to its resistance to hormonal regulation (Laborda 1991). Amplification of specific transcripts was confirmed by melting curve profiles (cooling the sample to 68 °C and heating slowly to 95 °C with measurement of fluorescence) at the end of each PCR. The specificity of the PCR was further verified by subjecting the amplification products to agarose gel electrophoresis. Linearity between total RNA used per reaction and amount of mRNA measured by the Taqman software was obtained between 2 and 200 ng of total RNA (data not shown).

Statistical analysis

Results are shown as means±S.E. Comparisons between groups were carried out by unpaired Student’s t-test and in the case of multiple time points and treatments by one-way ANOVA. P values <0.01 are considered highly significant and <0.05 significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Visfatin mRNA expression is high in 3T3-L1 adipocytes and stimulated during adipogenesis

We compared expression of visfatin in 3T3-L1 adipocytes in vitro to visceral and subcutaneous fat depots of mice in vivo. As shown in Fig. 1AGo, visfatin expression was about 6-fold higher in 3T3-L1 adipocytes as compared with visceral (=epididymal) fat (P<0.01). Moreover, expression of this adipocytokine was further decreased by 42% in subcutaneous as compared with visceral adipose tissue (Fig. 1AGo). Next, visfatin synthesis during differentiation of 3T3-L1 cells was determined. As compared with undifferentiated preadipocytes (day 0), visfatin mRNA increased significantly more than 3-fold on day 6 and day 9 of differentiation (P<0.05) (Fig. 1BGo).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 1 Expression of visfatin in 3T3-L1 adipocytes and during differentiation. (A) Expression of visfatin in fully differentiated 3T3-L1 adipocytes was compared with epididymal (Epi) and subcutaneous (SC) fat depots. (B) Confluent preadipocytes (day 0) were differentiated and at the indicated days (0, 3, 6, 9) total RNA was subjected to quantitative real-time RT-PCR. Visfatin mRNA levels are shown relative to (A) differentiated 3T3-L1 adipocytes (=100%) and (B) cells on day 0 (=100%). Results are the means±S.E. of at least four independent experiments. **indicates highly significant downregulation (P<0.01) comparing 3T3-L1 adipocytes with epididymal and subcutaneous fat depots. X indicates significant upregulation (P<0.05) comparing confluent cells (day 0) with differentiating adipocytes (day 6 and 9).

 
Dexamethasone increases visfatin mRNA whereas TNF{alpha}, GH and isoproterenol decrease expression of this adipocytokine

Various hormones which have been shown to induce insulin resistance were tested for their ability to regulate visfatin expression in 3T3-L1 fat cells. Treatment with 100 nM dexamethasone for 16 h significantly increased visfatin mRNA almost 1.5-fold (P<0.05) (Fig. 2Go). However, dexamethasone treatment did not influence expression of adipogenic markers including peroxisome proliferator activated receptor {gamma} (PPAR{gamma}), CCAAT/enhancer binding protein-{alpha} (C/EBP{alpha}) and the glucose transporter 4 (Glut4) (data not shown). In contrast, addition of 500 ng/ml GH, 10 ng/ml TNF{alpha} and 10 µM isoproterenol for 16 h decreased visfatin expression by 45% (P<0.01), 36% (P<0.01) and 43% (P<0.01) respectively (Fig. 2Go). Insulin did not significantly influence visfatin mRNA synthesis (Fig. 2Go). Furthermore, dexamethasone, GH, TNF{alpha}, isoproterenol, insulin and forskolin did not signifi-cantly influence cell viability as determined by trypan blue staining (data not shown).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 2 Visfatin mRNA expression is stimulated by dexamethasone and inhibited by GH, TNF{alpha} and isoproterenol. Fully differentiated 3T3-L1 cells were serum-deprived for 6 h before 100 nM dexamethasone (Dexa), 500 ng/ml GH, 10 ng/ml TNF{alpha} (TNF), 10 µM isoproterenol (Iso) and 100 nM insulin (Ins) were added for 16 h. Total RNA was subjected to quantitative real-time RT-PCR determining visfatin mRNA levels normalized to 36B4 relative to untreated control (Con) cells (=100%) as described in Materials and Methods. Results are the means± S.E. of at least three independent experiments. X indicates significant upregulation (P<0.05), **indicates highly significant downregulation (P<0.01) comparing hormone-treated with non-treated cells.

 
The effect of dexamethasone, GH, TNF{alpha} and isoproterenol on visfatin expression is time- and dose-dependent

Next, we determined time- and dose dependent effects of dexamethasone, GH, TNF{alpha}, and isoproterenol on visfatin mRNA. Significant 1.5-fold stimulation of visfatin expression by 100 nM dexamethasone was first seen at 8 h of treatment and persisted for up to 24 h (P<0.05) (Fig. 3AGo). In contrast, 500 ng/ml GH significantly decreased visfatin synthesis by more than 30% after 2 h of treatment (P<0.05), with maximally 65% suppression after 24 h (P<0.01) (Fig. 3BGo). 10 ng/ml TNF{alpha} significantly suppressed visfatin expression at 1 h and 24 h of treatment with a maximal decrease of 27% at 1 h (P<0.01) (Fig. 3CGo). Isoproterenol at 10 µM time-dependently inhibited visfatin mRNA synthesis with significant effects first seen after 1 h (P<0.05) and maximally 71% suppression observed after 24 h of treatment (P<0.01) (Fig. 3DGo).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 3 Visfatin mRNA expression is stimulated by dexamethasone and inhibited by GH, TNF{alpha} and isoproterenol in a time-dependent manner. Fully differentiated 3T3-L1 cells were serum-deprived overnight before (A) 100 nM dexamethasone, (B) 500 ng/ml GH, (C) 10 ng/ml TNF{alpha}, and (D) 10 µM isoproterenol were added for the indicated periods of time. Quantitative real-time RT-PCR was performed determining visfatin mRNA levels normalized to 36B4 and relative to untreated control cells (=100%) as described in Materials and Methods. Results are the means± S.E. of at least three independent experiments. XX indicates highly significant (P<0.01), X significant (P<0.05) upregulation, **indicates highly significant (P<0.01), *significant (P<0.05) downregulation comparing hormone-treated with non-treated adipocytes.

 
Incubation of 3T3-L1 adipocytes with dexamethasone for 16 h stimulated visfatin mRNA synthesis dose-dependently with significant 1.5-fold upregulation first seen at 100 nM and maximal effects at 1000 nM effector (P<0.05) (Fig. 4AGo). GH-treatment for 16 h inhibited visfatin mRNA expression with a significant 40% reduction seen at concentrations as low as 50 ng/ml (P<0.05) (Fig. 4BGo). TNF{alpha} significantly suppressed visfatin synthesis by almost 30% at 3 ng/ml (P<0.01) (Fig. 4CGo). Significant downregulation of visfatin by isoproterenol was first seen at 100 nM (data not shown).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 4 Dose-dependent regulation of visfatin by dexamethasone, GH, and TNF{alpha}. 3T3-L1 cells were serum-starved for 6 h before various concentrations of (A) dexamethasone, (B) GH, and (C) TNF{alpha} were added for 16 h. Total RNA was extracted and subjected to quantitative real-time RT-PCR to determine visfatin mRNA levels normalized to 36B4 expression as described in Materials and Methods. Data are expressed relative to untreated control (Con) cells (=100%). Results are the means± S E. of at least three independent experiments. X indicates significant (P<0.05) upregulation, **indicates highly significant (P<0.01), *significant (P<0.05) downregulation comparing hormone-treated with non-treated cells.

 
Forskolin and cholera toxin downregulate visfatin expression

We determined whether a cellular increase in cAMP concentrations would be sufficient to downregulate visfatin mRNA. Cholera toxin activates GS-proteins by ADP-ribosylation whereas forskolin is a direct activator of adenylyl cyclase. 3T3-L1 adipocytes were treated with 200 µM forskolin and different concentrations of cholera toxin for 16 h and visfatin mRNA levels were determined by real-time RT-PCR. As shown in Fig. 5Go, both effectors significantly inhibited visfatin expression. A maximal 78% (P<0.05) and 72% (P<0.01) reduction of visfatin mRNA was observed at concentrations of 200 µmol/l forskolin and 1000 ng/ml cholera toxin respectively (Fig. 5Go).



