|
|
||||||||
Departamento de Bioquímica y Biología Molecular, Facultad de Medicina, Universidad Complutense de Madrid, Ciudad Universitaria, 28040 Madrid, Spain
(Requests for offprints should be addressed to Elvira Alvarez; Email: eao513{at}med.ucm.es)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
GLP-1(736)amide also has a potent effect on glucose-dependent insulin secretion (Kreymann et al. 1987, Weir et al. 1989), and it also increases arterial blood pressure, heart rate (Barragán et al. 1994, 1996), and lung surfactant synthesis (Benito et al. 1998, Vara et al. 2001).
The effects of GLP-1(736)amide are mediated through a specific G-protein-coupled receptor (Thorens 1992, Dillon et al. 1993, Wheeler et al. 1993, Wei & Mojsov 1995, Alvarez et al. 1996) and its signalling on target cells is dependent on activation of the adenylate cyclase pathway (Thorens 1992, Wheeler et al. 1993). In this context, the third intracellular cytoplasmic loop is involved in coupling to G proteins and activation of the adenylyl cyclase system (Takhar et al. 1996). Desensitisation of the GLP-1 receptor has been correlated with C-terminal tail phosphorylation. Homologous desensitisation produced by GLP-1(736)amide induces the phosphorylation of three serine doublets located at positions 441/442, 444/445 and 451/452 and decreases maximum cAMP production by 20% (Widmann et al. 1997). Heterologous desensitisation of the GLP-1 receptor by protein kinase C (PKC) is correlated with the phosphorylation of four serine doublets located at positions 431/432, 441/442, 444/445 and 451/452. Activation of PKC by phorbol esters also decreases maximum cAMP production by 30% (Widmann et al. 1996a,b), and the levels of phosphorylation induced by GLP-1 and phorbol esters are additive (Widmann et al. 1996b). Phosphorylation of the three serine doublets, Ser441/442, Ser444/445 and Ser451/452, at the cytoplasmic tail after agonist binding is related to receptor endocytosis (Widmann et al. 1997). Agonist-promoted phosphorylation of the G-protein-coupled receptors increases the affinity of ß-arrestins and these act as a clathrin adaptor protein in the internalisation process (Goodman et al. 1996).
Most G-protein-coupled receptors have one or two cysteine residues in the carboxyl-terminal cytoplasmic tail, and palmitoylation of these cysteines has been reported for several members of this family of receptors (Bouvier et al. 1995a,b, Morello & Bouvier 1996). The palmitate tail anchors the cytoplasmic tail of the receptor into the plasma membrane to create a fourth intracellular loop, allowing a reversible and dynamic regulation (Bouvier et al. 1995a).
The aim of this study was to investigate whether cysteine 438 is a site of acylation and the function of Cys438 in signal transduction through GLP-1 receptors.
| Materials and Methods |
|---|
|
|
|---|
A HindIII-XbaI fragment of the rat GLP-1 receptor cDNA (Thorens 1992) was subcloned into PUC 18. Site-directed mutagenesis of cysteine 438 was accomplished using the Transformer Site-directed Mutagenesis kit from Clontech (Palo Alto, CA, USA). Mutagenic primers were prepared: 5' CCCCTTAAGGCTCCCAC CAGC 3'to change Cys438 to Ala and to create a BfrI restriction site, and 5'CCCCTTAAGTGTCCCACC AGC 3'to create only a BfrI restriction site at nucleotide 1322. A selection primer, 5' GTGTATCTTATGCC AAGTACG 3', to eliminate a unique NdeI restriction site in the vector was also used. Clones BfrI/Ala438 and BfrI were selected and mutations were confirmed by sequencing using an automated LKB ALF DNA sequencer (Amersham Pharmacia Biotech, Barcelona, Spain). HindIII-XbaI mutant cDNA was then cloned into the expression vector to create pcDNA3-GLPR A438 and pcDNA3 GLPR BfrI.
For substitution of amino acids Ser431/432 by alanine, PCR site-directed mutagenesis was used, following standard procedures. The following primers were used: two flanking primers -GLPR-1 oligonucleotide, corresponding to nucleotides 969993, and GLPR-2 oligonucleotide, corresponding to nucleotides 13841411 (Thorens 1992); the specific mutation primers GLPR-3: 5'CAGAGGGA CGCCGCCATGAAACCCTC3' and GLPR-4: 5'GG TTTCATGGCGGCGTCCCTCTGGATG were employed to mutate Ser431/432 into alanine residues. Mutation identity was verified by sequence analysis. The fragments containing the mutated gene were subcloned into the SacI/BfrI restriction sites of pcDNA3-GLPR BfrI and pcDNA3-GLPR A438 to create pcDNA3-GLPR A431/432 and pcDNA3-GLPR A431/432/438.
N-terminal epitope-tagged GLP-1 receptors were constructed by inserting a FLAG epitope (DYKDDDDK) after the initial methionine using a PCR strategy. A HindIII-AlwNI fragment was replaced in wild-type and mutant A438 and designated pcDNA 3 tag-GLPR and pcDNA 3 tag-GLPR A438. Also, 6x His-tagged GLP-1 receptors were constructed. BamHI-XbaI wild-type and mutant cDNAs were subcloned into pcDNA 3.1/His and designated pcDNA3-His GLPR and pcDNA3-His GLPR A438. Wild-type and mutant GLP-1 receptors were expressed in CHO cells by transfection using the calcium phosphate method. Transfected cells were selected by incubation with neomycin (geneticin, GIBCO). Stable colonies were isolated using cloning rings.
Binding of 125I-GLP-1(736)amide to cell surface receptors
GLP-1(736)amide was radio-labelled with 125I by the chloramine T method and mono 125I-GLP-1(736)amide was isolated by reverse-phase HPLC. Specific activity was between 35004000 d.p.m./fmol. CHO cells grown in 24-well plates (2x105/well) were washed with serum-free medium and incubated for 30 min at 37 °C in KRH (118 mM NaCl, 5 mM KCl, 1.2 mM MgSO4, 2.5 mM CaCl2, 25 mM HEPES, pH 7.4) with 0.5% bovine serum albumin (BSA). Then, cells were chilled on ice, and 125I-GLP-1(736)amide (0.1 nM) and unlabelled GLP-1(736)amide (0.0500 nM) were added for at least 16 h at 4 °C. Following this, cells were washed three times with cold medium and solubilised with 1 M NaOH. Non-specific binding of 125I-GLP-1(736)amide was estimated in the presence of 500 nM unlabelled ligand and this value was subtracted from the total binding values.
cAMP production assays
cAMP levels were measured using the cAMP Biotrack enzyme immunoassay system (Amersham Biosciences, UK) following the manufacturers instructions. Briefly, untransfected CHO cells and cells expressing wild-type and mutant GLP-1 receptors were grown in 12-well plates in F-12 medium supplemented with 5% FBS. CHO cells were washed and incubated in F-12 medium containing 0.1% FBS overnight. Cells were then washed with HBS medium (130 mM NaCl, 0.9 mM NaH2PO4, 0.8 mM MgSO4, 5.4 mM KCl, 1.8 mM CaCl2, 20 mM HEPES, pH 7.4, plus 25 mM glucose) and incubated in HBS containing 1 mM IBMX and 0.1% BSA in the presence or absence of different concentrations of GLP-1(736)amide (0.001100 nM) for 8 min. Then, cells were washed with HBS, after which lysis buffer was added and immediately processed in the immunoassay. In parallel experiments, binding of 125I-GLP-1(736)amide to cell surface receptors was determined at 4 °C. The agonist stimulated cAMP production was normalised by 125I-GLP-1(736)amide bound to cell surface receptors.
Internalisation of the GLP-1 receptor
The internalisation rate was measured as previously described (Alvarez et al. 1990). Briefly, CHO cells were incubated in KRH (118 mM NaCl, 5 mM KCl, 1.2 mM MgSO4, 2.5 mM CaCl2, 25 mM HEPES, pH 7.4) with 0.5% BSA at 37 °C for 30 min. Then, cells were incubated with 0.1 nM 125I-GLP-1(736)amide, and 125I-GLP-1(736)amide binding was determined at different times. Intracellular 125I-GLP-1(736)amide was measured as cell-associated radioactivity resistant to acid wash by incubation of the cells for 3 min at 4 °C with 50 mM NaCl, 150 mM glycine, pH 3.0. Cell surface-bound 125I-GLP-1(736)amide was calculated by subtraction of the intra-cellularly bound 125I-GLP-1(736)amide from the total binding.
Effect of metabolic inhibitors and hypertonic medium on the internalisation process
For metabolic depletion, CHO cells were washed twice with glucose-free HBS (140 mM NaCl, 20 mM HEPES, 1 mM CaCl2, 1 mM MgCl2, 10 mM KCl with 0.5% BSA) and incubated in the same buffer containing 20 mM 2-deoxyglucose and 10 mM sodium azide. Hypertonic treatment was performed as previously described (Heuser & Anderson 1989). Briefly, cells were washed twice with HBS containing 0.45 M sucrose and incubated in the same medium for 30 min at 37 °C. Then, 0.1 nM 125I-GLP-1(736)amide was added and after 6 min incubation cell-associated radioactivity and acid wash-resistant radioactivity were measured as previously described.
Redistribution of cell surface GLP-1 receptors
CHO cells were seeded in 24-well plates and incubated with 10 nM GLP-1(736)amide for different times (3, 6, 10, 15, 30 and 60 min). Then, the cells were washed at 0 °C and subsequently incubated for 3 min at 0 °C with 50 mM NaCl, 150 mM glycine, pH 3.0, to remove ligand bound to the cell surface, and washed with KRH containing 0.5% BSA. Cell surface receptors were then measured as described above.
Immunoprecipitation of tag-GLPR receptors
CHO cells expressing tag-GLPR wild-type or mutant receptors were seeded in 60 cm2 dishes for metabolic labelling. The cells were transferred into culture media: (1) methionine-free modified Eagles medium containing 150 µCi/ml 35S-methionine (Amersham Pharmacia Bio-tech) and (2) F-12 medium containing 1% fetal bovine serum (FBS) (GIBCO, Life Technologies, Paisley, UK) and 200 µCi/ml 3H-palmitate (Dupont-NEN, Boston, MA, USA). The cells were then washed and solubilised in PBS containing 1% Triton X-100, 1% deoxycholate, 0.1% SDS, 0.5 M NaCl, 5 mM EDTA, 1 mM PMSF, 50 mM NaF, 5 mM Na4P2O7 and 1 mM Na3VO4. The lysates were centrifuged at 10 000 g for 30 min and the supernatants were incubated with agarose-Streptavidin at room temperature for 30 min. After centrifugation, the supernatants were incubated for 60 min at room temperature with monoclonal anti-FLAG epitope M2-biotin conjugate antibody (SIGMA, Madrid, Spain) prebound to 50 µl agarose-Streptavidin or monoclonal anti-FLAG epitope M2-agarose (SIGMA). The immunoprecipitates were washed and resolved by SDS-PAGE and fluorography.
For purification of His-tagged GLP-1 receptors, crude membrane fractions of CHO cells expressing GLP-1 receptors were loaded into His micro spin columns (Amersham Biosciences Europe, Barcelona, Spain) previously incubated in the presence or absence of an excess of polyHis (30 µg/ml). Then, the columns were washed twice with phosphate/NaCl solution containing 20 mM imidazole and twice with phosphate/NaCl 60 mM imidazole and finally eluted with phosphate/NaCl solution containing 400 mM imidazole. Western blot analyses with anti-His antibody (Amersham Biosciences Europe) were performed following the manufacturers instructions.
CHO cells expressing His-wild-type or mutant GLP-1 receptors were also labelled with 35S-methionine or 3H-palmitate as described above. His-tagged GLP-1 receptors were purified using His micro spin columns and samples were resolved by SDS-PAGE and fluorography.
Data analysis
Data from competition experiments were analysed by non-linear regression with the GraphPad Prism computer program (GraphPad Software Inc., San Diego, CA, USA). Dissociation constants (Kd) and concentrations of receptor sites (Bmax) were calculated from IC50 values using the method of Cheng and Prusoff (1973). Data are expressed as means±S.E.M. Statistical comparisons were performed using the Students t-test and Newman-Keuls test with at least three separate experiments performed in duplicate (*P<0.05 and **P<0.001).
| Results |
|---|
|
|
|---|
To analyse the role of Cys438 located in the C-terminal domain of the GLP-1 receptor (Fig. 1
), we constructed a series of mutant receptors in which Cys438 or Ser431,432 were substituted by alanine (Fig. 1
). CHO cells expressing wild-type or mutant receptors (GLPR A438, GLPR A431/432 and GLPR A431/432/438) were used to determine the binding properties of 125I-GLP-1(736)amide to all receptors. The competition binding curves are shown in Fig. 2
. The Kd and Bmax calculated from the IC50 values are shown in Table 1
. The competition binding data of wild-type and mutant receptors fit a single-site model best.
|
|
|
The binding of GLP-1(736)amide to its receptor produces activation of the adenylate cyclase pathway. Accordingly, we tested the effect of this peptide on the production of cAMP by cells transfected with the wild-type and mutant GLP-1 receptors. As shown in Fig. 3
, GLP-1(736)amide stimulated CHO cells expressing wild-type receptors in a dose-dependent manner; the EC50 of GLP-1(736) amide was 0.09±0.03 nM, maximum stimulation (Rmax) being observed at 10 nM of the agonist (Table 1
). CHO cells expressing mutant GLPR A438 receptors showed a similar EC50 0.05±0.016 nM value calculated from the doseresponse curve (Fig. 3
). However, the mutant receptor revealed a 6070% decreased efficacy as compared with wild-type receptors (Table 1
). Similar results were obtained using a pool of clones expressing the wild-type and mutant GLP-1 receptors.
|
To investigate post-translational modifications of the GLP-1 receptor by acylation, CHO cells expressing tag-wild-type GLP-1 receptors were labelled with 35S-methionine and 3H-palmitic acid. The immunoprecipitates were analysed by non-reducing polyacrylamide gel electrophoresis and fluorography. The epitope-tagged GLP-1 receptors were not immunoprecipitated by anti-FLAG M2 monoclonal antibody or anti-FLAG M2 affinity gel, and hence we could not detect tag-GLP-1 receptors in cells labelled with 35S-methionine. We therefore decided to use 6x His-tagged GLP-1 receptors. His-GLP-1 receptors were isolated using His micro spin columns. Western blot analysis using an anti-His antibody (Fig. 4
) revealed the presence of a 65 kDa band in CHO cells expressing His-tagged wild-type and mutant Ala438 GLP-1 receptors. This band disappeared when the columns were previously saturated with polyHis. CHO cells expressing His-tagged wild-type and mutant GLP-1 receptors were metabolically labelled with 35S-methionine and 3H-palmitate. His-GLP-1 receptors were purified with His micro spin columns and subjected to SDS-PAGE and fluorography. As shown in Fig. 4
, when the cells were labelled with 35S-methionine a 65 kDa band was detected in cells transfected with wild-type and mutant GLPR A438 receptors. However, when the cells were labelled with 3H-palmitate, the incorporation of 3H-palmitate was only observed in cells expressing wild-type receptors. No 3H-palmitate-labelled band was detected in samples purified from CHO-K1 and mutant GLPR A438 receptor-expressing cell lines, although the expression levels of the wild-type and mutant GLPR A438 receptors were similar in this experiment, as indicated by the 35S-labelled purification. These data are consistent with the hypothesis that Cys438 is a site of GLP-1 receptor palmitoylation.
|
Effect of substitution of Ser431/432 by alanine on adenylate cyclase activation
Substitution of Ser431/432 by alanine in the wild-type receptor did not modify the potency and efficacy of such receptors in stimulating cAMP production (Fig. 3
, Table 1
). By contrast, in cells expressing GLPR A431/432/438 the EC50 value of GLP-1(736)amide was similar to that of the wild-type, but the efficacy was three- to fourfold increased relative to the wild-type (Table 1
).
Effect of the Cys438 mutation and the substitution of Ser431/432 by alanine on the rate of GLP-1 receptor endocytosis
Figure 5A
shows that the substitution of Cys438 or Ser431/432 by alanine in the GLP-1 receptor did not modify the rate of its internalisation. The first-order endocytic rates measured for wild-type, GLPR A438, GLPR A431/432 and GLPR A431/432/438 were 0.198 ± 0.005 min1, 0.217 ± 0.006 min1, 0.18 ± 0.014 min1 and 0.22 ± 0.015 min1 respectively. The rate of endocytosis of GLP-1 receptors was also similar in a pool of clones expressing the wild-type and mutant GLP-1 receptors. The effects of metabolic inhibitors or hypertonic medium on the rate of endocytosis were also measured (Fig. 5B
). The rate of endocytosis was inhibited by 7390% under both conditions after metabolic depletion and hypertonic treatment in cells expressing wild-type or mutant receptors.
|
It has been reported that GLP-1 receptor recycling to the cell surface following agonist-induced endocytosis takes about 15 min and that a rapid rate of endocytosis produces a progressive decrease in the surface expression of GLP-1 receptors upon continuous exposure to the agonist.
The effect of pre-exposure to 10 nM GLP-1(736)amide on cell surface receptors was determined as a function of time, as shown in Fig. 5C
. A rapid decrease in cell surface receptor numbers was observed in cells expressing wild-type and mutant GLP-1 receptors. In both cases, the number of cell surface receptors decreased during the first 15 min of agonist exposure, receptor numbers falling to 4550% of the initial values. After longer times of exposure, the number of cell surface receptors decreased slowly to 3627% in cells expressing wild-type and mutant receptors respectively.
| Discussion |
|---|
|
|
|---|
The data obtained by us show that the GLP-1 receptor is palmitoylated and that substitution of Cys438 by alanine prevented 3H-palmitate incorporation to GLP-1 receptors. We do not have any information about the stoichiometry of GLP-1 receptor palmitoylation.
As compared with the wild-type receptor, the efficacy of mutant A438 receptors in stimulating adenylate cyclase activity after GLP-1(736)amide treatment decreased approximately threefold. A decrease in cAMP production in cells expressing mutant GLPR A438 receptors is consistent with the data reported for non-palmitoylated ß2 adrenergic receptors (ODowd et al. 1989) and the D1 dopamine receptor (Jensen et al. 1995). In our data, the differences in cAMP production are not correlated with a change in the agonist-affinity state of GLP-1 receptors after the substitution of Cys438 by alanine.
Replacement of Cys438 or substitution of Ser431/432 did not affect the processing of mutant receptors. Under these experimental conditions, wild-type and mutant receptors showed a similar agonist binding affinity. In contrast, the expression level of mutant A438 and A431/432 at the cell surface was higher than for wild-type GLP-1 receptors, and CHO cells transfected with mutant A431/432/438 expressed low levels of receptors as compared with wild-type receptors. Thus, these findings cannot be related to the effect of palmitoylation or depalmitoylation.
It has been reported that the region involved in the coupling of GLP-1 receptors to G proteins is located in the third intracellular cytoplasmic loop (Takhar et al. 1996) and that C-terminal tail phosphorylation is involved in the desensitisation process. Nevertheless, a receptor lacking 33 amino acids of the C-terminal tail stimulates cAMP production at the same rate as wild-type receptors (Widmann et al. 1996a,b). We also tested a truncated receptor lacking 27 amino acids of the C-terminal tail and this truncated form stimulated cAMP production at a similar rate to wild-type receptors, indicating that this region of the cytoplasmic tail is not necessary for the GLP-1 receptor/G protein interaction (our unpublished data).
Palmitoylation of cysteines in the carboxyl terminal tail of G-protein-coupled receptors anchors this receptor domain into the plasma membrane, forming a fourth intracellular loop. Substitution of Cys438 in GLP-1 receptors abolishes 3H-palmitate incorporation, which should produce a different conformational state of the carboxyl terminal tail and may affect the access of kinases to the cytoplasmic tail.
The cytoplasmic tail of GLPR also contains several phosphorylation sites reported to be necessary for the internalisation and desensitisation of GLP-1 receptors. Previous work using GLP-1 receptors revealed that PKC activation by phorbol esters produced phosphorylation of the four serine doublets in the intracytoplasmic tail: Ser431/432, Ser441/442, Ser444/445 and Ser451/452 (Widmann et al. 1996a). Agonist binding to the GLP-1 receptor also induces phosphorylation of three doublets: Ser441/442, Ser444/445 and Ser451/452 (Widmann et al. 1997), and the receptor phosphorylation induced by homologous and heterologous desensitisation is additive (Widmann et al. 1996b). The substitution of Cys438 might regulate the access of protein kinases to such phosphorylation sites. Thus, the phosphorylation of a protein kinase A (PKA) site in the ß2-adrenergic receptor located downstream from the palmitoylated cysteine is also dependent on the state of palmitoylation of the receptor (Moffett et al. 1993, 1996). It has also been reported that mutations of the two Cys residues in the A3-adenosine receptor increase phosphorylation of the receptor independently of the presence of agonist (Palmer & Stiles 2000). Palmitoylation of the vasopressin V1a receptor also regulates phosphorylation, but in this case the reduction of [3H]palmitate incorporation decreased the basal level of phosphorylation of mutant receptors (Hawtin et al. 2001).
Since our data indicated that the rate of endocytosis was similar in wild-type and mutant receptors, and since it has been reported that phosphorylation of the three doublets Ser441/442, Ser444/445 and Ser451/452 is involved in this process, we next investigated the effect of the substitution of serines 431/432 by alanines in the wild-type and GLPR A438 receptors. The substitution of Ser431/432 by alanine did not modify the potency or efficacy of these receptors in stimulating adenylate cyclase. In contrast, substitution of these residues in GLPR A438 receptors increased the efficacy in stimulating adenylate cyclase at concentrations higher than 1 nM GLP-1(736)amide.
The results obtained after the substitution of Ser431/432 by alanine when Cys438 is also absent suggest that the rate of phosphorylation of the other serine doublets in the cytoplasmic tail might also be affected. To confirm this hypothesis it would be necessary to analyse the effect of substitution of the other sites of phosphorylation involved in the desensitisation and internalisation of GLP-1 receptors. However, a synergistic action of kinases on other members of G-protein-coupled receptors, such as ß2-adrenergic receptors (Moffett et al. 2001) and A3- adenosine receptors (Palmer & Stiles 2000), has been reported previously.
The effect of the substitution of Cys438 by alanine on the endocytosis and recycling processes was also tested. The GLPR A438 receptors did not show significant differences in the internalisation rate as compared with the wild-type GLP-1 receptor and, likewise, the number of cell surface receptors after agonist exposure decreased in the same way as in cells expressing the wild-type receptors. Substitution of Ser431/432 by alanine in wild-type and GLPR A438 did not modify either the rate of endocytosis or the number of cell surface receptors after exposure to 10 nM agonist. The effect of acid washing was similar in all clones used. Our results suggest that the substitution of Ser431/432 or Cys438 by Ala in the GLP-1 receptor does not modify the capacity of these receptors to interact with the components of the vesicular transport system.
We also studied the endocytosis pathway used by these receptors, testing the effect of hypertonic medium; we found that all wild-type and mutant GLPR A438, GLPR A431/432 and GLPR A431/432/438 receptors were mainly internalised through coated pits.
In conclusion, the substitution of Cys438 in the cytoplasmic tail of GLP-1 receptors decreases the efficacy of adenylate cyclase stimulation promoted by agonist binding through these receptors. In addition, this residue is a site of acylation of GLP-1 receptors and might regulate the state of phosphorylation of the GLP-1 receptor, which modulates the desensitisation process. Nevertheless, further studies are required to confirm the latter hypothesis.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Alvarez E, Roncero I, Chowen JA, Thorens B & Blázquez E 1996 Expression of the glucagon-like peptide-1 receptor gene in rat brain. Journal of Neurochemistry 66 920927.[ISI][Medline]
Barragán JM, Rodriguez R & Blázquez E 1994 Changes in arterial blood pressure and heart rate induced by glucagon-like peptide-1(736)amide in rats. American Journal of PhysiologyEndocrinology and Metabolism 266 E459E466.
Barragán JM, Rodríguez RE, Eng J & Blázquez E 1996 Interactions of exendin(939) with the effects of glucagon-like peptide-1(736)amide and of exendin-4 on arterial blood pressure and heart rate in rats. Regulatory Peptides 67 6368.[CrossRef][ISI][Medline]
Benito E, Blázquez E & Bosch M 1998 Glucagon-like peptide-1(736)amide increases pulmonary surfactant secretion through a cyclic adenosine 3',5'-monophosphate-dependent protein kinase mechanism in rat type II pneumocytes. Endocrinology 139 23632368.
Bouvier M, Loisel TP & Hebert T 1995a Dynamic regulation of G-protein-coupled receptor palmitoylation: potential role in receptor function. Biochemical Society Transactions 23 577581.[ISI][Medline]
Bouvier M, Moffett S, Loisel TP, Mouillac B, Hebert T & Chidiac P 1995b Palmitoylation of G-protein-coupled receptor: a dynamic modification with functional consequences. Biochemical Society Transactions 23 116120.[ISI][Medline]
Calvo JC, Gisolfi CV, Blázquez E & Mora F 1995 Glucagon-like peptide-1(736)amide induces the release of aspartic acid and glutamine by the ventromedial hypothalamus of the conscious rat. Brain Research Bulletin 38 435439.[CrossRef][ISI][Medline]
Cheng Y & Prusoff WH 1973 Relationship between the inhibition constant (KI) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochemical Pharmacology 22 30993108.[CrossRef][ISI][Medline]
Chowen JA, Rodriguez de Fonseca F, Alvarez E, Navarro M, García-Segura LM & Blázquez E 1999 Increased glucagon-like peptide-1 receptor expression in glia after mechanical lesion of the rat brain. Neuropeptides 33 212215.[CrossRef][ISI][Medline]
Dillon JS, Tanizawa Y, Wheeler MB, Leng X-H, Ligon BB, Rabin DU, Yoo-Warren H, Permutt MA & Boyd AE III 1993 Cloning and functional expression of the human glucagon-like peptide-1 (GLP-1) receptor. Endocrinology 133 19071910.[Abstract]
Goodman OB, Krupnick JG, Santini F, Gurevich W, Penn RB, Gagnon AW, Keen JH & Benovic JL 1996 ß-Arrestin acts as a clathrin adaptor in endocytosis of the ß 2-adrenergic receptor. Nature 383 447450.[CrossRef][Medline]
Gutzwiller JP, Goke B, Drewe J, Hildebrand P, Ketterer S, Handschin D, Winterhalder R, Conen D & Beglinger C 1999 Glucagon-like peptide-1: a potent regulator of food intake in humans. Gut 44 8186.
Hawtin SR, Tobin AB, Patel S & Wheatley M 2001 Palmitoylation of vasopressin V1a receptor reveals different conformational requirements for signaling, agonist-induced receptor phosphorylation and sequestration. Journal of Biological Chemistry 276 3813938146.
Heuser JE & Anderson RG 1989 Hypertonic media inhibit receptor-mediated endocytosis by blocking clathrin-coated pit formation. Journal of Cell Biology 108 389400.
Jensen AA, Pedersen UB, Kiemer A, Din N & Andersen PH 1995 Functional importance of the carboxyl tail cysteine residues in the human D1 dopamine receptor. Journal of Neurochemistry 65 13251331.[ISI][Medline]
Jin SLC, Han VKM, Simmons JG, Towle AC, Lauder JM & Lund PK 1988 Distribution of glucagon-like peptide-1 (GLP-1), glucagon, and glycentin in the rat brain: an immunocytochemical study. Journal of Comparative Neurology 271 519532.[CrossRef][ISI][Medline]
Kreymann B, Williams G, Ghatei MA & Bloom SR 1987 Glucagon-like peptide-1(736): a physiological incretin in man. Lancet 2 13001304.[ISI][Medline]
Kreymann B, Ghatei MA, Burnet P, Williams G, Kanse S, Diani AR & Bloom SR 1989 Characterization of glucagon-like peptide-1(736)amide in the hypothalamus. Brain Research 502 325331.[CrossRef][ISI][Medline]
Moffett S, Mouillac B, Bonin H & Bouvier M 1993 Altered phosphorylation and desensitization patterns of a human ß2-adrenergic receptor lacking the palmitoylated Cys 341. EMBO Journal 12 349356.[ISI][Medline]
Moffett S, Adam L, Bonin H, Loisel TP, Bouvier M & Mouillac B 1996 Palmitoylated cysteine 341 modulates phosphorylation of the ß2-adrenergic receptor by the cAMP-dependent protein kinase. Journal of Biological Chemistry 271 2149021497.
Moffett S, Rousseau G, Lagacé M & Bouvier M 2001 The palmitoylation state of the ß2-adrenergic receptor regulates the synergistic action of cyclic AMP-dependent protein kinase and ß-adrenergic receptor kinase involved in its phosphorylation and desensitization. Journal of Neurochemistry 76 269279.[CrossRef][ISI][Medline]
Mora F, Expósito I, Sanz B & Blázquez E 1992 Selective release of glutamine and glutamic acid produced by perfusion of GLP-1(736)amide in the basal ganglia of the conscious rat. Brain Research Bulletin 29 359361.[CrossRef][ISI][Medline]
Morello JP & Bouvier M 1996 Palmitoylation: a posttranslational modification that regulates signalling from G-protein-coupled receptor. Biochemistry and Cell Biology 74 449457.[ISI][Medline]
Navarro M, Rodriguez de Fonseca F, Alvarez E, Chowen JA, Zueco JA, Gómez R, Eng J & Blázquez E 1996 Colocalization of glucagon-like peptide-1 (GLP-1) receptors, glucose transporter GLUT-2, and glucokinase mRNAs in rat hypothalamic cells: evidence for a role of GLP-1 receptor agonists as an inhibitory signal for food and water intake. Journal of Neurochemistry 67 19821991.[ISI][Medline]
ODowd BF, Hnatowich M, Caron MG, Lefkowitz RJ & Bouvier M 1989 Palmitoylation of the human ß2-adrenergic receptor. Mutation of Cys341 in the carboxyl tail leads to an uncoupled nonpalmitoylated form of the receptor. Journal of Biological Chemistry 264 75647569.
Orskov C, Poulsen SS, Moller M & Holst JJ 1996 Glucagon-like peptide 1 receptors in the subfornical organ and the area postrema are accessible to circulating glucagon-like peptide 1. Diabetes 45 832835.[Abstract]
Palmer TM & Stiles GL 2000 Identification of threonine residues controlling the agonist-dependent phosphorylation and desensitization of the rat A3 adenosine receptor. Molecular Pharmacology 57 539545.
Perry T, Lahiri DK, Chen D, Zhou J, Shaw KTY, Egan JM & Greig N 2002 A novel neurotrophic property of glucagon-like peptide 1: a promoter of nerve growth factor-mediated differentiation in PC12 cells. Journal of Phamacology and Experimental Therapeutics 300 958966.
Rodriguez de Fonseca F, Navarro M, Alvarez E, Roncero I, Chowen JA, Maestre O, Gómez R, Muñoz RM, Eng J & Blázquez E 2000 Peripheral versus central effects of glucagon-like peptide-1 on satiety and body weight loss in Zucker obese rats. Metabolism 49 110.
Takhar S, Gyomorey S, Su R-C, Mathi SK, Li X & Wheeler MB 1996 The third cytoplasmic domain of the GLP-1(736)amide receptor is required for coupling to the adenylyl cyclase system. Endocrinology 137 21752178.[Abstract]
Tang-Christensen M, Larsen PJ, Goke R, Fink-Jensen A, Jessop D, Moller M & Sheikh SP 1996 Central administration of GLP-1(736)amide inhibits food and water intake in rats. American Journal of PhysiologyRegulatory, Integrative and Comparative Physiology 271 R848R856.
Thorens B 1992 Expression cloning of the pancreatic ß cell receptor for the glucoincretin hormone glucagon-like peptide 1. PNAS 89 86418645.
Turton MD, OShea D, Gunn I, Beak SA, Edwards CMB, Meeran K, Choi SJ, Taylor GM, Heath MM, Lambert PD, Wilding JPH, Smith DM, Ghatei MA, Herbert J & Bloom SR 1996 A role for glucagon-like peptide-1 in the central regulation of feeding. Nature 379 6972.[CrossRef][Medline]
Vara E, Arias-Díaz J, García C, Balibrea JL & Blázquez E 2001 Glucagon-like peptide-1(736)amide stimulates surfactant secretion in human type II pneumocytes. American Journal of Respiratory and Critical Care Medicine 163 840846.
Wei Y & Mojsov S 1995 Tissue-specific expression of the human receptor for glucagon-like peptide-1: brain, heart and pancreatic forms have the same deduced amino acid sequences. FEBS Letters 358 219224.[CrossRef][ISI][Medline]
Weir GC, Mojsov S, Hendrich GK & Habener JF 1989 Glucagon-like peptide1(737) actions on endocrine pancreas. Diabetes 38 338342.[Abstract]
Wheeler MB, Lu M, Dillon JS, Leng X-H, Chen C & Boyd AE III 1993 Functional expression of the rat glucagon-like peptide-1 receptor, evidence for coupling to both adenylyl cyclase and phospholipase C. Endocrinology 133 5762.[Abstract]
Widmann CH, Dolci W & Thorens B 1996a Heterologous desensitization of the glucagon-like peptide-1 receptor by phorbol esters requires phosphorylation of the cytoplasmic tail at four different sites. Journal of Biological Chemistry 271 1995719963.
Widmann CH, Dolci W & Thorens B 1996b Desensitization and phosphorylation of the glucagon-like peptide-1 GLP-1 receptor by GLP-1 and 4-phorbol 12-myristate-13-acetate. Molecular Endocrinology 10 6275.[Abstract]
Widmann CH, Dolci W & Thorens B 1997 Internalization and homologous desensitization of the GLP-1 receptor dependent on phosphorylation of the receptor carboxyl tail at the same three sites. Molecular Endocrinology 11 10941102.
Received 22 December 2004
Accepted 27 January 2005
Made available online as an Accepted Preprint 7 February 2005
This article has been cited by other articles:
![]() |
Y. Yang, M. Chen, R. A. Kesterson Jr., and C. M. Harmon Structural insights into the role of the ACTH receptor cysteine residues on receptor function Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1120 - R1126. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Vazquez, I. Roncero, E. Blazquez, and E. Alvarez The cytoplasmic domain close to the transmembrane region of the glucagon-like peptide-1 receptor contains sequence elements that regulate agonist-dependent internalisation J. Endocrinol., July 1, 2005; 186(1): 221 - 231. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |