| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
RAPID COMMUNICATION |
University of Leipzig, Department of Internal Medicine III, 04103 Leipzig, Germany
1 University of Lübeck, Department of Internal Medicine I, 23538 Lübeck, Germany
(Requests for offprints should be addressed to M Fasshauer, Ph.-Rosenthal-Str.27, 04103 Leipzig, Germany; Email: mathias.fasshauer{at}medizin.uni-leipzig.de)
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and 10 µM isoproterenol downregulated visfatin expression by 45%, 36%, and 43% respectively. Insulin did not influence synthesis of this adipocytokine. The effects of dexamethasone, GH, TNF and isoproterenol were time- and dose-dependent. Furthermore, activation of Gs-protein-coupled pathways by forskolin and cholera toxin was sufficient to significantly downregulate visfatin mRNA. Taken together, our results show a differential regulation of visfatin mRNA by insulin resistance-inducing hormones, supporting the view that this adipo-cytokine might be an interesting novel candidate linking core components of the metabolic syndrome such as obesity and insulin resistance. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, interleukin (IL)-6, and resistin are upregulated in obesity and induce insulin resistance. In contrast, the adipocytokine adiponectin is downregulated in states of impaired insulin sensitivity and appears as an endogenous insulin sensitizer (Fasshauer & Paschke 2003). Most recently, by using a differential display method, visfatin was isolated as a novel adipocytokine implicated in the development of obesity-associated insulin resistance and diabetes mellitus (Fukuhara et al. 2005). The authors demonstrated that visfatin, which is identical to pre-B cell colony-enhancing factor (PBEF), is preferentially expressed in visceral as compared with subcutaneous fat (Fukuhara et al. 2005). Furthermore, plasma visfatin concentrations correlated strongly with the amount of visceral fat in human subjects (Fukuhara et al. 2005). Most interestingly, visfatin had insulin-mimetic effects in various rodent models of insulin resistance and obesity in vivo (Fukuhara et al. 2005). Consistent with these effects, visfatin addition to 3T3-L1 adipocytes and L6 myocytes increased basal glucose uptake, whereas glucose release was suppressed from H4IIEC3 hepatocytes in vitro (Fukuhara et al. 2005). Further experiments indicated that visfatin directly binds to and stimulates the insulin receptor, however, the binding site appeared to be different from insulin (Fukuhara et al. 2005).
Thus, the data accumulated so far suggest that visfatin is a novel adipocyte-secreted factor that strongly correlates to visceral obesity and has insulin-mimetic effects. A number of factors have been shown to alter glucose tolerance although the underlying cellular mechanisms are not always understood. It is possible that some of these mechanisms are indirect and involve alterations in visfatin expression in adipocytes. To test this hypothesis, we examined the effect of various insulin resistance-inducing hormones on visfatin expression in 3T3-L1 adipocytes in vitro. We demonstrate for the first time that dexamethasone induces visfatin mRNA whereas growth hormone (GH), TNF, and the ß-adrenergic agonist isoproterenol significantly suppress synthesis of this adipocytokine. Furthermore, we present first evidence that intracellular cAMP accumulation is sufficient to downregulate visfatin mRNA.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell culture reagents were obtained from Life Technologies Inc. (Grand Island, NY, USA), oligonucleotides from MWG-Biotech (Ebersberg, Germany). Cholera toxin, dexamethasone, forskolin, GH, insulin, isobutyl-methylxanthine, isoproterenol and TNF were obtained from Sigma Chemical Co. (St Louis, MO, USA).
Culture and differentiation of 3T3-L1 cells
3T3-L1 adipocytes (American Type Culture Collection, Rockville, MD, USA) were cultured and differentiated as described recently (Fasshauer et al. 2004a). In brief, after reaching confluence, preadipocytes were cultured for three days in Dulbecco’s Modified Eagle Medium (DMEM) containing 25 mM glucose (DMEM-H), 10% fetal bovine serum and antibiotics (culture medium) further supplemented with 1 µM insulin, 0.5 mM iso-butylmethylxanthine (IBMX) and 0.1 µM dexamethasone. Then, cells were kept for three more days in culture medium with 1 µM insulin (without IBMX, dexamethasone) and three to six days in culture medium (without insulin, IBMX, dexamethasone) after which about 95% of the cells had accumulated fat droplets. All stimulations were carried out after culturing the cells in DMEM-H without any additions for the time periods indicated.
Animals and tissue collection
Random-fed (n=6) 3-month-old male C57BL/6 mice (Taconic, Borup, Denmark) were sacrificed. Epididymal and subcutaneous fat pads were removed, immediately frozen in liquid nitrogen, and stored at –70 °C. Animals were housed in virus-free facilities on a 12 h light/dark cycle (07:00 h on-19:00 h off), fed a standard rodent chow and allowed water ad libitum. All protocols for animal use and euthanasia were in accordance with the ‘Principles of laboratory animal care’ (NIH Guidelines), approved by the Animal Care Committee of the University of Leipzig and followed the current version of the German Law on the Protection of Animals.
Analysis of visfatin gene expression
Visfatin mRNA synthesis was determined by quantitative real-time RT-PCR in a fluorescent temperature cycler (Taqman, Applied Biosystems, Darmstadt, Germany) as described previously (Fasshauer et al. 2004a). Briefly, total RNA was isolated from 3T3-L1 adipocytes with TRIzol (Life Technologies Inc.) and 1 µg RNA was reverse transcribed using standard reagents (Life Technologies Inc.). 2 µl of each RT reaction was amplified in a 26 µl PCR. Samples were incubated in the Taqman for an initial denaturation at 95 °C for 10 min, after which 40 PCR cycles were performed, each cycle consisting of 95 °C for 15 s, 60 °C for 1 min, and 72 °C for 1 min. The following primers specific for mouse visfatin and mouse 36B4 were used: Visfatin (accession no. NM021524) 5'–TCGGTTCTGGTGGCGCTTTGCTAC–3' (sense) and 5'–AAGTTCCCCGCTGGTGTCCTATGT–3' (anti-sense); 36B4 (accession no. NM007475) 5'–AAGCGC GTCCTGGCATTGTCT–3' (sense) and 5'–CCGCAG GGGCAGCAGTGGT–3' (antisense). SYBR Green I fluorescence emissions were monitored after each cycle. Synthesis of visfatin and 36B4 mRNA was quantified using the second derivative maximum method of the Taqman Software (Applied Biosystems, Darmstadt, Germany) which determines the crossing points of individual samples by an algorithm identifying the first turning point of the fluorescence curve. Visfatin synthesis was expressed relative to 36B4, which was used as an internal control due to its resistance to hormonal regulation (Laborda 1991). Amplification of specific transcripts was confirmed by melting curve profiles (cooling the sample to 68 °C and heating slowly to 95 °C with measurement of fluorescence) at the end of each PCR. The specificity of the PCR was further verified by subjecting the amplification products to agarose gel electrophoresis. Linearity between total RNA used per reaction and amount of mRNA measured by the Taqman software was obtained between 2 and 200 ng of total RNA (data not shown).
Statistical analysis
Results are shown as means±S.E. Comparisons between groups were carried out by unpaired Student’s t-test and in the case of multiple time points and treatments by one-way ANOVA. P values <0.01 are considered highly significant and <0.05 significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We compared expression of visfatin in 3T3-L1 adipocytes in vitro to visceral and subcutaneous fat depots of mice in vivo. As shown in Fig. 1A
, visfatin expression was about 6-fold higher in 3T3-L1 adipocytes as compared with visceral (=epididymal) fat (P<0.01). Moreover, expression of this adipocytokine was further decreased by 42% in subcutaneous as compared with visceral adipose tissue (Fig. 1A). Next, visfatin synthesis during differentiation of 3T3-L1 cells was determined. As compared with undifferentiated preadipocytes (day 0), visfatin mRNA increased significantly more than 3-fold on day 6 and day 9 of differentiation (P<0.05) (Fig. 1B).
|
, GH and isoproterenol decrease expression of this adipocytokine
Various hormones which have been shown to induce insulin resistance were tested for their ability to regulate visfatin expression in 3T3-L1 fat cells. Treatment with 100 nM dexamethasone for 16 h significantly increased visfatin mRNA almost 1.5-fold (P<0.05) (Fig. 2). However, dexamethasone treatment did not influence expression of adipogenic markers including peroxisome proliferator activated receptor 
(PPAR), CCAAT/enhancer binding protein- (C/EBP) and the glucose transporter 4 (Glut4) (data not shown). In contrast, addition of 500 ng/ml GH, 10 ng/ml TNF and 10 µM isoproterenol for 16 h decreased visfatin expression by 45% (P<0.01), 36% (P<0.01) and 43% (P<0.01) respectively (Fig. 2). Insulin did not significantly influence visfatin mRNA synthesis (Fig. 2). Furthermore, dexamethasone, GH, TNF, isoproterenol, insulin and forskolin did not signifi-cantly influence cell viability as determined by trypan blue staining (data not shown).
|
and isoproterenol on visfatin expression is time- and dose-dependent
Next, we determined time- and dose dependent effects of dexamethasone, GH, TNF, and isoproterenol on visfatin mRNA. Significant 1.5-fold stimulation of visfatin expression by 100 nM dexamethasone was first seen at 8 h of treatment and persisted for up to 24 h (P<0.05) (Fig. 3A). In contrast, 500 ng/ml GH significantly decreased visfatin synthesis by more than 30% after 2 h of treatment (P<0.05), with maximally 65% suppression after 24 h (P<0.01) (Fig. 3B). 10 ng/ml TNF significantly suppressed visfatin expression at 1 h and 24 h of treatment with a maximal decrease of 27% at 1 h (P<0.01) (Fig. 3C). Isoproterenol at 10 µM time-dependently inhibited visfatin mRNA synthesis with significant effects first seen after 1 h (P<0.05) and maximally 71% suppression observed after 24 h of treatment (P<0.01) (Fig. 3D).
|
). GH-treatment for 16 h inhibited visfatin mRNA expression with a significant 40% reduction seen at concentrations as low as 50 ng/ml (P<0.05) (Fig. 4B). TNF significantly suppressed visfatin synthesis by almost 30% at 3 ng/ml (P<0.01) (Fig. 4C). Significant downregulation of visfatin by isoproterenol was first seen at 100 nM (data not shown).
|
We determined whether a cellular increase in cAMP concentrations would be sufficient to downregulate visfatin mRNA. Cholera toxin activates GS-proteins by ADP-ribosylation whereas forskolin is a direct activator of adenylyl cyclase. 3T3-L1 adipocytes were treated with 200 µM forskolin and different concentrations of cholera toxin for 16 h and visfatin mRNA levels were determined by real-time RT-PCR. As shown in Fig. 5, both effectors significantly inhibited visfatin expression. A maximal 78% (P<0.05) and 72% (P<0.01) reduction of visfatin mRNA was observed at concentrations of 200 µmol/l forskolin and 1000 ng/ml cholera toxin respectively (Fig. 5).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In the current study, we demonstrate for the first time that the glucocorticoid dexamethasone significantly induces visfatin mRNA expression in 3T3-L1 adipocytes. It has long been known that glucocorticoids cause insulin resistance in vitro and in vivo (Ward et al. 2003). Thus, in 3T3-L1 fat cells, insulin-induced glucose uptake is signifi-cantly impaired after chronic treatment with dexamethasone (Sakoda et al. 2000, Bazuine et al. 2004). However, it is not clear to what extent increased glucocorticoid levels contribute to impaired insulin sensitivity seen in obesity. Thus, cortisol serum concentrations are not consistently increased in overweight persons (Wajchenberg 2000). On the other hand, transgenic overexpression of 11ß-hydroxysteroid dehydrogenase type 1 (11ß-HSD-1) in fat, which results in increased local levels of corticosterone, is accompanied by various symptoms of the metabolic syndrome including insulin resistance and obesity (Masuzaki et al. 2001). Furthermore, studies in humans confirm that local overexpression of 11ß-HSD-1 in adipocytes might contribute to insulin resistance found in obesity (Bahr et al. 2002). Since dexamethasone stimulates visfatin expression in 3T3-L1 adipocytes in vitro, increased local glucocorticoid levels in fat might contribute to upregulation of visfatin found in visceral obesity in vivo (Fukuhara et al. 2005). However, our data also point to the fact that fat-secreted visfatin is probably not a mediator of glucocorticoid-induced glucose intolerance. Here, other mechanisms including downregulation of insulin-sensitizing adiponectin and inhibition of insulin signaling molecules probably contribute (Sakoda et al. 2000, Fasshauer & Paschke 2003). Furthermore, since visfatin is not exclusively expressed in fat, visfatin serum levels in patients with hypercortisolism need to be determined to further define its role in states of increased glucocorticoid levels.
GH, which is secreted primarily by the anterior pituitary gland as a 22 kDa polypeptide, significantly down-regulates visfatin mRNA in 3T3-L1 adipocytes. It has long been known that GH potently antagonizes insulin action on insulin sensitive tissues such as muscle, fat and liver in vivo and in vitro (Frank 2001). Thus, Takano and co-workers showed significant suppression of insulin-induced glucose uptake in 3T3-L1 adipocytes at 500 ng/ml effector which was added for 16 h comparable to the highest concentration used in our study (Takano et al. 2001). Furthermore, GH receptor is expressed in 3T3-L1 adipocytes and upregulated during adipogenic conversion (Zou et al. 1997, Iida et al. 2003). Clinically, acromegalic patients are insulin resistant (Hansen et al. 1986) and nocturnal GH secretion appears to contribute to nocturnal hyperglycemia in diabetic patients (Campbell et al. 1985). Our current findings suggest that downregulation of visfatin in adipocytes may contribute to impaired glucose tolerance caused by increased GH levels. However, it has to be pointed out that stimulation of suppressor of cytokine signaling (SOCS)-1 (Fasshauer et al. 2004b) and -3 (Fasshauer et al. 2002), activation of MCP-1 (Fasshauer et al. 2004a) and IL-6 (Fasshauer & Paschke 2003), as well as altered insulin signaling downstream of phosphatidylinositol 3-kinase (Takano et al. 2001), are additional mechanisms by which GH affects glucose metabolism.
TNF, originally identified in 1985, is a cytokine primarily produced by macrophages and adipocytes (Hotamisligil et al. 1993). Several studies have shown that TNF potently induces insulin resistance and that serum levels of this cytokine are increased in human and murine obesity (Spiegelman & Flier 2001). In 3T3-L1 adipocytes, TNF addition for 24 h at 85 ng/ml suppressed insulin-induced glucose uptake (Stephens & Pekala 1991). In the present study, we demonstrate that TNF suppresses visfatin gene expression in a dose- and time-dependent fashion, which possibly contributes to impaired glucose tolerance seen in states of increased TNF levels. However, direct inhibition of insulin signaling molecules by TNF (Hotamisligil 1999), suppression of adiponectin (Fasshauer & Paschke 2003), as well as upregulation of MCP-1 (Fasshauer et al. 2004a) and IL-6 (Fasshauer & Paschke 2003), probably represent additional mechanisms for TNF-induced glucose intolerance.
There is growing evidence suggesting that catecholamines impair insulin sensitivity and that increased activity of the sympathetic nervous system contributes to insulin resistance and diabetes mellitus (Facchini et al. 1996, Reaven et al. 1996, Hoieggen et al. 2000, Maison et al. 2000). In a clinical context, our group recently demonstrated that patients with pheochromocytoma are insulin resistant due to increased serum levels of catecholamines and insulin resistance improved after removal of the tumors in most cases (Bluher et al. 2000). In 3T3-L1 adipocytes significant impairment of insulin-stimulated glucose uptake is seen after treatment with 4 µM iso-proterenol for 16 h (Kaestner et al. 1991). Several mechanisms by which catecholamines induce insulin resistance have been suggested, including molecular interactions on several levels between adrenergic and insulin signaling cascades (Klein et al. 1999, Klein et al. 2000), upregulation of IL-6 (Fasshauer & Paschke 2003) and SOCS-3 (Fasshauer et al. 2002), as well as suppression of adipo-nectin (Fasshauer & Paschke 2003). Based on the findings in our current study, downregulation of the insulin-mimetic visfatin may also contribute to catecholamine-induced glucose intolerance. Furthermore, we present evidence that the inhibitory effect of isoproterenol can be mimicked by forskolin and cholera toxin, which increase intracellular levels of cAMP. These results are in accordance with the classical view of ß-adrenergic receptors being coupled to GS-proteins leading to activation of adenylyl cyclase and protein kinase A (PKA) (Collins & Surmit 2001). Interestingly, TNF has also been shown to activate PKA by downregulating cyclic-nucleotide phosphodiesterase 3B in 3T3-L1 adipocytes (Rahn Landstrom et al. 2000). Thus, it appears possible that both, iso-proterenol and TNF, suppress visfatin synthesis via the same signaling pathways.
It has to be pointed out that in most experiments significant regulation of visfatin by dexamethasone, GH, TNF and isoproterenol was only seen at supraphysiological concentrations. However, various studies in 3T3-L1 adipocytes determining effects of these hormones on insulin sensitivity have also been performed with supraphysiological effector concentrations similar or higher as compared with our study. Thus, dexamethasone-induced insulin resistance was studied in detail in 3T3-L1 adipocytes at 1 µM (Sakoda et al. 2000) and 100 nM (Bazuine et al. 2004) effector respectively. Furthermore, insulin resistance was induced by 500 ng/ml GH (Takano et al. 2001), 85 ng/ml TNF (Stephens & Pekala 1991), or 4 µM isoproterenol (Kaestner et al. 1991). Taking these studies into account, it appears likely that supraphysiological concentrations of dexamethasone, GH, TNF and isoproterenol are commonly needed in 3T3-L1 adipocytes in vitro to show relevant physiological effects. To our knowledge, the reasons for the need to use high effector concentrations have not been studied systematically. It could be postulated that receptor and/or signaling protein expression might be lower in adipocytes differentiated in vitro as compared with mature adipocytes in vivo.
Hyperinsulinemia caused by peripheral insulin resistance is an integral part in the development of type 2 diabetes (Gerich 1998). In our experimental system, insulin does not affect visfatin gene expression. Thus, any correlational association between high visfatin and hyper-insulinemia cannot be explained by insulin inducing visfatin gene expression in fat cells.
Taken together, we demonstrate for the first time that dexamethasone stimulates whereas GH, TNF, and iso-proterenol inhibit visfatin synthesis in 3T3-L1 adipocytes in vitro. These data indicate that expression of visfatin in fat is a selectively regulated mechanism that might constitute an important element in the pathogenesis of insulin resistance, obesity, and associated metabolic and cardiovascular disorders.
|
Acknowledgements |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Bazuine M, Carlotti F, Tafrechi RS, Hoeben RC & Maassen JA 2004 Mitogen-activated protein kinase (MAPK) phosphatase-1 and -4 attenuate p38 MAPK during dexamethasone-induced insulin resistance in 3T3-L1 adipocytes. Molecular Endocrinology 18 1697–1707.
Bluher M, Windgassen M & Paschke R 2000 Improvement of insulin sensitivity after adrenalectomy in patients with pheochromocytoma. Diabetes Care 23 1591–1592.[ISI][Medline]
Campbell PJ, Bolli GB, Cryer PE & Gerich JE 1985 Pathogenesis of the dawn phenomenon in patients with insulin-dependent diabetes mellitus. Accelerated glucose production and impaired glucose utilization due to nocturnal surges in growth hormone secretion. New England Journal of Medicine 312 1473–1479.[Abstract]
Collins S & Surwit RS 2001 The beta-adrenergic receptors and the control of adipose tissue metabolism and thermogenesis. Recent Progress in Hormone Research 56 309–328.
Facchini FS, Stoohs RA & Reaven GM 1996 Enhanced sympathetic nervous system activity. The linchpin between insulin resistance, hyperinsulinemia, and heart rate. American Journal of Hypertension 9 1013–1017.[CrossRef][ISI][Medline]
Fasshauer M & Paschke R 2003 Regulation of adipocytokines and insulin resistance. Diabetologia 46 1594–1603.[CrossRef][ISI][Medline]
Fasshauer M, Klein J, Lossner U & Paschke R 2002 Isoproterenol is a positive regulator of SOCS-3 gene expression in 3T3-L1 adipocytes. Journal of Endocrinology 175 727–733.[Abstract]
Fasshauer M, Klein J, Kralisch S, Klier M, Lossner U, Bluher M & Paschke R 2004a Monocyte chemoattractant protein 1 expression is stimulated by growth hormone and interleukin-6 in 3T3-L1 adipocytes. Biochemical and Biophysical Research Communications 317 598–604.[CrossRef][ISI][Medline]
Fasshauer M, Kralisch S, Klier M, Lossner U, Bluher M, Klein J & Paschke R 2004b Insulin resistance-inducing cytokines differentially regulate SOCS mRNA expression via growth factor- and Jak/Stat signaling pathways in 3T3-L1 adipocytes. Journal of Endocrinology 181 129–138.[Abstract]
Frank SJ 2001 Growth hormone signalling and its regulation: preventing too much of a good thing. Growth Hormone and IGF Research 11 201–212.
Fukuhara A, Matsuda M, Nishizawa M, Segawa K, Tanaka M, Kishimoto K, Matsuki Y, Murakami M, Ichisaka T, Murakami H, Watanabe E, Takagi T, Akiyoshi M, Ohtsubo T, Kihara S, Yamashita S, Makishima M, Funahashi T, Yamanaka S, Hiramatsu R, Matsuzawa Y & Shimomura I 2005 Visfatin: a protein secreted by visceral fat that mimics the effects of insulin. Science 307 426–430.
Gerich JE 1998 The genetic basis of type 2 diabetes mellitus: impaired insulin secretion versus impaired insulin sensitivity. Endocrine Reviews 19 491–503.
Hansen I, Tsalikian E, Beaufrere B, Gerich J, Haymond M & Rizza R 1986 Insulin resistance in acromegaly: defects in both hepatic and extrahepatic insulin action. Amercian Journal of Physiology –Endocrinology and Metabolism 250 E269–E273.
Hoieggen A, Fossum E, Nesbitt SD, Palmieri V & Kjeldsen SE 2000 Blood viscosity, plasma adrenaline and fasting insulin in hypertensive patients with left ventricular hypertrophy. ICARUS, a LIFE Substudy. Insulin CARotids US Scandinavica. Blood Pressure 9 83–90.[CrossRef][ISI][Medline]
Hotamisligil GS 1999 The role of TNFalpha and TNF receptors in obesity and insulin resistance. Journal of Internal Medicine 245 621–625.[CrossRef][ISI][Medline]
Hotamisligil GS, Shargill NS & Spiegelman BM 1993 Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science 259 87–91.
Iida K, Takahashi Y, Kaji H, Yoshioka S, Murata M, Iguchi G, Okimura Y & Chihara K 2003 Diverse regulation of full-length and truncated growth hormone receptor expression in 3T3-L1 adipocytes. Molecular and Cellular Endocrinology 210 21–29.[CrossRef][ISI][Medline]
Kaestner KH, Flores-Riveros JR, McLenithan JC, Janicot M & Lane MD 1991 Transcriptional repression of the mouse insulin-responsive glucose transporter (GLUT4) gene by cAMP. PNAS 88 1933–1937.
Klein J, Fasshauer M, Ito M, Lowell BB, Benito M & Kahn CR 1999 beta(3)-adrenergic stimulation differentially inhibits insulin signaling and decreases insulin-induced glucose uptake in brown adipocytes. Journal of Biological Chemistry 274 34795–34802.
Klein J, Fasshauer M, Benito M & Kahn CR 2000 Insulin and the beta3-adrenoceptor differentially regulate uncoupling protein-1 expression. Molecular Endocrinology 14 764–773.
Laborda J 1991 36B4 cDNA used as an estradiol-independent mRNA control is the cDNA for human acidic ribosomal phosphoprotein PO. Nucleic Acids Research 19 3998.
Lazar MA 2005 How obesity causes diabetes: not a tall tale. Science 307 373–375.
Maison P, Byrne CD, Hales CN & Wareham NJ 2000 Hypertension and its treatment influence changes in fasting nonesterified fatty acid concentrations: a link between the sympathetic nervous and the metabolic syndrome? Metabolism 49 81–87.[CrossRef][ISI][Medline]
Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR & Flier JS 2001 A transgenic model of visceral obesity and the metabolic syndrome. Science 294 2166–2170.
Matthaei S, Stumvoll M, Kellerer M & Haring HU 2000 Pathophysiology and pharmacological treatment of insulin resistance. Endocrine Reviews 21 585–618.
Rahn Landstrom T, Mei J, Karlsson M, Manganiello V & Degerman E 2000 Down-regulation of cyclic-nucleotide phosphodiesterase 3B in 3T3-L1 adipocytes induced by tumour necrosis factor alpha and cAMP. Biochemical Journal 346 Pt 2: 337–343.
Reaven GM, Lithell H & Landsberg L 1996 Hypertension and associated metabolic abnormalities–the role of insulin resistance and the sympathoadrenal system. New England Journal of Medicine 334 374–381.
Sakoda H, Ogihara T, Anai M, Funaki M, Inukai K, Katagiri H, Fukushima Y, Onishi Y, Ono H, Fujishiro M, Kikuchi M, Oka Y & Asano T 2000 Dexamethasone-induced insulin resistance in 3T3-L1 adipocytes is due to inhibition of glucose transport rather than insulin signal transduction. Diabetes 49 1700–1708.[Abstract]
Spiegelman BM & Flier JS 2001 Obesity and the regulation of energy balance. Cell 104 531–543.[CrossRef][ISI][Medline]
Stephens JM & Pekala PH 1991 Transcriptional repression of the GLUT4 and C/EBP genes in 3T3-L1 adipocytes by tumor necrosis factor-alpha. Journal of Biological Chemistry 266 21839–21845.
Takano A, Haruta T, Iwata M, Usui I, Uno T, Kawahara J, Ueno E, Sasaoka T & Kobayashi M 2001 Growth hormone induces cellular insulin resistance by uncoupling phosphatidylinositol 3-kinase and its downstream signals in 3t3-l1 adipocytes. Diabetes 50 1891–1900.
Wajchenberg BL 2000 Subcutaneous and visceral adipose tissue: their relation to the metabolic syndrome. Endocrine Reviews 21 697–738.
Ward AM, Fall CH, Stein CE, Kumaran K, Veena SR, Wood PJ, Syddall HE & Phillips DI 2003 Cortisol and the metabolic syndrome in South Asians. Clinical Endocrinology 58 500–505.[CrossRef][Medline]
Zou L, Menon RK & Sperling MA 1997 Induction of mRNAs for the growth hormone receptor gene during mouse 3T3-L1 preadipocyte differentiation. Metabolism 46 114–118.[CrossRef][ISI][Medline]
Received 20 April 2005
Accepted 22 April 2005
Made available online as an Accepted Preprint 29 April 2005
This article has been cited by other articles:
|
|
 |
|
  T. Luk, Z. Malam, and J. C. Marshall Pre-B cell colony-enhancing factor (PBEF)/visfatin: a novel mediator of innate immunity J. Leukoc. Biol., April 1, 2008; 83(4): 804 - 816. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. B. Dahl, A. Yndestad, M. Skjelland, E. Oie, A. Dahl, A. Michelsen, J. K. Damas, S. H. Tunheim, T. Ueland, C. Smith, et al. Increased Expression of Visfatin in Macrophages of Human Unstable Carotid and Coronary Atherosclerosis: Possible Role in Inflammation and Plaque Destabilization Circulation, February 27, 2007; 115(8): 972 - 980. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Frydelund-Larsen, T. Akerstrom, S. Nielsen, P. Keller, C. Keller, and B. K. Pedersen Visfatin mRNA expression in human subcutaneous adipose tissue is regulated by exercise Am J Physiol Endocrinol Metab, January 1, 2007; 292(1): E24 - E31. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Lopez-Bermejo, B. Chico-Julia, M. Fernandez-Balsells, M. Recasens, E. Esteve, R. Casamitjana, W. Ricart, and J.-M. Fernandez-Real Serum Visfatin Increases With Progressive {beta}-Cell Deterioration. Diabetes, October 1, 2006; 55(10): 2871 - 2875. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. D. Bailey, J C. Loredo-Osti, P. Lepage, J. Faith, J. Fontaine, K. M. Desbiens, T. J. Hudson, C. Bouchard, D. Gaudet, L. Perusse, et al. Common Polymorphisms in the Promoter of the Visfatin Gene (PBEF1) Influence Plasma Insulin Levels in a French-Canadian Population. Diabetes, October 1, 2006; 55(10): 2896 - 2902. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S Kralisch, U Lossner, M Bluher, R Paschke, M Stumvoll, and M Fasshauer Tissue inhibitor of metalloproteinase 1 expression and secretion are induced by {beta}-adrenergic stimulation in 3T3-L1 adipocytes. J. Endocrinol., June 1, 2006; 189(3): 665 - 670. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Dotsch, W. Rascher, and U. Meissner Does visceral fat produce insulin? Eur. J. Endocrinol., October 1, 2005; 153(4): 475 - 476. [Full Text] [PDF]
|
|
|
|
|
|
S. Kralisch, J. Klein, U. Lossner, M. Bluher, R. Paschke, M. Stumvoll, and M. Fasshauer Interleukin-6 is a negative regulator of visfatin gene expression in 3T3-L1 adipocytes Am J Physiol Endocrinol Metab, October 1, 2005; 289(4): E586 - E590. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