View larger version (11K):
[in this window]
[in a new window]
 
Figure 5 Forskolin and cholera toxin downregulate visfatin mRNA. After serum-starvation for 6 h, 3T3-L1 cells were cultured in the presence or absence of 200 µM forskolin (For) and the indicated concentrations of cholera toxin for 16 h. Total RNA was extracted and subjected to quantitative real-time RT-PCR to determine visfatin normalized to 36B4 expression as described in Materials and Methods. Data are expressed relative to non-treated control (Con) cells (=100%). Results are the means± S.E. of two independent experiments. **denotes P<0.01, *denotes P<0.05 comparing effector-treated with non-treated fat cells.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Visfatin expression in differentiated 3T3-L1 adipocytes is about 6-fold higher as compared with visceral fat, supporting the notion that 3T3-L1 adipocytes constitute an appropriate model to determine hormonal regulation of this adipocytokine. Furthermore, in agreement with the original study (Fukuhara et al. 2005), visfatin mRNA synthesis is lower in subcutaneous as compared with visceral fat and is induced during adipogenesis.

In the current study, we demonstrate for the first time that the glucocorticoid dexamethasone significantly induces visfatin mRNA expression in 3T3-L1 adipocytes. It has long been known that glucocorticoids cause insulin resistance in vitro and in vivo (Ward et al. 2003). Thus, in 3T3-L1 fat cells, insulin-induced glucose uptake is signifi-cantly impaired after chronic treatment with dexamethasone (Sakoda et al. 2000, Bazuine et al. 2004). However, it is not clear to what extent increased glucocorticoid levels contribute to impaired insulin sensitivity seen in obesity. Thus, cortisol serum concentrations are not consistently increased in overweight persons (Wajchenberg 2000). On the other hand, transgenic overexpression of 11ß-hydroxysteroid dehydrogenase type 1 (11ß-HSD-1) in fat, which results in increased local levels of corticosterone, is accompanied by various symptoms of the metabolic syndrome including insulin resistance and obesity (Masuzaki et al. 2001). Furthermore, studies in humans confirm that local overexpression of 11ß-HSD-1 in adipocytes might contribute to insulin resistance found in obesity (Bahr et al. 2002). Since dexamethasone stimulates visfatin expression in 3T3-L1 adipocytes in vitro, increased local glucocorticoid levels in fat might contribute to upregulation of visfatin found in visceral obesity in vivo (Fukuhara et al. 2005). However, our data also point to the fact that fat-secreted visfatin is probably not a mediator of glucocorticoid-induced glucose intolerance. Here, other mechanisms including downregulation of insulin-sensitizing adiponectin and inhibition of insulin signaling molecules probably contribute (Sakoda et al. 2000, Fasshauer & Paschke 2003). Furthermore, since visfatin is not exclusively expressed in fat, visfatin serum levels in patients with hypercortisolism need to be determined to further define its role in states of increased glucocorticoid levels.

GH, which is secreted primarily by the anterior pituitary gland as a 22 kDa polypeptide, significantly down-regulates visfatin mRNA in 3T3-L1 adipocytes. It has long been known that GH potently antagonizes insulin action on insulin sensitive tissues such as muscle, fat and liver in vivo and in vitro (Frank 2001). Thus, Takano and co-workers showed significant suppression of insulin-induced glucose uptake in 3T3-L1 adipocytes at 500 ng/ml effector which was added for 16 h comparable to the highest concentration used in our study (Takano et al. 2001). Furthermore, GH receptor is expressed in 3T3-L1 adipocytes and upregulated during adipogenic conversion (Zou et al. 1997, Iida et al. 2003). Clinically, acromegalic patients are insulin resistant (Hansen et al. 1986) and nocturnal GH secretion appears to contribute to nocturnal hyperglycemia in diabetic patients (Campbell et al. 1985). Our current findings suggest that downregulation of visfatin in adipocytes may contribute to impaired glucose tolerance caused by increased GH levels. However, it has to be pointed out that stimulation of suppressor of cytokine signaling (SOCS)-1 (Fasshauer et al. 2004b) and -3 (Fasshauer et al. 2002), activation of MCP-1 (Fasshauer et al. 2004a) and IL-6 (Fasshauer & Paschke 2003), as well as altered insulin signaling downstream of phosphatidylinositol 3-kinase (Takano et al. 2001), are additional mechanisms by which GH affects glucose metabolism.

TNF{alpha}, originally identified in 1985, is a cytokine primarily produced by macrophages and adipocytes (Hotamisligil et al. 1993). Several studies have shown that TNF{alpha} potently induces insulin resistance and that serum levels of this cytokine are increased in human and murine obesity (Spiegelman & Flier 2001). In 3T3-L1 adipocytes, TNF{alpha} addition for 24 h at 85 ng/ml suppressed insulin-induced glucose uptake (Stephens & Pekala 1991). In the present study, we demonstrate that TNF{alpha} suppresses visfatin gene expression in a dose- and time-dependent fashion, which possibly contributes to impaired glucose tolerance seen in states of increased TNF{alpha} levels. However, direct inhibition of insulin signaling molecules by TNF{alpha} (Hotamisligil 1999), suppression of adiponectin (Fasshauer & Paschke 2003), as well as upregulation of MCP-1 (Fasshauer et al. 2004a) and IL-6 (Fasshauer & Paschke 2003), probably represent additional mechanisms for TNF{alpha}-induced glucose intolerance.

There is growing evidence suggesting that catecholamines impair insulin sensitivity and that increased activity of the sympathetic nervous system contributes to insulin resistance and diabetes mellitus (Facchini et al. 1996, Reaven et al. 1996, Hoieggen et al. 2000, Maison et al. 2000). In a clinical context, our group recently demonstrated that patients with pheochromocytoma are insulin resistant due to increased serum levels of catecholamines and insulin resistance improved after removal of the tumors in most cases (Bluher et al. 2000). In 3T3-L1 adipocytes significant impairment of insulin-stimulated glucose uptake is seen after treatment with 4 µM iso-proterenol for 16 h (Kaestner et al. 1991). Several mechanisms by which catecholamines induce insulin resistance have been suggested, including molecular interactions on several levels between adrenergic and insulin signaling cascades (Klein et al. 1999, Klein et al. 2000), upregulation of IL-6 (Fasshauer & Paschke 2003) and SOCS-3 (Fasshauer et al. 2002), as well as suppression of adipo-nectin (Fasshauer & Paschke 2003). Based on the findings in our current study, downregulation of the insulin-mimetic visfatin may also contribute to catecholamine-induced glucose intolerance. Furthermore, we present evidence that the inhibitory effect of isoproterenol can be mimicked by forskolin and cholera toxin, which increase intracellular levels of cAMP. These results are in accordance with the classical view of ß-adrenergic receptors being coupled to GS-proteins leading to activation of adenylyl cyclase and protein kinase A (PKA) (Collins & Surmit 2001). Interestingly, TNF{alpha} has also been shown to activate PKA by downregulating cyclic-nucleotide phosphodiesterase 3B in 3T3-L1 adipocytes (Rahn Landstrom et al. 2000). Thus, it appears possible that both, iso-proterenol and TNF{alpha}, suppress visfatin synthesis via the same signaling pathways.

It has to be pointed out that in most experiments significant regulation of visfatin by dexamethasone, GH, TNF{alpha} and isoproterenol was only seen at supraphysiological concentrations. However, various studies in 3T3-L1 adipocytes determining effects of these hormones on insulin sensitivity have also been performed with supraphysiological effector concentrations similar or higher as compared with our study. Thus, dexamethasone-induced insulin resistance was studied in detail in 3T3-L1 adipocytes at 1 µM (Sakoda et al. 2000) and 100 nM (Bazuine et al. 2004) effector respectively. Furthermore, insulin resistance was induced by 500 ng/ml GH (Takano et al. 2001), 85 ng/ml TNF{alpha} (Stephens & Pekala 1991), or 4 µM isoproterenol (Kaestner et al. 1991). Taking these studies into account, it appears likely that supraphysiological concentrations of dexamethasone, GH, TNF{alpha} and isoproterenol are commonly needed in 3T3-L1 adipocytes in vitro to show relevant physiological effects. To our knowledge, the reasons for the need to use high effector concentrations have not been studied systematically. It could be postulated that receptor and/or signaling protein expression might be lower in adipocytes differentiated in vitro as compared with mature adipocytes in vivo.

Hyperinsulinemia caused by peripheral insulin resistance is an integral part in the development of type 2 diabetes (Gerich 1998). In our experimental system, insulin does not affect visfatin gene expression. Thus, any correlational association between high visfatin and hyper-insulinemia cannot be explained by insulin inducing visfatin gene expression in fat cells.

Taken together, we demonstrate for the first time that dexamethasone stimulates whereas GH, TNF{alpha}, and iso-proterenol inhibit visfatin synthesis in 3T3-L1 adipocytes in vitro. These data indicate that expression of visfatin in fat is a selectively regulated mechanism that might constitute an important element in the pathogenesis of insulin resistance, obesity, and associated metabolic and cardiovascular disorders.


    Acknowledgements
 
This work was supported by a grant of the Deutsche Forschungsgemeinschaft (DFG, FA476/3–1) and the Deutsche Diabetes Gesellschaft (DDG) to M F. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bahr V, Pfeiffer AF & Diederich S 2002 The metabolic syndrome X and peripheral cortisol synthesis. Experimental and Clinical Endocrinology and Diabetes 110 313–318.

Bazuine M, Carlotti F, Tafrechi RS, Hoeben RC & Maassen JA 2004 Mitogen-activated protein kinase (MAPK) phosphatase-1 and -4 attenuate p38 MAPK during dexamethasone-induced insulin resistance in 3T3-L1 adipocytes. Molecular Endocrinology 18 1697–1707.[Abstract/Free Full Text]

Bluher M, Windgassen M & Paschke R 2000 Improvement of insulin sensitivity after adrenalectomy in patients with pheochromocytoma. Diabetes Care 23 1591–1592.[Web of Science][Medline]

Campbell PJ, Bolli GB, Cryer PE & Gerich JE 1985 Pathogenesis of the dawn phenomenon in patients with insulin-dependent diabetes mellitus. Accelerated glucose production and impaired glucose utilization due to nocturnal surges in growth hormone secretion. New England Journal of Medicine 312 1473–1479.[Abstract]

Collins S & Surwit RS 2001 The beta-adrenergic receptors and the control of adipose tissue metabolism and thermogenesis. Recent Progress in Hormone Research 56 309–328.

Facchini FS, Stoohs RA & Reaven GM 1996 Enhanced sympathetic nervous system activity. The linchpin between insulin resistance, hyperinsulinemia, and heart rate. American Journal of Hypertension 9 1013–1017.[CrossRef][Web of Science][Medline]

Fasshauer M & Paschke R 2003 Regulation of adipocytokines and insulin resistance. Diabetologia 46 1594–1603.[CrossRef][Web of Science][Medline]

Fasshauer M, Klein J, Lossner U & Paschke R 2002 Isoproterenol is a positive regulator of SOCS-3 gene expression in 3T3-L1 adipocytes. Journal of Endocrinology 175 727–733.[Abstract]

Fasshauer M, Klein J, Kralisch S, Klier M, Lossner U, Bluher M & Paschke R 2004a Monocyte chemoattractant protein 1 expression is stimulated by growth hormone and interleukin-6 in 3T3-L1 adipocytes. Biochemical and Biophysical Research Communications 317 598–604.[CrossRef][Web of Science][Medline]

Fasshauer M, Kralisch S, Klier M, Lossner U, Bluher M, Klein J & Paschke R 2004b Insulin resistance-inducing cytokines differentially regulate SOCS mRNA expression via growth factor- and Jak/Stat signaling pathways in 3T3-L1 adipocytes. Journal of Endocrinology 181 129–138.[Abstract]

Frank SJ 2001 Growth hormone signalling and its regulation: preventing too much of a good thing. Growth Hormone and IGF Research 11 201–212.

Fukuhara A, Matsuda M, Nishizawa M, Segawa K, Tanaka M, Kishimoto K, Matsuki Y, Murakami M, Ichisaka T, Murakami H, Watanabe E, Takagi T, Akiyoshi M, Ohtsubo T, Kihara S, Yamashita S, Makishima M, Funahashi T, Yamanaka S, Hiramatsu R, Matsuzawa Y & Shimomura I 2005 Visfatin: a protein secreted by visceral fat that mimics the effects of insulin. Science 307 426–430.[Abstract/Free Full Text]

Gerich JE 1998 The genetic basis of type 2 diabetes mellitus: impaired insulin secretion versus impaired insulin sensitivity. Endocrine Reviews 19 491–503.[Abstract/Free Full Text]

Hansen I, Tsalikian E, Beaufrere B, Gerich J, Haymond M & Rizza R 1986 Insulin resistance in acromegaly: defects in both hepatic and extrahepatic insulin action. Amercian Journal of Physiology –Endocrinology and Metabolism 250 E269–E273.

Hoieggen A, Fossum E, Nesbitt SD, Palmieri V & Kjeldsen SE 2000 Blood viscosity, plasma adrenaline and fasting insulin in hypertensive patients with left ventricular hypertrophy. ICARUS, a LIFE Substudy. Insulin CARotids US Scandinavica. Blood Pressure 9 83–90.[CrossRef][Web of Science][Medline]

Hotamisligil GS 1999 The role of TNFalpha and TNF receptors in obesity and insulin resistance. Journal of Internal Medicine 245 621–625.[CrossRef][Web of Science][Medline]

Hotamisligil GS, Shargill NS & Spiegelman BM 1993 Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science 259 87–91.[Abstract/Free Full Text]

Iida K, Takahashi Y, Kaji H, Yoshioka S, Murata M, Iguchi G, Okimura Y & Chihara K 2003 Diverse regulation of full-length and truncated growth hormone receptor expression in 3T3-L1 adipocytes. Molecular and Cellular Endocrinology 210 21–29.[CrossRef][Web of Science][Medline]

Kaestner KH, Flores-Riveros JR, McLenithan JC, Janicot M & Lane MD 1991 Transcriptional repression of the mouse insulin-responsive glucose transporter (GLUT4) gene by cAMP. PNAS 88 1933–1937.[Abstract/Free Full Text]

Klein J, Fasshauer M, Ito M, Lowell BB, Benito M & Kahn CR 1999 beta(3)-adrenergic stimulation differentially inhibits insulin signaling and decreases insulin-induced glucose uptake in brown adipocytes. Journal of Biological Chemistry 274 34795–34802.[Abstract/Free Full Text]

Klein J, Fasshauer M, Benito M & Kahn CR 2000 Insulin and the beta3-adrenoceptor differentially regulate uncoupling protein-1 expression. Molecular Endocrinology 14 764–773.[Abstract/Free Full Text]

Laborda J 1991 36B4 cDNA used as an estradiol-independent mRNA control is the cDNA for human acidic ribosomal phosphoprotein PO. Nucleic Acids Research 19 3998.[Free Full Text]

Lazar MA 2005 How obesity causes diabetes: not a tall tale. Science 307 373–375.[Abstract/Free Full Text]

Maison P, Byrne CD, Hales CN & Wareham NJ 2000 Hypertension and its treatment influence changes in fasting nonesterified fatty acid concentrations: a link between the sympathetic nervous and the metabolic syndrome? Metabolism 49 81–87.[CrossRef][Web of Science][Medline]

Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR & Flier JS 2001 A transgenic model of visceral obesity and the metabolic syndrome. Science 294 2166–2170.[Abstract/Free Full Text]

Matthaei S, Stumvoll M, Kellerer M & Haring HU 2000 Pathophysiology and pharmacological treatment of insulin resistance. Endocrine Reviews 21 585–618.[Abstract/Free Full Text]

Rahn Landstrom T, Mei J, Karlsson M, Manganiello V & Degerman E 2000 Down-regulation of cyclic-nucleotide phosphodiesterase 3B in 3T3-L1 adipocytes induced by tumour necrosis factor alpha and cAMP. Biochemical Journal 346 Pt 2: 337–343.

Reaven GM, Lithell H & Landsberg L 1996 Hypertension and associated metabolic abnormalities–the role of insulin resistance and the sympathoadrenal system. New England Journal of Medicine 334 374–381.[Free Full Text]

Sakoda H, Ogihara T, Anai M, Funaki M, Inukai K, Katagiri H, Fukushima Y, Onishi Y, Ono H, Fujishiro M, Kikuchi M, Oka Y & Asano T 2000 Dexamethasone-induced insulin resistance in 3T3-L1 adipocytes is due to inhibition of glucose transport rather than insulin signal transduction. Diabetes 49 1700–1708.[Abstract]

Spiegelman BM & Flier JS 2001 Obesity and the regulation of energy balance. Cell 104 531–543.[CrossRef][Web of Science][Medline]

Stephens JM & Pekala PH 1991 Transcriptional repression of the GLUT4 and C/EBP genes in 3T3-L1 adipocytes by tumor necrosis factor-alpha. Journal of Biological Chemistry 266 21839–21845.[Abstract/Free Full Text]

Takano A, Haruta T, Iwata M, Usui I, Uno T, Kawahara J, Ueno E, Sasaoka T & Kobayashi M 2001 Growth hormone induces cellular insulin resistance by uncoupling phosphatidylinositol 3-kinase and its downstream signals in 3t3-l1 adipocytes. Diabetes 50 1891–1900.[Abstract/Free Full Text]

Wajchenberg BL 2000 Subcutaneous and visceral adipose tissue: their relation to the metabolic syndrome. Endocrine Reviews 21 697–738.[Abstract/Free Full Text]

Ward AM, Fall CH, Stein CE, Kumaran K, Veena SR, Wood PJ, Syddall HE & Phillips DI 2003 Cortisol and the metabolic syndrome in South Asians. Clinical Endocrinology 58 500–505.[CrossRef][Medline]

Zou L, Menon RK & Sperling MA 1997 Induction of mRNAs for the growth hormone receptor gene during mouse 3T3-L1 preadipocyte differentiation. Metabolism 46 114–118.[CrossRef][Web of Science][Medline]

Received 20 April 2005
Accepted 22 April 2005
Made available online as an Accepted Preprint 29 April 2005




This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
T. Luk, Z. Malam, and J. C. Marshall
Pre-B cell colony-enhancing factor (PBEF)/visfatin: a novel mediator of innate immunity
J. Leukoc. Biol., April 1, 2008; 83(4): 804 - 816.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. B. Dahl, A. Yndestad, M. Skjelland, E. Oie, A. Dahl, A. Michelsen, J. K. Damas, S. H. Tunheim, T. Ueland, C. Smith, et al.
Increased Expression of Visfatin in Macrophages of Human Unstable Carotid and Coronary Atherosclerosis: Possible Role in Inflammation and Plaque Destabilization
Circulation, February 27, 2007; 115(8): 972 - 980.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. Frydelund-Larsen, T. Akerstrom, S. Nielsen, P. Keller, C. Keller, and B. K. Pedersen
Visfatin mRNA expression in human subcutaneous adipose tissue is regulated by exercise
Am J Physiol Endocrinol Metab, January 1, 2007; 292(1): E24 - E31.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. Lopez-Bermejo, B. Chico-Julia, M. Fernandez-Balsells, M. Recasens, E. Esteve, R. Casamitjana, W. Ricart, and J.-M. Fernandez-Real
Serum Visfatin Increases With Progressive {beta}-Cell Deterioration.
Diabetes, October 1, 2006; 55(10): 2871 - 2875.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. D. Bailey, J C. Loredo-Osti, P. Lepage, J. Faith, J. Fontaine, K. M. Desbiens, T. J. Hudson, C. Bouchard, D. Gaudet, L. Perusse, et al.
Common Polymorphisms in the Promoter of the Visfatin Gene (PBEF1) Influence Plasma Insulin Levels in a French-Canadian Population.
Diabetes, October 1, 2006; 55(10): 2896 - 2902.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S Kralisch, U Lossner, M Bluher, R Paschke, M Stumvoll, and M Fasshauer
Tissue inhibitor of metalloproteinase 1 expression and secretion are induced by {beta}-adrenergic stimulation in 3T3-L1 adipocytes.
J. Endocrinol., June 1, 2006; 189(3): 665 - 670.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
J. Dotsch, W. Rascher, and U. Meissner
Does visceral fat produce insulin?
Eur. J. Endocrinol., October 1, 2005; 153(4): 475 - 476.
[Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Kralisch, J. Klein, U. Lossner, M. Bluher, R. Paschke, M. Stumvoll, and M. Fasshauer
Interleukin-6 is a negative regulator of visfatin gene expression in 3T3-L1 adipocytes
Am J Physiol Endocrinol Metab, October 1, 2005; 289(4): E586 - E590.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kralisch, S.
Right arrow Articles by Fasshauer, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kralisch, S.
Right arrow Articles by Fasshauer, M.


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS