JOE
HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Endocrinology (2005) 185, 35-44    DOI: 10.1677/joe.1.06031
© 2005 Society for Endocrinology

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vázquez, P.
Right arrow Articles by Alvarez, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vázquez, P.
Right arrow Articles by Alvarez, E.

Substitution of the cysteine 438 residue in the cytoplasmic tail of the glucagon-like peptide-1 receptor alters signal transduction activity

Patricia Vázquez, Isabel Roncero, Enrique Blázquez and Elvira Alvarez

Departamento de Bioquímica y Biología Molecular, Facultad de Medicina, Universidad Complutense de Madrid, Ciudad Universitaria, 28040 Madrid, Spain

(Requests for offprints should be addressed to Elvira Alvarez; Email: eao513{at}med.ucm.es)


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Several G-protein-coupled receptors contain cysteine residues in the C-terminal tail that may modulate receptor function. In this work we analysed the substitution of Cys438 by alanine in the glucagon-like peptide-1 (GLP-1) receptor (GLPR), which led to a threefold decrease in cAMP production, although endocytosis and cellular redistribution of GLP-1 receptor agonist-induced processes were unaffected. Additionally, cysteine residues in the C-terminal tail of several G-protein-coupled receptors were found to act as substrates for palmitoylation, which might modify the access of protein kinases to this region. His-tagged GLP-1 receptors incorporated 3H-palmitate. Nevertheless, substitution of Cys438 prevented the incorporation of palmitate. Accordingly, we also investigated the effect of substitution of the consensus sequence by protein kinase C (PKC) Ser431/432 in both wild-type and Ala438 GLP-1 receptors. Substitution of Ser431/432 by alanine did not modify the ability of wild-type receptors to stimulate adenylate cyclase or endocytosis and recycling processes. By contrast, the substitution of Ser431/432 by alanine in the receptor containing Ala438 increased the ability to stimulate adenylate cyclase. All types of receptors were mainly internalised through coated pits. Thus, cysteine 438 in the cytoplasmic tail of the GLP-1 receptor would regulate its interaction with G-proteins and the stimulation of adenylyl cyclase. Palmitoylation of this residue might control the access of PKC to Ser431/432.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Glucagon-like peptide-1(7–36)amide (GLP-1) is an intestinal peptide synthesised in L-cells. It is also produced in the brain (Jin et al. 1988, Kreymann et al. 1989), where it exerts some effects on neurotransmitter release from selected brain nuclei (Mora et al. 1992, Calvo et al. 1995) and produces an inhibitory effect on food and water intake (Navarro et al. 1996, Tang-Christensen 1996, Turton et al. 1996). Subcutaneous administration of GLP-1(7–36)amide also elicits a reduction in food and water intake (Rodriguez de Fonseca et al. 2000). Similar results were found in human subjects when the peptide was administered peripherally (Gutzwiller et al. 1999). Administered subcutaneously, the peptide could be transported into the brain through the choroid plexus, which has a high density of GLP-1 receptors (GLPR) (Alvarez et al. 1996), or by blood–brain barrier-free organs, such as the subfornical organ and the area postrema (Orskov et al. 1996). It has also been suggested that this peptide acts as a neurotrophic factor. GLP-1 receptors are expressed at high levels in glial cells after mechanical injury (Chowen et al. 1999) and it has recently been shown that GLP-1(7–36)amide can promote the proliferation and differentiation of PC12 cells (Perry et al. 2002).

GLP-1(7–36)amide also has a potent effect on glucose-dependent insulin secretion (Kreymann et al. 1987, Weir et al. 1989), and it also increases arterial blood pressure, heart rate (Barragán et al. 1994, 1996), and lung surfactant synthesis (Benito et al. 1998, Vara et al. 2001).

The effects of GLP-1(7–36)amide are mediated through a specific G-protein-coupled receptor (Thorens 1992, Dillon et al. 1993, Wheeler et al. 1993, Wei & Mojsov 1995, Alvarez et al. 1996) and its signalling on target cells is dependent on activation of the adenylate cyclase pathway (Thorens 1992, Wheeler et al. 1993). In this context, the third intracellular cytoplasmic loop is involved in coupling to G proteins and activation of the adenylyl cyclase system (Takhar et al. 1996). Desensitisation of the GLP-1 receptor has been correlated with C-terminal tail phosphorylation. Homologous desensitisation produced by GLP-1(7–36)amide induces the phosphorylation of three serine doublets located at positions 441/442, 444/445 and 451/452 and decreases maximum cAMP production by 20% (Widmann et al. 1997). Heterologous desensitisation of the GLP-1 receptor by protein kinase C (PKC) is correlated with the phosphorylation of four serine doublets located at positions 431/432, 441/442, 444/445 and 451/452. Activation of PKC by phorbol esters also decreases maximum cAMP production by 30% (Widmann et al. 1996a,b), and the levels of phosphorylation induced by GLP-1 and phorbol esters are additive (Widmann et al. 1996b). Phosphorylation of the three serine doublets, Ser441/442, Ser444/445 and Ser451/452, at the cytoplasmic tail after agonist binding is related to receptor endocytosis (Widmann et al. 1997). Agonist-promoted phosphorylation of the G-protein-coupled receptors increases the affinity of ß-arrestins and these act as a clathrin adaptor protein in the internalisation process (Goodman et al. 1996).

Most G-protein-coupled receptors have one or two cysteine residues in the carboxyl-terminal cytoplasmic tail, and palmitoylation of these cysteines has been reported for several members of this family of receptors (Bouvier et al. 1995a,b, Morello & Bouvier 1996). The palmitate tail anchors the cytoplasmic tail of the receptor into the plasma membrane to create a fourth intracellular loop, allowing a reversible and dynamic regulation (Bouvier et al. 1995a).

The aim of this study was to investigate whether cysteine 438 is a site of acylation and the function of Cys438 in signal transduction through GLP-1 receptors.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mutagenesis of the GLP-1 receptor

A HindIII-XbaI fragment of the rat GLP-1 receptor cDNA (Thorens 1992) was subcloned into PUC 18. Site-directed mutagenesis of cysteine 438 was accomplished using the Transformer Site-directed Mutagenesis kit from Clontech (Palo Alto, CA, USA). Mutagenic primers were prepared: 5' CCCCTTAAGGCTCCCAC CAGC 3'to change Cys438 to Ala and to create a BfrI restriction site, and 5'CCCCTTAAGTGTCCCACC AGC 3'to create only a BfrI restriction site at nucleotide 1322. A selection primer, 5' GTGTATCTTATGCC AAGTACG 3', to eliminate a unique NdeI restriction site in the vector was also used. Clones BfrI/Ala438 and BfrI were selected and mutations were confirmed by sequencing using an automated LKB ALF DNA sequencer (Amersham Pharmacia Biotech, Barcelona, Spain). HindIII-XbaI mutant cDNA was then cloned into the expression vector to create pcDNA3-GLPR A438 and pcDNA3 GLPR BfrI.

For substitution of amino acids Ser431/432 by alanine, PCR site-directed mutagenesis was used, following standard procedures. The following primers were used: two flanking primers -GLPR-1 oligonucleotide, corresponding to nucleotides 969–993, and GLPR-2 oligonucleotide, corresponding to nucleotides 1384–1411 (Thorens 1992); the specific mutation primers GLPR-3: 5'CAGAGGGA CGCCGCCATGAAACCCTC3' and GLPR-4: 5'GG TTTCATGGCGGCGTCCCTCTGGATG were employed to mutate Ser431/432 into alanine residues. Mutation identity was verified by sequence analysis. The fragments containing the mutated gene were subcloned into the SacI/BfrI restriction sites of pcDNA3-GLPR BfrI and pcDNA3-GLPR A438 to create pcDNA3-GLPR A431/432 and pcDNA3-GLPR A431/432/438.

N-terminal epitope-tagged GLP-1 receptors were constructed by inserting a FLAG epitope (DYKDDDDK) after the initial methionine using a PCR strategy. A HindIII-AlwNI fragment was replaced in wild-type and mutant A438 and designated pcDNA 3 tag-GLPR and pcDNA 3 tag-GLPR A438. Also, 6x His-tagged GLP-1 receptors were constructed. BamHI-XbaI wild-type and mutant cDNAs were subcloned into pcDNA 3.1/His and designated pcDNA3-His GLPR and pcDNA3-His GLPR A438. Wild-type and mutant GLP-1 receptors were expressed in CHO cells by transfection using the calcium phosphate method. Transfected cells were selected by incubation with neomycin (geneticin, GIBCO). Stable colonies were isolated using cloning rings.

Binding of 125I-GLP-1(7–36)amide to cell surface receptors

GLP-1(7–36)amide was radio-labelled with 125I by the chloramine T method and mono 125I-GLP-1(7–36)amide was isolated by reverse-phase HPLC. Specific activity was between 3500–4000 d.p.m./fmol. CHO cells grown in 24-well plates (2x105/well) were washed with serum-free medium and incubated for 30 min at 37 °C in KRH (118 mM NaCl, 5 mM KCl, 1.2 mM MgSO4, 2.5 mM CaCl2, 25 mM HEPES, pH 7.4) with 0.5% bovine serum albumin (BSA). Then, cells were chilled on ice, and 125I-GLP-1(7–36)amide (0.1 nM) and unlabelled GLP-1(7–36)amide (0.0–500 nM) were added for at least 16 h at 4 °C. Following this, cells were washed three times with cold medium and solubilised with 1 M NaOH. Non-specific binding of 125I-GLP-1(7–36)amide was estimated in the presence of 500 nM unlabelled ligand and this value was subtracted from the total binding values.

cAMP production assays

cAMP levels were measured using the cAMP Biotrack enzyme immunoassay system (Amersham Biosciences, UK) following the manufacturer’s instructions. Briefly, untransfected CHO cells and cells expressing wild-type and mutant GLP-1 receptors were grown in 12-well plates in F-12 medium supplemented with 5% FBS. CHO cells were washed and incubated in F-12 medium containing 0.1% FBS overnight. Cells were then washed with HBS medium (130 mM NaCl, 0.9 mM NaH2PO4, 0.8 mM MgSO4, 5.4 mM KCl, 1.8 mM CaCl2, 20 mM HEPES, pH 7.4, plus 25 mM glucose) and incubated in HBS containing 1 mM IBMX and 0.1% BSA in the presence or absence of different concentrations of GLP-1(7–36)amide (0.001–100 nM) for 8 min. Then, cells were washed with HBS, after which lysis buffer was added and immediately processed in the immunoassay. In parallel experiments, binding of 125I-GLP-1(7–36)amide to cell surface receptors was determined at 4 °C. The agonist stimulated cAMP production was normalised by 125I-GLP-1(7–36)amide bound to cell surface receptors.

Internalisation of the GLP-1 receptor

The internalisation rate was measured as previously described (Alvarez et al. 1990). Briefly, CHO cells were incubated in KRH (118 mM NaCl, 5 mM KCl, 1.2 mM MgSO4, 2.5 mM CaCl2, 25 mM HEPES, pH 7.4) with 0.5% BSA at 37 °C for 30 min. Then, cells were incubated with 0.1 nM 125I-GLP-1(7–36)amide, and 125I-GLP-1(7–36)amide binding was determined at different times. Intracellular 125I-GLP-1(7–36)amide was measured as cell-associated radioactivity resistant to acid wash by incubation of the cells for 3 min at 4 °C with 50 mM NaCl, 150 mM glycine, pH 3.0. Cell surface-bound 125I-GLP-1(7–36)amide was calculated by subtraction of the intra-cellularly bound 125I-GLP-1(7–36)amide from the total binding.

Effect of metabolic inhibitors and hypertonic medium on the internalisation process

For metabolic depletion, CHO cells were washed twice with glucose-free HBS (140 mM NaCl, 20 mM HEPES, 1 mM CaCl2, 1 mM MgCl2, 10 mM KCl with 0.5% BSA) and incubated in the same buffer containing 20 mM 2-deoxyglucose and 10 mM sodium azide. Hypertonic treatment was performed as previously described (Heuser & Anderson 1989). Briefly, cells were washed twice with HBS containing 0.45 M sucrose and incubated in the same medium for 30 min at 37 °C. Then, 0.1 nM 125I-GLP-1(7–36)amide was added and after 6 min incubation cell-associated radioactivity and acid wash-resistant radioactivity were measured as previously described.

Redistribution of cell surface GLP-1 receptors

CHO cells were seeded in 24-well plates and incubated with 10 nM GLP-1(7–36)amide for different times (3, 6, 10, 15, 30 and 60 min). Then, the cells were washed at 0 °C and subsequently incubated for 3 min at 0 °C with 50 mM NaCl, 150 mM glycine, pH 3.0, to remove ligand bound to the cell surface, and washed with KRH containing 0.5% BSA. Cell surface receptors were then measured as described above.

Immunoprecipitation of tag-GLPR receptors

CHO cells expressing tag-GLPR wild-type or mutant receptors were seeded in 60 cm2 dishes for metabolic labelling. The cells were transferred into culture media: (1) methionine-free modified Eagle’s medium containing 150 µCi/ml 35S-methionine (Amersham Pharmacia Bio-tech) and (2) F-12 medium containing 1% fetal bovine serum (FBS) (GIBCO, Life Technologies, Paisley, UK) and 200 µCi/ml 3H-palmitate (Dupont-NEN, Boston, MA, USA). The cells were then washed and solubilised in PBS containing 1% Triton X-100, 1% deoxycholate, 0.1% SDS, 0.5 M NaCl, 5 mM EDTA, 1 mM PMSF, 50 mM NaF, 5 mM Na4P2O7 and 1 mM Na3VO4. The lysates were centrifuged at 10 000 g for 30 min and the supernatants were incubated with agarose-Streptavidin at room temperature for 30 min. After centrifugation, the supernatants were incubated for 60 min at room temperature with monoclonal anti-FLAG epitope M2-biotin conjugate antibody (SIGMA, Madrid, Spain) prebound to 50 µl agarose-Streptavidin or monoclonal anti-FLAG epitope M2-agarose (SIGMA). The immunoprecipitates were washed and resolved by SDS-PAGE and fluorography.

For purification of His-tagged GLP-1 receptors, crude membrane fractions of CHO cells expressing GLP-1 receptors were loaded into His micro spin columns (Amersham Biosciences Europe, Barcelona, Spain) previously incubated in the presence or absence of an excess of polyHis (30 µg/ml). Then, the columns were washed twice with phosphate/NaCl solution containing 20 mM imidazole and twice with phosphate/NaCl 60 mM imidazole and finally eluted with phosphate/NaCl solution containing 400 mM imidazole. Western blot analyses with anti-His antibody (Amersham Biosciences Europe) were performed following the manufacturer’s instructions.

CHO cells expressing His-wild-type or mutant GLP-1 receptors were also labelled with 35S-methionine or 3H-palmitate as described above. His-tagged GLP-1 receptors were purified using His micro spin columns and samples were resolved by SDS-PAGE and fluorography.

Data analysis

Data from competition experiments were analysed by non-linear regression with the GraphPad Prism computer program (GraphPad Software Inc., San Diego, CA, USA). Dissociation constants (Kd) and concentrations of receptor sites (Bmax) were calculated from IC50 values using the method of Cheng and Prusoff (1973). Data are expressed as means±S.E.M. Statistical comparisons were performed using the Student’s t-test and Newman-Keuls test with at least three separate experiments performed in duplicate (*P<0.05 and **P<0.001).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effect of the mutation in Cys438 on GLP-1 receptor binding

To analyse the role of Cys438 located in the C-terminal domain of the GLP-1 receptor (Fig. 1Go), we constructed a series of mutant receptors in which Cys438 or Ser431,432 were substituted by alanine (Fig. 1Go). CHO cells expressing wild-type or mutant receptors (GLPR A438, GLPR A431/432 and GLPR A431/432/438) were used to determine the binding properties of 125I-GLP-1(7–36)amide to all receptors. The competition binding curves are shown in Fig. 2Go. The Kd and Bmax calculated from the IC50 values are shown in Table 1Go. The competition binding data of wild-type and mutant receptors fit a single-site model best.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1 Amino acid sequence of the C-terminal tail of the wild-type and GLP-1 receptor mutants. The 56 C-terminal amino acids of the rat wild-type and mutant GLP-1 receptor are shown. Italicised letters represent substituted or mutated residues.

 


View larger version (23K):
[in this window]
[in a new window]
 
Figure 2 Analysis of 125I-GLP-1(7–36)amide binding to wild-type and mutant GLP-1 receptors. CHO cells expressing wild-type, GLPR A438, GLPR A431/432 and GLPR A431/432/438 GLP-1 receptors were incubated with 0.1 nM 125I-GLP-1(7–36)amide and increasing concentrations of the unlabelled peptide. The competition binding curves are shown. Data are means±S.E.M. (n=3–6) and are expressed as a percentage of maximal specific binding.

 

View this table:
[in this window]
[in a new window]
 
Table 1 GLP-1(7–36)amide binding parameters and adenylyl cyclase stimulation for wild-type and mutant GLP-1 receptors expressed in CHO cells. The GLP-1(7–36)amide binding parameters were determined by competitive binding assays using CHO cells stably transfected with wild-type and mutant GLP-1 receptors. The data were analysed by non-linear regression and the dissociation constant (Kd) and the concentration of receptor sites (Bmax) of these receptors were calculated from IC50 values as described in Materials and Methods. The data of adenylyl cyclase activity were analysed using non-linear least squares regression. The agonist potency EC50 and maximal GLP-1(7–36)amide-stimulated adenylyl cyclase activity (Rmax) are shown. The data represent the mean ±S.E.M. of three to six independent experiments
 
Activation of adenylate cyclase

The binding of GLP-1(7–36)amide to its receptor produces activation of the adenylate cyclase pathway. Accordingly, we tested the effect of this peptide on the production of cAMP by cells transfected with the wild-type and mutant GLP-1 receptors. As shown in Fig. 3Go, GLP-1(7–36)amide stimulated CHO cells expressing wild-type receptors in a dose-dependent manner; the EC50 of GLP-1(7–36) amide was 0.09±0.03 nM, maximum stimulation (Rmax) being observed at 10 nM of the agonist (Table 1Go). CHO cells expressing mutant GLPR A438 receptors showed a similar EC50 0.05±0.016 nM value calculated from the dose–response curve (Fig. 3Go). However, the mutant receptor revealed a 60–70% decreased efficacy as compared with wild-type receptors (Table 1Go). Similar results were obtained using a pool of clones expressing the wild-type and mutant GLP-1 receptors.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 3 Effect of GLP-1(7–36)amide on cAMP production by CHO cells transfected with wild-type and GLPR A438, GLPR A431/432 and GLPR A431/432/438 GLP-1 receptors. CHO cells expressing wild-type and mutant GLP-1 receptors were stimulated with different concentrations (0.001–100 nM) of GLP-1(7–36)amide for 8 min and cAMP production was determined by enzyme immunoassay and normalised by 125I-GLP-1(7–36)amide bound to cell surface receptors. The data presented are means±S.E.M. of three to six separate experiments performed in duplicate. *P<0.05, **P<0.001, compared with cells expressing wild-type receptors (Neuman-Keuls test).

 
Post-translational modifications of the GLP-1 receptor

To investigate post-translational modifications of the GLP-1 receptor by acylation, CHO cells expressing tag-wild-type GLP-1 receptors were labelled with 35S-methionine and 3H-palmitic acid. The immunoprecipitates were analysed by non-reducing polyacrylamide gel electrophoresis and fluorography. The epitope-tagged GLP-1 receptors were not immunoprecipitated by anti-FLAG M2 monoclonal antibody or anti-FLAG M2 affinity gel, and hence we could not detect tag-GLP-1 receptors in cells labelled with 35S-methionine. We therefore decided to use 6x His-tagged GLP-1 receptors. His-GLP-1 receptors were isolated using His micro spin columns. Western blot analysis using an anti-His antibody (Fig. 4Go) revealed the presence of a 65 kDa band in CHO cells expressing His-tagged wild-type and mutant Ala438 GLP-1 receptors. This band disappeared when the columns were previously saturated with polyHis. CHO cells expressing His-tagged wild-type and mutant GLP-1 receptors were metabolically labelled with 35S-methionine and 3H-palmitate. His-GLP-1 receptors were purified with His micro spin columns and subjected to SDS-PAGE and fluorography. As shown in Fig. 4Go, when the cells were labelled with 35S-methionine a 65 kDa band was detected in cells transfected with wild-type and mutant GLPR A438 receptors. However, when the cells were labelled with 3H-palmitate, the incorporation of 3H-palmitate was only observed in cells expressing wild-type receptors. No 3H-palmitate-labelled band was detected in samples purified from CHO-K1 and mutant GLPR A438 receptor-expressing cell lines, although the expression levels of the wild-type and mutant GLPR A438 receptors were similar in this experiment, as indicated by the 35S-labelled purification. These data are consistent with the hypothesis that Cys438 is a site of GLP-1 receptor palmitoylation.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 4 Immunological detection of His-GLP-1 receptors and fluorography. (A) Eluates of the His micro spin column previously incubated with (+) or without (–) excess polyHis were processed by SDS-PAGE and Western blot. An immunoblot using an anti-His antibody is shown. Arrows indicate the positions of immunoreactive proteins. (B) CHO cells expressing His-GLPR and His-GLPR A438 receptors were labelled with 35S-methionine and 3H-palmitate. His-GLP-1 receptors were purified with His micro spin columns and resolved by SDS-PAGE and fluorography. The figure presents an autoradiograph of the dried gel.

 
The presence of cysteine residues in many G-protein-coupled receptors allows post-translational modification by palmitoylation. It has also been demonstrated that the palmitic acid tail can attach the cytoplasmic domain of the receptor to the cell membrane, which should change accessibility to the phosphorylation sites closest to Cys438 (Ser431,432 and Ser441,442). In other experiments we used a receptor lacking Ser431,432, the consensus phosphorylation site for PKC (GLPR A431/432/438), but keeping the three serine doublets 441/442, 444/445 and 451/452, identified as the sites of homologous phosphorylation in response to agonist binding. To check the specific effect of substitution of Ser431,432 by alanine a mutant GLPR A431/432 was also used (Fig. 1Go).

Effect of substitution of Ser431/432 by alanine on adenylate cyclase activation

Substitution of Ser431/432 by alanine in the wild-type receptor did not modify the potency and efficacy of such receptors in stimulating cAMP production (Fig. 3Go, Table 1Go). By contrast, in cells expressing GLPR A431/432/438 the EC50 value of GLP-1(7–36)amide was similar to that of the wild-type, but the efficacy was three- to fourfold increased relative to the wild-type (Table 1Go).

Effect of the Cys438 mutation and the substitution of Ser431/432 by alanine on the rate of GLP-1 receptor endocytosis

Figure 5AGo shows that the substitution of Cys438 or Ser431/432 by alanine in the GLP-1 receptor did not modify the rate of its internalisation. The first-order endocytic rates measured for wild-type, GLPR A438, GLPR A431/432 and GLPR A431/432/438 were 0.198 ± 0.005 min–1, 0.217 ± 0.006 min–1, 0.18 ± 0.014 min–1 and 0.22 ± 0.015 min–1 respectively. The rate of endocytosis of GLP-1 receptors was also similar in a pool of clones expressing the wild-type and mutant GLP-1 receptors. The effects of metabolic inhibitors or hypertonic medium on the rate of endocytosis were also measured (Fig. 5BGo). The rate of endocytosis was inhibited by 73–90% under both conditions after metabolic depletion and hypertonic treatment in cells expressing wild-type or mutant receptors.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5 Agonist-induced endocytosis and redistribution of GLP-1 receptors and the effect of metabolic inhibitors and hypertonic medium on endocytosis in cells expressing wild-type and mutant GLP-1 receptors. (A) The rate of 125I-GLP-1(7–36)amide endocytosis was measured in CHO cells expressing wild-type, GLPR A438, GLPR A431/432 and GLPR A431/432/438 GLP-1 receptors. Cells were incubated with 0.1 nM 125I-GLP-1(7–36)amide. After defined times, total and acid wash-resistant (intracellular) cell-associated radioactivity was measured. Data are represented in the form of an IN/SUR plot, means±S.E.M. (n=6). IN, intracellular 125I-GLP-1(7–36)amide; SUR, cell surface-bound 125I-GLP-1(7–36)amide. (B) The effects of metabolic depletion and hypertonic medium in the internalisation process were analysed in CHO cells expressing wild-type or mutant GLP-1 receptors. The data are percentages of the rate of endocytosis and are means±S.E.M. of three independent experiments performed in triplicate. (C) The effect of pretreatment with 10 nM GLP-1(7–36)amide on cell surface expression of GLP-1 receptors was investigated. Cells were incubated in the presence of agonist for different times, after which the cells were washed and the ligand bound to the cell surface was removed by acid washing. Finally, 125I-GLP-1(7–36)amide binding to cell surface receptors was measured. Results are means±S.E.M. (n=6).

 
Effect of agonist on the cellular redistribution of GLP-1 receptors

It has been reported that GLP-1 receptor recycling to the cell surface following agonist-induced endocytosis takes about 15 min and that a rapid rate of endocytosis produces a progressive decrease in the surface expression of GLP-1 receptors upon continuous exposure to the agonist.

The effect of pre-exposure to 10 nM GLP-1(7–36)amide on cell surface receptors was determined as a function of time, as shown in Fig. 5CGo. A rapid decrease in cell surface receptor numbers was observed in cells expressing wild-type and mutant GLP-1 receptors. In both cases, the number of cell surface receptors decreased during the first 15 min of agonist exposure, receptor numbers falling to 45–50% of the initial values. After longer times of exposure, the number of cell surface receptors decreased slowly to 36–27% in cells expressing wild-type and mutant receptors respectively.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Here we report the results obtained following the replacement of Cys438 by alanine in the rat GLP-1 receptor.

The data obtained by us show that the GLP-1 receptor is palmitoylated and that substitution of Cys438 by alanine prevented 3H-palmitate incorporation to GLP-1 receptors. We do not have any information about the stoichiometry of GLP-1 receptor palmitoylation.

As compared with the wild-type receptor, the efficacy of mutant A438 receptors in stimulating adenylate cyclase activity after GLP-1(7–36)amide treatment decreased approximately threefold. A decrease in cAMP production in cells expressing mutant GLPR A438 receptors is consistent with the data reported for non-palmitoylated ß2 adrenergic receptors (O’Dowd et al. 1989) and the D1 dopamine receptor (Jensen et al. 1995). In our data, the differences in cAMP production are not correlated with a change in the agonist-affinity state of GLP-1 receptors after the substitution of Cys438 by alanine.

Replacement of Cys438 or substitution of Ser431/432 did not affect the processing of mutant receptors. Under these experimental conditions, wild-type and mutant receptors showed a similar agonist binding affinity. In contrast, the expression level of mutant A438 and A431/432 at the cell surface was higher than for wild-type GLP-1 receptors, and CHO cells transfected with mutant A431/432/438 expressed low levels of receptors as compared with wild-type receptors. Thus, these findings cannot be related to the effect of palmitoylation or depalmitoylation.

It has been reported that the region involved in the coupling of GLP-1 receptors to G proteins is located in the third intracellular cytoplasmic loop (Takhar et al. 1996) and that C-terminal tail phosphorylation is involved in the desensitisation process. Nevertheless, a receptor lacking 33 amino acids of the C-terminal tail stimulates cAMP production at the same rate as wild-type receptors (Widmann et al. 1996a,b). We also tested a truncated receptor lacking 27 amino acids of the C-terminal tail and this truncated form stimulated cAMP production at a similar rate to wild-type receptors, indicating that this region of the cytoplasmic tail is not necessary for the GLP-1 receptor/G protein interaction (our unpublished data).

Palmitoylation of cysteines in the carboxyl terminal tail of G-protein-coupled receptors anchors this receptor domain into the plasma membrane, forming a fourth intracellular loop. Substitution of Cys438 in GLP-1 receptors abolishes 3H-palmitate incorporation, which should produce a different conformational state of the carboxyl terminal tail and may affect the access of kinases to the cytoplasmic tail.

The cytoplasmic tail of GLPR also contains several phosphorylation sites reported to be necessary for the internalisation and desensitisation of GLP-1 receptors. Previous work using GLP-1 receptors revealed that PKC activation by phorbol esters produced phosphorylation of the four serine doublets in the intracytoplasmic tail: Ser431/432, Ser441/442, Ser444/445 and Ser451/452 (Widmann et al. 1996a). Agonist binding to the GLP-1 receptor also induces phosphorylation of three doublets: Ser441/442, Ser444/445 and Ser451/452 (Widmann et al. 1997), and the receptor phosphorylation induced by homologous and heterologous desensitisation is additive (Widmann et al. 1996b). The substitution of Cys438 might regulate the access of protein kinases to such phosphorylation sites. Thus, the phosphorylation of a protein kinase A (PKA) site in the ß2-adrenergic receptor located downstream from the palmitoylated cysteine is also dependent on the state of palmitoylation of the receptor (Moffett et al. 1993, 1996). It has also been reported that mutations of the two Cys residues in the A3-adenosine receptor increase phosphorylation of the receptor independently of the presence of agonist (Palmer & Stiles 2000). Palmitoylation of the vasopressin V1a receptor also regulates phosphorylation, but in this case the reduction of [3H]palmitate incorporation decreased the basal level of phosphorylation of mutant receptors (Hawtin et al. 2001).

Since our data indicated that the rate of endocytosis was similar in wild-type and mutant receptors, and since it has been reported that phosphorylation of the three doublets Ser441/442, Ser444/445 and Ser451/452 is involved in this process, we next investigated the effect of the substitution of serines 431/432 by alanines in the wild-type and GLPR A438 receptors. The substitution of Ser431/432 by alanine did not modify the potency or efficacy of these receptors in stimulating adenylate cyclase. In contrast, substitution of these residues in GLPR A438 receptors increased the efficacy in stimulating adenylate cyclase at concentrations higher than 1 nM GLP-1(7–36)amide.

The results obtained after the substitution of Ser431/432 by alanine when Cys438 is also absent suggest that the rate of phosphorylation of the other serine doublets in the cytoplasmic tail might also be affected. To confirm this hypothesis it would be necessary to analyse the effect of substitution of the other sites of phosphorylation involved in the desensitisation and internalisation of GLP-1 receptors. However, a synergistic action of kinases on other members of G-protein-coupled receptors, such as ß2-adrenergic receptors (Moffett et al. 2001) and A3- adenosine receptors (Palmer & Stiles 2000), has been reported previously.

The effect of the substitution of Cys438 by alanine on the endocytosis and recycling processes was also tested. The GLPR A438 receptors did not show significant differences in the internalisation rate as compared with the wild-type GLP-1 receptor and, likewise, the number of cell surface receptors after agonist exposure decreased in the same way as in cells expressing the wild-type receptors. Substitution of Ser431/432 by alanine in wild-type and GLPR A438 did not modify either the rate of endocytosis or the number of cell surface receptors after exposure to 10 nM agonist. The effect of acid washing was similar in all clones used. Our results suggest that the substitution of Ser431/432 or Cys438 by Ala in the GLP-1 receptor does not modify the capacity of these receptors to interact with the components of the vesicular transport system.

We also studied the endocytosis pathway used by these receptors, testing the effect of hypertonic medium; we found that all wild-type and mutant GLPR A438, GLPR A431/432 and GLPR A431/432/438 receptors were mainly internalised through coated pits.

In conclusion, the substitution of Cys438 in the cytoplasmic tail of GLP-1 receptors decreases the efficacy of adenylate cyclase stimulation promoted by agonist binding through these receptors. In addition, this residue is a site of acylation of GLP-1 receptors and might regulate the state of phosphorylation of the GLP-1 receptor, which modulates the desensitisation process. Nevertheless, further studies are required to confirm the latter hypothesis.


    Acknowledgements
 
This study was supported by grants from Dirección General de Investigación Científica y Técnica (DGI-CYT), Fondo de Investigación Sanitaria, Instituto de Salud Carlos III, RGDM (G03/212) and the Comunidad de Madrid, Spain. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Alvarez E, Girones N & Davis RJ 1990 Inhibition of the receptor-mediated endocytosis of diferric transferrin is associated with the covalent modification of the transferrin receptor with palmitic acid. Journal of Biological Chemistry 265 16644–16655.[Abstract/Free Full Text]

Alvarez E, Roncero I, Chowen JA, Thorens B & Blázquez E 1996 Expression of the glucagon-like peptide-1 receptor gene in rat brain. Journal of Neurochemistry 66 920–927.[ISI][Medline]

Barragán JM, Rodriguez R & Blázquez E 1994 Changes in arterial blood pressure and heart rate induced by glucagon-like peptide-1(7–36)amide in rats. American Journal of Physiology–Endocrinology and Metabolism 266 E459–E466.

Barragán JM, Rodríguez RE, Eng J & Blázquez E 1996 Interactions of exendin(9–39) with the effects of glucagon-like peptide-1(7–36)amide and of exendin-4 on arterial blood pressure and heart rate in rats. Regulatory Peptides 67 63–68.[CrossRef][ISI][Medline]

Benito E, Blázquez E & Bosch M 1998 Glucagon-like peptide-1(7–36)amide increases pulmonary surfactant secretion through a cyclic adenosine 3',5'-monophosphate-dependent protein kinase mechanism in rat type II pneumocytes. Endocrinology 139 2363–2368.[Abstract/Free Full Text]

Bouvier M, Loisel TP & Hebert T 1995a Dynamic regulation of G-protein-coupled receptor palmitoylation: potential role in receptor function. Biochemical Society Transactions 23 577–581.[ISI][Medline]

Bouvier M, Moffett S, Loisel TP, Mouillac B, Hebert T & Chidiac P 1995b Palmitoylation of G-protein-coupled receptor: a dynamic modification with functional consequences. Biochemical Society Transactions 23 116–120.[ISI][Medline]

Calvo JC, Gisolfi CV, Blázquez E & Mora F 1995 Glucagon-like peptide-1(7–36)amide induces the release of aspartic acid and glutamine by the ventromedial hypothalamus of the conscious rat. Brain Research Bulletin 38 435–439.[CrossRef][ISI][Medline]

Cheng Y & Prusoff WH 1973 Relationship between the inhibition constant (KI) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochemical Pharmacology 22 3099–3108.[CrossRef][ISI][Medline]

Chowen JA, Rodriguez de Fonseca F, Alvarez E, Navarro M, García-Segura LM & Blázquez E 1999 Increased glucagon-like peptide-1 receptor expression in glia after mechanical lesion of the rat brain. Neuropeptides 33 212–215.[CrossRef][ISI][Medline]

Dillon JS, Tanizawa Y, Wheeler MB, Leng X-H, Ligon BB, Rabin DU, Yoo-Warren H, Permutt MA & Boyd AE III 1993 Cloning and functional expression of the human glucagon-like peptide-1 (GLP-1) receptor. Endocrinology 133 1907–1910.[Abstract]

Goodman OB, Krupnick JG, Santini F, Gurevich W, Penn RB, Gagnon AW, Keen JH & Benovic JL 1996 ß-Arrestin acts as a clathrin adaptor in endocytosis of the ß 2-adrenergic receptor. Nature 383 447–450.[CrossRef][Medline]

Gutzwiller JP, Goke B, Drewe J, Hildebrand P, Ketterer S, Handschin D, Winterhalder R, Conen D & Beglinger C 1999 Glucagon-like peptide-1: a potent regulator of food intake in humans. Gut 44 81–86.[Abstract/Free Full Text]

Hawtin SR, Tobin AB, Patel S & Wheatley M 2001 Palmitoylation of vasopressin V1a receptor reveals different conformational requirements for signaling, agonist-induced receptor phosphorylation and sequestration. Journal of Biological Chemistry 276 38139–38146.[Abstract/Free Full Text]

Heuser JE & Anderson RG 1989 Hypertonic media inhibit receptor-mediated endocytosis by blocking clathrin-coated pit formation. Journal of Cell Biology 108 389–400.[Abstract/Free Full Text]

Jensen AA, Pedersen UB, Kiemer A, Din N & Andersen PH 1995 Functional importance of the carboxyl tail cysteine residues in the human D1 dopamine receptor. Journal of Neurochemistry 65 1325–1331.[ISI][Medline]

Jin SLC, Han VKM, Simmons JG, Towle AC, Lauder JM & Lund PK 1988 Distribution of glucagon-like peptide-1 (GLP-1), glucagon, and glycentin in the rat brain: an immunocytochemical study. Journal of Comparative Neurology 271 519–532.[CrossRef][ISI][Medline]

Kreymann B, Williams G, Ghatei MA & Bloom SR 1987 Glucagon-like peptide-1(7–36): a physiological incretin in man. Lancet 2 1300–1304.[ISI][Medline]

Kreymann B, Ghatei MA, Burnet P, Williams G, Kanse S, Diani AR & Bloom SR 1989 Characterization of glucagon-like peptide-1(7–36)amide in the hypothalamus. Brain Research 502 325–331.[CrossRef][ISI][Medline]

Moffett S, Mouillac B, Bonin H & Bouvier M 1993 Altered phosphorylation and desensitization patterns of a human ß2-adrenergic receptor lacking the palmitoylated Cys 341. EMBO Journal 12 349–356.[ISI][Medline]

Moffett S, Adam L, Bonin H, Loisel TP, Bouvier M & Mouillac B 1996 Palmitoylated cysteine 341 modulates phosphorylation of the ß2-adrenergic receptor by the cAMP-dependent protein kinase. Journal of Biological Chemistry 271 21490–21497.[Abstract/Free Full Text]

Moffett S, Rousseau G, Lagacé M & Bouvier M 2001 The palmitoylation state of the ß2-adrenergic receptor regulates the synergistic action of cyclic AMP-dependent protein kinase and ß-adrenergic receptor kinase involved in its phosphorylation and desensitization. Journal of Neurochemistry 76 269–279.[CrossRef][ISI][Medline]

Mora F, Expósito I, Sanz B & Blázquez E 1992 Selective release of glutamine and glutamic acid produced by perfusion of GLP-1(7–36)amide in the basal ganglia of the conscious rat. Brain Research Bulletin 29 359–361.[CrossRef][ISI][Medline]

Morello JP & Bouvier M 1996 Palmitoylation: a posttranslational modification that regulates signalling from G-protein-coupled receptor. Biochemistry and Cell Biology 74 449–457.[ISI][Medline]

Navarro M, Rodriguez de Fonseca F, Alvarez E, Chowen JA, Zueco JA, Gómez R, Eng J & Blázquez E 1996 Colocalization of glucagon-like peptide-1 (GLP-1) receptors, glucose transporter GLUT-2, and glucokinase mRNAs in rat hypothalamic cells: evidence for a role of GLP-1 receptor agonists as an inhibitory signal for food and water intake. Journal of Neurochemistry 67 1982–1991.[ISI][Medline]

O’Dowd BF, Hnatowich M, Caron MG, Lefkowitz RJ & Bouvier M 1989 Palmitoylation of the human ß2-adrenergic receptor. Mutation of Cys341 in the carboxyl tail leads to an uncoupled nonpalmitoylated form of the receptor. Journal of Biological Chemistry 264 7564–7569.[Abstract/Free Full Text]

Orskov C, Poulsen SS, Moller M & Holst JJ 1996 Glucagon-like peptide 1 receptors in the subfornical organ and the area postrema are accessible to circulating glucagon-like peptide 1. Diabetes 45 832–835.[Abstract]

Palmer TM & Stiles GL 2000 Identification of threonine residues controlling the agonist-dependent phosphorylation and desensitization of the rat A3 adenosine receptor. Molecular Pharmacology 57 539–545.[Abstract/Free Full Text]

Perry T, Lahiri DK, Chen D, Zhou J, Shaw KTY, Egan JM & Greig N 2002 A novel neurotrophic property of glucagon-like peptide 1: a promoter of nerve growth factor-mediated differentiation in PC12 cells. Journal of Phamacology and Experimental Therapeutics 300 958–966.

Rodriguez de Fonseca F, Navarro M, Alvarez E, Roncero I, Chowen JA, Maestre O, Gómez R, Muñoz RM, Eng J & Blázquez E 2000 Peripheral versus central effects of glucagon-like peptide-1 on satiety and body weight loss in Zucker obese rats. Metabolism 49 1–10.

Takhar S, Gyomorey S, Su R-C, Mathi SK, Li X & Wheeler MB 1996 The third cytoplasmic domain of the GLP-1(7–36)amide receptor is required for coupling to the adenylyl cyclase system. Endocrinology 137 2175–2178.[Abstract]

Tang-Christensen M, Larsen PJ, Goke R, Fink-Jensen A, Jessop D, Moller M & Sheikh SP 1996 Central administration of GLP-1(7–36)amide inhibits food and water intake in rats. American Journal of Physiology–Regulatory, Integrative and Comparative Physiology 271 R848–R856.

Thorens B 1992 Expression cloning of the pancreatic ß cell receptor for the glucoincretin hormone glucagon-like peptide 1. PNAS 89 8641–8645.[Abstract/Free Full Text]

Turton MD, O’Shea D, Gunn I, Beak SA, Edwards CMB, Meeran K, Choi SJ, Taylor GM, Heath MM, Lambert PD, Wilding JPH, Smith DM, Ghatei MA, Herbert J & Bloom SR 1996 A role for glucagon-like peptide-1 in the central regulation of feeding. Nature 379 69–72.[CrossRef][Medline]

Vara E, Arias-Díaz J, García C, Balibrea JL & Blázquez E 2001 Glucagon-like peptide-1(7–36)amide stimulates surfactant secretion in human type II pneumocytes. American Journal of Respiratory and Critical Care Medicine 163 840–846.[Abstract/Free Full Text]

Wei Y & Mojsov S 1995 Tissue-specific expression of the human receptor for glucagon-like peptide-1: brain, heart and pancreatic forms have the same deduced amino acid sequences. FEBS Letters 358 219–224.[CrossRef][ISI][Medline]

Weir GC, Mojsov S, Hendrich GK & Habener JF 1989 Glucagon-like peptide–1(7–37) actions on endocrine pancreas. Diabetes 38 338–342.[Abstract]

Wheeler MB, Lu M, Dillon JS, Leng X-H, Chen C & Boyd AE III 1993 Functional expression of the rat glucagon-like peptide-1 receptor, evidence for coupling to both adenylyl cyclase and phospholipase C. Endocrinology 133 57–62.[Abstract]

Widmann CH, Dolci W & Thorens B 1996a Heterologous desensitization of the glucagon-like peptide-1 receptor by phorbol esters requires phosphorylation of the cytoplasmic tail at four different sites. Journal of Biological Chemistry 271 19957–19963.[Abstract/Free Full Text]

Widmann CH, Dolci W & Thorens B 1996b Desensitization and phosphorylation of the glucagon-like peptide-1 GLP-1 receptor by GLP-1 and 4-phorbol 12-myristate-13-acetate. Molecular Endocrinology 10 62–75.[Abstract]

Widmann CH, Dolci W & Thorens B 1997 Internalization and homologous desensitization of the GLP-1 receptor dependent on phosphorylation of the receptor carboxyl tail at the same three sites. Molecular Endocrinology 11 1094–1102.[Abstract/Free Full Text]

Received 22 December 2004
Accepted 27 January 2005
Made available online as an Accepted Preprint 7 February 2005




This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Y. Yang, M. Chen, R. A. Kesterson Jr., and C. M. Harmon
Structural insights into the role of the ACTH receptor cysteine residues on receptor function
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1120 - R1126.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
P. Vazquez, I. Roncero, E. Blazquez, and E. Alvarez
The cytoplasmic domain close to the transmembrane region of the glucagon-like peptide-1 receptor contains sequence elements that regulate agonist-dependent internalisation
J. Endocrinol., July 1, 2005; 186(1): 221 - 231.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vázquez, P.
Right arrow Articles by Alvarez, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vázquez, P.
Right arrow Articles by Alvarez, E.


HOME HELP CONTACT US SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS