|
|
||||||||
Research Unit, La Paz University Hospital, Madrid, Spain
(Requests for offprints should be addressed to E De Miguel del Campo, Research Unit Cirugía Experimental, Hospital Universitario La Paz, Castellana 261, 28046 Madrid, Spain; Email: emiguel.hulp{at}salud.madrid.org)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The telomerase enzyme consists of two essential components, the reverse transcriptase subunit, which contains telomerase catalytic activity (TERT), and the associated RNA component, which serves as the template to synthesise the telomeric sequence (Nugent & Lundblad 1998). There is evidence to indicate that the TERT, but not the RNA component, is highly correlated with the presence of telomerase activity (Koyanagi et al. 2000, Misiti et al. 2000). In fact, the telomerase activity in telomerase-negative cells can be restored by ectopic human TERT expression (Bodnar et al. 1998), which suggests that in certain cases, TERT is the only limiting factor for telomerase activation.
Telomerase activity is closely regulated by changes in gene transcription (Kyo et al. 2000, Mauro & Foster 2002), proteinprotein interactions (Haendeler et al. 2003) and phosphorylation by protein kinase C, ERK1/2 and phosphatidylinositol 3'-kinase (PI3-K)/Akt (Li et al. 1998, Kang et al. 1999, Maida et al. 2002).
Human somatic cells normally lack telomerase activity (Ramakrishnan et al. 1998); however, approximately 90% of tumour-derived immortal cells (Kim et al. 1994), the germ-line cells, certain stem cells and cells from renewable tissues, such as intestinal epithelium and liver (Wright et al. 1996, Yasumoto et al. 1996, Inui et al. 2002), do contain telomerase activity. In these cells, telomerase activity is usually growth-regulated. In fact, growth signals induced, for example, by fibroblast growth factor (FGF), epidermal growth factor (EGF) or insulin growth factor (IGF)-I, are directly or indirectly involved in telomerase regulation (Haik et al. 2000, Akiyama et al. 2002, Wetterau et al. 2003).
Growth hormone (GH) is a peptide molecule that has diverse and pleiotropic actions on cellular metabolism, growth and differentiation (Carter et al. 1996). Other functions of GH are involved in apoptosis inhibition and cell survival (Gomez de Segura et al. 1998, Costoya et al. 1999, Vazquez et al. 1999, Frago et al. 2002, Liu et al. 2002, Madrid et al. 2002, Maida et al. 2002). The signal transduction pathways triggered by GH in these processes have been analysed. Binding between GH and GH receptor (GHR) induces tyrosyl phosphorylation and activation of Janus kinase-2, a cytoplasmic kinase that is associated with GHR and mediates the cellular effects of GH (Carter et al. 1996). Subsequent signalling events include tyrosyl phosphorylation of the GHR and phosphorylation and activation of a number of cytoplasmic molecules, including signal transducer and activator of transcription-1 (STAT1), STAT3 and STAT5; mitogen activated protein kinases (MAPKs) (ERK-1 and ERK-2); insulin receptor substrate-1 (IRS1), IRS2 and IRS3; and PI3-K (Moller et al. 1992, Carter et al. 1996, Costoya et al. 1999).
In the present work we are interested in determining whether telomerase is regulated by GH. The findings suggest that GH can induce telomerase activation in Chinese hamster ovary (CHO)4 cells by up-regulating hamster (ham) TERT mRNA expression and by the signal transduction pathway that involves PI3-K.
| Materials and Methods |
|---|
|
|
|---|
CHO4 cells, expressing the rat GHR cDNA, kindly provided by Dr C Moller (Center for Biotechnology, Karolinska Institute, Novum, Huddinge, Sweden; Moller et al. 1992), were cultured in Hams F-12 medium containing 10% fetal calf serum and 1 mM L-glutamine, 50 units/ml penicillin and 50 µg/ml streptomycin (Gibco). To assay GH induction, 3 x 105 cells were plated and starved for 1518 h in serum-free Hams F12 medium, washed twice with PBS and then incubated with several doses of human recombinant GH (hGH) (Pharmacia SA, Spain) for the indicated time periods. To perform bleomycin induction, cells were treated as above, and instead of GH were stimulated with 10 mIU of bleomycin for 24 h in fresh serum-free Hams F12 medium. For inhibitor studies, cells were treated with either LY294002 (PI3-K inhibitor) (Calbiochem-Novabiochem Corp., San Diego, CA, USA) or PD98059 (MAPK kinase (MEK)-1 inhibitor) (Calbiochem-Novabiochem) in the presence or absence of GH for the indicated period of time.
The study was approved by the Institutional Animal Care and Use Committee and met European criteria for protection of animals used for experimental and other scientific purposes (86/609/EU). Animals were purchased from an authorised breeder (Elevage Janvier, Le Genest-St-Isle, France) and housed in standard conditions of light and humidity and with a light/dark cycle of 12 h. Hepatocytes were isolated by perfusion of the livers of Wistar rats with collagenase (Sigma) (Feliu et al. 1983) and suspended in medium 199 supplemented with 10% fetal bovine serum (FBS), 0.1% BSA, 1 µM triiodothyronine, 1 µM dexamethasone and glucose up to 10 mM. Hepatocytes were plated to attain a cell density of 1.2 x 105 cells/cm2 and cultured in a cell incubator at 37 °C in an atmosphere of 5% CO2. Four hours after plating, the medium was replaced by fresh supplemented medium 199. After 19 h of culture, hepatocyte monolayers were washed three times with PBS and incubated for an additional 2 h in medium 199 supplemented with 20 mM Hepes (pH 7.4), 0.1% BSA and 10 mM glucose; after this time 50 nM GH was added for another 24 h.
Telomerase activity assays
Telomerase activity was measured using the quantitative TeloTAGGG Telomerase PCR ELISAPLUS kit (Roche Molecular Biochemicals, Indianapolis, IN, USA) and the TRAPeze Telomerase Detection kit (Intergen, New York, NY, USA). For each experiment, 3 x 105 CHO4 cells were plated in a 60 mm well in medium containing 10% FBS for 24 h before washing twice with phosphate buffer and changing to serum-free Hams F12 medium for 16 h; after this, cells were stimulated with the indicated doses of hGH for the indicated time periods in fresh serum-free medium. After treatment, 2 x105 were resuspended in 200 µl 1 x lysis reagent and the extracts were obtained according to manufacturers protocol for the TeloTAGGG Telomerase PCR ELISAPLUS kit analysis. For each assay 1.5 µl (1500 cells) were used. For the TRAPeze Telomerase Detection kit, the cell extract was prepared with the CHAPS lysis buffer x 1 according to manufacturers protocol and an aliquot of cell extract containing 200 ng protein was used in each assay. The protein concentration was measured by the bicinchoninic acid protein assay (Pierce, Rockford, IL, USA). Once they had been prepared, the extracts were immediately frozen in liquid nitrogen and stored at 80 °C until use.
The Telomerase PCR ELISAPLUS kit and TRAPeze Telomerase Detection kit are an extension of the original telomeric repeat amplification protocol (TRAP) (Kim et al. 1994). The ELISA kit allows the highly specific amplification of telomerase-mediated elongation products combined with non-radioactive detection following an ELISA protocol. The levels of telomerase activity were within the linear range of the TRAP assay. In the ELISA PCR, telomerase-mediated elongation was performed for 30 min at 25 °C. Afterwards the telomerase was heat inactivated for 5 min at 94 °C. PCR cycling conditions were 25 cycles (94 °C for 30 s, 50 °C for 30 s and at 72 °C for 90 s) followed by a cycle at 72 °C for 10 min. For TRAPeze, briefly, 200 ng protein were added to 50 µl reaction mixtures containing telomeric substrate oligonucleotide primer, a primer and template for amplification of internal standard, reverse oligonucleotide primer, Taq DNA polymerase (5 units/µl) (Roche), dNTP Mix and TRAP reaction buffer. After 30 min incubation at 30 °C for telomerase extension of the TS primer, the PCR cycling conditions were 33 cycles at 94 °C for 30 s, 59 °C for 30 s and 72 °C for 90 s followed by a cycle at 72 °C for 10 min. A loading dye containing bromophenol blue and xylene cyanol (0.25% each in 50% glycerol/50 mM EDTA) was then added to each reaction tube and the sample (25 µl) was loaded on a 12.5% non-denaturing PAGE in 0.5 x TBE buffer. After electrophoresis, the gel with ethidium bromide (1:10 000 in deionised water) was stained for 30 min and destained for 2030 min in deionised water at room temperature. Bands were visualised by ethidium bromide staining and quantified by densitometric scanning (1D Manager; TDI, Madrid, Spain). The telomerase activity was evaluated by the TRAP products/internal control ratio (data not shown).
In each set of experiments for each kit, aliquots of all samples were treated by RNase (37 °C for 20 min) in order to ascertain the specificity of the reaction. The two methods gave very similar results; accordingly, only the ELISA assay was performed in some experiments.
Real-time quantitative PCR for hamTERT mRNA detection
Total RNA was isolated from CHO4 cells using the aqueous phase obtained by the Tri Reagent method (Molecular Research Center, Cincinnati, OH, USA), following the manufacturers instructions. Reverse transcription was performed with 1 µg total RNA, Oligo-p(dT) as primers, and AMV reverse transcriptase (Roche) following the manufacturers instructions. Each PCR contained, in 20 µl, 1 x Fast Start DNA Master SYBR Green 1 mix (Roche), 4 mM MgCl2, 0.5 µM (each) of the sense and antisense primers, and 1 µl of the corresponding cDNA. For each mRNA, hamTERT expression was corrected by the 18S content in each sample. PCR was performed in a LightCycler instrument (Roche) with 10 min preincubation at 95 °C followed by 45 cycles of 5 s at 95 °C (denaturation), 10 s at 70 °C or 60 °C (annealing) for hamTERT or 18S respectively, and 10 s at 72 °C (amplification). Standard curves were run with each set of samples and for each gene. Correlation coefficients (r2) for standard curves were typically
0.98. To confirm the specificity of the reaction product during each run, the melting profile of each sample was analysed using the LightCycler software. The melting profile was determined by keeping the reaction at 80 °C for hamTERT or at 87 °C for 18S, for 10 s, and then heating slowly to 95 °C at a linear rate of 0.1 °C/s to measure fluorescence.
The PCRs employed a set of primers that were specific for the hamTERT gene (Guo et al. 2001): hamTERT sense 5'GACTCTGTTCAGCGTGCTCAA3', and anti-sense 5'AGAACTGGCCCATGTGTGGCT3'. The specific primers for 18S were from the Classic 18S Internal Standards kit (Ambion, Inc., Austin, TX, USA). In all cases, each PCR was repeated at least three times. Some of the samples were run in a gel to confirm that the specific band had the expected size (bp), as well as to rule out possible contaminants that would not be distinguishable by their melting points (not shown).
Statistical analysis
All data were expressed as means ± S.D. unless otherwise indicated. Differences between means of various treatment and control groups were assessed for statistical significance by ANOVA followed by the post-hoc Fisher test for group comparison. A P value<0.05 was considered to indicate statistical significance.
| Results |
|---|
|
|
|---|
We examined the effect of GH on telomerase activity in CHO4 cells. Cells were stimulated with different doses of GH (100, 200, 300, 400 nM) for 24 h before performing the TRAP-based ELISA assay. The maximum of telomerase activation was observed at 300 nM and was statistically different (P<0.05) from the responses with 100, 200 and 400 nM (Fig. 1A
). The highest dose did not stimulate telomerase activity. It is possible that this dose was toxic, as described previously (Madrid et al. 2002). The same result was confirmed with the TRAPeze Telomerase Detection kit (Fig. 1B
). The levels of PCR amplification for the internal control were similar between treatments. The RNase treatment demonstrated the specificity of the telomerase reaction. Telomerase activation was also induced by a radiomimetic drug, bleomycin (data not shown), so telomerase activity can be regulated by different stimuli in CHO4 cells.
|
|
We also sought to determine whether another cell type responded to GH with similar telomerase activation. We therefore treated a primary culture of rat hepatocytes with GH at 50 nM (Beauloye et al. 1999) for 24 h and then performed a TRAP assay with the TRAPeze Telomerase Detection kit (Fig. 3
). This confirmed that GH was able to activate telomerase in a primary culture of rat hepatocytes and demonstrated that GH is able to induce telomerase activation in a different cell type.
|
To investigate whether GH activation of telomerase could be explained by increases in hamTERT mRNA, we used real-time quantitative PCR. Cells were treated with different doses of GH for 24 h. We did not observe a stimulatory effect of GH on the level of hamTERT mRNA at 24 h (data not shown). Some reports have described a rapid and transient induction of TERT mRNA (Liu et al. 2002). We therefore treated the cells with GH (300 nM) for 16 h and also observed up-regulation of hamTert mRNA expression (Table 1
). The maximum induction was produced at 2 h after GH treatment. These results suggest that in CHO4 cells, GH regulation of telomerase activity is primarily transcriptional.
|
We next characterised mechanisms of telomerase activity triggered by GH. PI3-K and MAPK are pathways that are activated by GH. Since telomerase activation can depend on both PI3-K and MAPK activation, we investigated whether these signalling pathways modified the telomerase activation induced by GH. For this purpose CHO4 cells were incubated with GH in the absence or presence of LY294002, a specific PI3-K inhibitor, or of PD98059, a specific inhibitor of MEK1, and then a TRAP-based ELISA assay was performed. The effect of GH was significantly inhibited by the PI3-K inhibitor, but not by the MAPK inhibitor. The PI3-K inhibitor did not affect constitutive telomerase activity (Fig. 4
). To confirm that these concentrations of LY294002 and of PD98059 were efficacious in inhibiting both Akt/protein kinase B and ERK phosphorylation respectively, cells were treated with or without 10 µM LY294002 or 30 µM PD98059 and then treated for 10 min with or without 300 nM GH. Western blot analyses performed to determine the level of phospho-Akt or phospho-ERK demonstrated that the inhibitors used were effective (Fig. 4B
).
|
| Discussion |
|---|
|
|
|---|
In a primary culture of rat hepatocytes, which express GHR physiologically, we found that GH also triggered telomerase activity. Previously it has been shown that other growth factors such as EGF and hepatocyte growth factor also induce telomerase activation in hepatocytes (Inui et al. 2002). These events would confirm the regulation of telomerase by different growth factors, among which would be GH. On the other hand, GH does not activate telomerase in a prostate cancer cell line (Wetterau et al. 2003), perhaps indicating that the response would depend on cell type.
Expression of the catalytic subunit of telomerase is tightly linked to the regulation of its enzymatic activity and it is, in certain cases, a rate-limiting determinant of telomerase activity (Kyo et al. 1997, Minamino & Kourembanas 2001). TERT regulation involves transcriptional and post-transcriptional mechanisms (Mauro & Foster 2002). We have shown that the activation of telomerase by GH was induced by an increase in hamTERT mRNA expression. However, although the GH-induced telomerase activity was maximal at 24 h, it did not correlate with the TERT mRNA levels at this time. This discrepancy may be because GH elevates hamTERT mRNA levels rapidly and transiently, with a maximum effect between 2 and 4 h, that begins to decrease at 6 h and reaches the baseline level at 24 h (data not shown). Similar results have been described in response to oestrogen (Kyo et al. 1999), EGF (Maida et al. 2002), basic FGF in fibroblasts (Liu et al. 2002) or IGF-I (Wetterau et al. 2003), where telomerase activation has been induced through the up-regulation of TERT mRNA expression.
As mentioned above, telomerase activity may be regulated through PI3-K/Akt or ERK1/2 (Kang et al. 1999, Maida et al. 2002); in fact, PI3-K/Akt enhances human telomerase activity by phosphorylating the telomerase catalytic subunit (Kang et al. 1999, Breitschopf et al. 2001, Haendeler et al. 2003). Akt is one of the downstream targets of PI3-K, a signalling molecule associated with growth factors (Akiyama et al. 2002). In other GHR-transfected CHO cells, GH promoted growth by increasing cell survival and that effect depended on PI3-K/Akt activation (Costoya et al. 1999). Several pathways activated by GH are triggered through PI3-K and MAPK (Carter et al. 1996), so we examined the implication of both signalling pathways in regulating telomerase activity in CHO4 cells. We saw that the PI3-K inhibitor, LY294002, but not the MEK1 signalling pathway inhibitor, PD98059, decreased GH-induced telomerase activation. We also observed that LY294002 only down-regulated GH-induced telomerase activity in CHO4 cells, but not their constitutive activity. Our results indicate that the PI3-K/Akt pathway may mediate GH-induced telomerase up-regulation. Similar results have been described in a human multiple myeloma cell line, where telomerase activation would depend on PI3-K in response to other factors such as IGF-I or interleukin-6 (Akiyama et al. 2002).
The actions of GH on telomerase may be direct or mediated by IGF-I. The observed effect on CHO4 cells suggest a direct action since this system has been shown to not produce IGF-I in response to GH (Moller et al. 1992). Furthermore, this cell system was also employed to demonstrate the actin filament reorganisation in an IGF-I-independent response to GH (Goh et al. 1997). Therefore, although IGF-I can stimulate telomerase activity in other cell system like human multiple myeloma and DU-145 prostate cancer cells (Akiyama et al. 2002), we think that in our system GH activates telomerase independently of IGF-I.
GH has neuroprotective and radioprotective qualities and possesses the ability to inhibit apoptosis and induce cell survival (Gomez de Segura et al. 1998, Vazquez et al. 1999, Frago et al. 2002). In fact, in GHR-transfected CHO cells, GH may promote growth by increasing cell survival and that effect may depend on PI3-K/Akt activation (Costoya et al. 1999). Using the same in vitro cell system used in this study, we have reported that GH promotes cell survival when the cells have been exposed to GH prior to irradiation (Madrid et al. 2002). Likewise, telomerase activity is also closely associated with cell proliferation (Minamino & Kourembanas 2001, Smith et al. 2003) in different types of cells and contributes to the life span and integrity of these cells by protecting against apoptosis as well as by inducing cell survival or neuroprotection (Bodnar et al. 1998, Zhu et al. 2000, Haendeler et al. 2003). In the light of these reports, we observed that not only are there are functional coincidences between GH and telomerase, but they also may share signal transduction pathways involving Akt (Costoya et al. 1999, Kang et al. 1999).
Here we have demonstrated that a PI3-K inhibitor, LY294002, can block Akt phosphorylation, a key step in activating the PI3-K signal pathway in response to GH. The identification of real Akt kinase substrates, such as telomerase, provided clues to understanding how GH could contribute to cell survival or proliferation via the PI3-K pathway. Current knowledge about the regulation of telomerase activity has shown that the modulation of this enzyme is critical for cell growth and survival.
In summary, we have shown that, in CHO4 cells, supraphysiological doses of GH activate telomerase. This activation involves mechanisms that are both transcriptional, by up-regulating hamTERT transcription, and post-transcriptional, through PI3-K signal pathways. Future studies are needed to identify the specific GH-induced signal transduction pathways that ultimately affect telomerase activity and the possible implication of this activation in cell proliferation or survival.
| Acknowledgements |
|---|
| Funding |
|---|
This work has been supported by the Fondo de Investigaciones Sanitarias, project FIS PI020455 and by the Comunidad de Madrid, project CAM 08.6/0033/01.1. There is no conflict of interest in this article.
| References |
|---|
|
|
|---|
Beauloye V, Ketelslegers JM, Moreau B & Thissen JP 1999 Dexamethasone inhibits both growth hormone (GH)-induction of insulin-like growth factor-I (IGF-I) mRNA and GH receptor (GHR) mRNA levels in rat primary cultured hepatocytes. Growth Hormone and IGF Research 9 205211.
Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu CP, Morin GB, Harley CB, Shay JW, Lichtsteiner S & Wright WE 1998 Extension of life-span by introduction of telomerase into normal human cells. Science 279 349352.
Breitschopf K, Zeiher AM & Dimmeler S 2001 Pro-atherogenic factors induce telomerase inactivation in endothelial cells through an Akt-dependent mechanism. FEBS Letters 493 2125.[CrossRef][Web of Science][Medline]
Carter S, Schwartz J & Smith LS 1996 Molecular mechanism of growth hormone action. Annual Review of Physiology 58 187207.[CrossRef][Web of Science][Medline]
Costoya JA, Finidori J, Moutoussamy S, Searis R, Devesa J & Arce VM 1999 Activation of growth hormone receptor delivers an antiapoptotic signal: evidence for a role of Akt in this pathway. Endocrinology 140 59375943.
Feliu JE, Mojena M, Silvestre RA, Monge L & Marco J 1983 Stimulatory effect of vasoactive intestinal peptide on glycogenolysis and gluconeogenesis in isolated rat hepatocytes: antagonism by insulin. Endocrinology 112 21202127.
Frago LM, Paneda C, Dickson SL, Hewson AK, Argente J & Chowen JA 2002 Growth hormone (GH) and GH-releasing peptide-6 increase brain insulin-like growth factor-I expression and activate intracellular signalling pathways involved in neuroprotection. Endocrinology 143 41134122.
Goh EL, Pircher TJ, Wood TJ, Norstedt G, Graichen R & Lobie PE 1997 Growth hormone-induced reorganisation of the actin cytoskeleton is not required for STAT5 (signal transducer and activator of transcription-5)-mediated transcription. Endocrinology 138 32073215.
Gomez de Segura IA, Prieto I, Grande AG, Garcia P, Guerra A, Mendez J & De Miguel E 1998 Growth hormone reduces mortality and bacterial translocation in irradiated rats. Acta Oncologica 37 179185.[CrossRef][Medline]
Greider CW 1996 Telomere length regulation. Annual Review of Biochemistry 65 337365.[CrossRef][Web of Science][Medline]
Guo W, Okamoto M, Lee YM, Baluda MA & Park NH 2001 Enhanced activity of cloned hamster TERT gene promoter in transformed cells. Biochimica et Biophysica Acta 1517 398409.[Medline]
Haendeler J, Hoffmann J, Rahman S, Zeiher AM & Dimmeler S 2003 Regulation of telomerase activity and anti-apoptotic function by proteinprotein interaction and phosphorylation. FEBS Letters 536 180186.[CrossRef][Web of Science][Medline]
Haik S, Gauthier LR, Granotier C, Peyrin JM, Lages CS, Dormont D & Boussin FD 2000 Fibroblast growth factor 2 up regulates telomerase activity in neural precursor cells. Oncogene 19 29572966.[CrossRef][Medline]
Inui T, Shinomiya N, Fukasawa M, Kobayashi M, Kuranaga N, Ohkura S & Seki S 2002 Growth-related signaling regulates activation of telomerase in regenerating hepatocytes. Experimental Cell Research 273 147156.[Medline]
Kang SS, Kwon T, Kwon DY & Do SI 1999 Akt protein kinase enhances human telomerase activity through phosphorylation of telomerase reverse transcriptase subunit. Journal of Biological Chemistry 274 1308513090.
Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PL, Coviello GM, Wright WE, Weinrich SL & Shay JW 1994 Specific association of human telomerase activity with immortal cells and cancer. Science 266 20112015.
Koyanagi Y, Kobayashi D, Yajima T, Asanuma K, Kimura T, Sato T, Kida T, Yagihashi A, Kameshima H & Watanabe N 2000 Telomerase activity is down regulated via decreases in hTERT mRNA but not TEP1 mRNA or hTERC during the differentiation of leukemic cells. Anticancer Research 20 773778.[Web of Science][Medline]
Kyo S, Takakura M, Kohama T & Inoue M 1997 Telomerase activity in human endometrium. Cancer Research 57 610614.
Kyo S, Takakura M, Kanaya T, Zhuo W, Fujimoto K, Nishio Y, Orimo A & Inoue M 1999 Estrogen activates telomerase. Cancer Research 59 59175921.
Kyo S, Takakura M, Taira T, Kanaya T, Itoh H, Yutsudo M, Ariga H & Inoue M 2000 Sp1 cooperates with c-Myc to activate transcription of the human telomerase reverse transcriptase gene (hTERT). Nucleic Acids Research 28 669677.
Li H, Zhao L, Yang Z, Funder JW & Liu JP 1998 Telomerase is controlled by protein kinase Calpha in human breast cancer cells. Journal of Biological Chemistry 273 3343633442.
Liu T, Nozaki Y & Phan SH 2002 Regulation of telomerase activity in rat lung fibroblasts. American Journal of Respiratory Cell and Molecular Biology 26 534540.
Madrid O, Varea S, Sanchez-Perez I, Gómez-García I, De Miguel E, Gómez de Segura IA & Perona R 2002 Growth hormone protects against radiotherapy-induced cell death. European Journal of Endocrinology 147 535541.[Abstract]
Maida Y, Kyo S, Kanaya T, Wang Z, Yatabe N, Tanaka M, Nakamura M, Ohmichi M, Gotoh N, Murakami S & Inoue M 2002 Direct activation of telomerase by EGF through Ets-mediated transactivation of TERT via MAP kinase signalling pathway. Oncogene 21 40714079.[CrossRef][Web of Science][Medline]
Mauro LJ & Foster DN 2002 Regulators of telomerase activity. American Journal of Respiratory Cell and Molecular Biology 26 521524.
Minamino T & Kourembanas S 2001 Mechanisms of telomerase induction during vascular smooth muscle cell proliferation. Circulation Research 89 237243.
Misiti S, Nanni S, Fontemaggi G, Cong YS, Wen J, Hirte HW, Piaggio G, Sacchi A, Pontecorvi A, Bacchetti S et al. 2000 Induction of hTERT expression and telomerase activity by estrogens in human ovary epithelium cells. Molecular and Cellular Biology 20 37643771.
Moller C, Hansson A, Enberg B, Lobie PE & Norstedt G 1992 Growth hormone (GH) induction of tyrosine phosphorylation and activation of mitogen-activated protein kinases in cells transfected with rat GH receptor cDNA. Journal of Biological Chemistry 267 2340323408.
Nugent CI & Lundblad V 1998 The telomerase reverse transcriptase: components and regulation. Genes and Development 12 10731085.
Oh H, Taffet GE, Youker KA, Entman ML, Overbeek PA, Michael LH & Schneider MD 2001 Telomerase reverse transcriptase promotes cardiac muscle cell proliferation, hypertrophy, and survival. PNAS 98 1030810313.
Ramakrishnan S, Eppenberger U, Mueller H, Shinkai Y & Narayanan R 1998 Expression profile of the putative catalytic subunit of the telomerase gene. Cancer Research 58 622625.
Smith LL, Coller HA & Roberts JM 2003 Telomerase modulates expression of growth-controlling genes and enhances cell proliferation. Nature Cell Biology 5 474479.[CrossRef][Web of Science][Medline]
Vazquez I, Gomez de Segura IA, Grande AG, Escribano A, Gonzalez Gancedo P, Gomez A & Diez R 1999 Protective effect of enriched diet plus growth hormone administration on radiation-induced intestinal injury and on its evolutionary pattern in the rat. Digestive Diseases and Sciences 44 23502358.[Medline]
Wetterau LA, Francis MJ, Ma L & Cohen P 2003 Insulin-like growth factor I stimulates telomerase activity in prostate cancer cells. Journal of Clinical Endocrinology and Metabolism 88 33543359.
Wright WE, Piatyszek MA, Rainey WE, Byrd W & Shay JW 1996 Telomerase activity in human germline and embryonic tissues and cells. Developmental Genetics 18 173179.[CrossRef][Web of Science][Medline]
Yasumoto S, Kunimura C, Kikuchi K, Tahara H, Ohji H, Yamamoto H, Ide T & Utakoji T 1996 Telomerase activity in normal human epithelial cells. Oncogene 13 433439.[Web of Science][Medline]
Zhu H, Fu W & Mattson MP 2000 The catalytic subunit of telomerase protects neurons against amyloid beta-peptide-induced apoptosis. Journal of Neurochemistry 75 117124.[CrossRef][Web of Science][Medline]
Received 8 February 2005
Accepted 24 February 2005
Made available online as an Accepted Preprint 1 March 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |