| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Division of Medical Sciences, University of Birmingham, Queen Elizabeth Hospital, Birmingham B15 2TH, United Kingdom
(Requests for offprints should be addressed to P M Stewart; Email: p.m.stewart{at}bham.ac.uk)
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Recent research focused on sex steroid conversion in human adipose tissue, specifically investigating the expression and activity of 17ß-hydroxysteroid dehydrogenases (17ß-HSDs), which represent a major switch regulating sex steroid activation and inactivation at the pre-receptor level (Adamski & Jakob 2001, Luu-The 2001). By employing RNA protection assays and Southern blot, Corbould et al.(1998) detected low mRNA expression levels of 17ß-HSD isozymes 2 and 3, but not of 17ß-HSD1, in human adipose tissue. In another study, Corbould et al.(2002) found that preadipocytes readily converted androstenedione to testosterone and that the ratio of 17ß-HSD3 to aromatase expression in omental adipose tissue was positively correlated with BMI. However, in recent years 17ß-HSD5 (AKR1C3) has been described as a major player in androgen interconversion (Dufort et al. 1999, Penning et al. 2000, Luu-The et al. 2001). Recently, Blouin et al.(2003) described mRNA expression of 17ß-HSD5 (AKR1C3) and 3
-HSD type 3 (AKR1C2) in human female adipose tissue. They reported an increased inactivation of 5-dihydrotestosterone by AKR1C2 in omental fat tissue from women with visceral obesity and suggested that local androgen inactivation is a predominant reaction in female abdominal tissue.
Here, we studied androgen generation in human female adipose tissue, particularly focusing on the site-specific expression of 17ß-HSD5 (AKR1C3) in omental and subcutaneous fat, and investigated the impact of changes in BMI. In addition, we explored 17ß-HSD5 expression and androgen conversion across adipocyte differentiation.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Paired subcutaneous and omental biopsies Paired subcutaneous (sc) and omental (om) adipose tissue biopsies were obtained from 27 female patients undergoing elective abdominal hysterectomy for myoma or fibroma (median age 43 years, range 30–50 years; median BMI 27.8 kg/m2, range 19.7–39.2 kg/m2). All were premenopausal, non-diabetic, and none of them had been treated with glucocorticoids within the preceding twelve months or had been on any hormonal treatment, e.g. contraceptives. In 24 of the 27 subjects suffcient material for both activity and expression studies was obtained, while biopsy material in the remaining three subjects was only suffcient for expression analysis.
Subcutaneous biopsies (weight loss study) Six healthy women (median age 45 years, range 23–57 years; median BMI 35.2 kg/m2, range 30.4–38.3 kg/m2) with no significant past medical history were recruited for a weight loss study as previously reported (Tomlinson et al. 2004). A sc buttock biopsy was performed under local anaesthetic to obtain 1–2 g adipose tissue. After a median duration of 10 weeks of a weight loss program with a very low calorie diet (425 kcal/day) and a weight loss of more than 10% of the initial body weight, the patients returned to a normal diet for at least 1 week before they received a second sc buttock biopsy (Tomlinson et al. 2004).
All studies had the approval of the local research ethics committee and written informed consent was obtained in every case.
Tissue and primary cell culture
Samples of whole sc and om fat tissue were used for RNA extraction and for the isolation of preadipocytes as previously reported (Bujalska et al. 1997). Briefly, adipose tissue biopsies were washed in PBS, then chopped and digested with collagenase class 1 (2 mg/ml; Worthington Biochemical Corp., Reading, Berks, UK) in 1x Hank’s balanced salt solution (Life Technologies Inc., Paisley, Strathclyde, UK) for 60 min at 37 °C in a shaking water bath. Samples were centrifuged at 90 x g for 1 min, the top adipocyte layer was removed and then centrifuged again at 90 x g for 5 min. The pellet containing preadipocytes was removed, and cells were washed with DMEM/Nutrient Mixture F-12 (Life Technologies Inc.) containing 15% fetal calf serum (Life Technologies Inc.), penicillin (50 000 U/l) and streptomycin (50 000 µg/l), and seeded in 24-well plates. Cells were left overnight and washed the following day with 1x Hank’s balanced salt solution (Fig. 1A
). Subsequently, preadipocyte cultures were either cultured towards confluence to study proliferated preadipocytes or subjected to differentiation stimuli to study the effects of maturation of stromal preadipocytes to adipocytes.
|
). Preadipocytes were then used for enzyme assays and RNA extraction.
For preadipocyte differentiation assays, human subcutaneous and omental preadipocytes were cultured for 14 days in media known to promote adipocyte differentiation (Hauner et al. 1987) following an established protocol (Bujalska et al. 1999) (Fig. 1C). On days 1 and 14, total RNA was extracted and differentiation of adipose stromal cells to adipocytes was confirmed by analysing lipoprotein lipase and glycerol-3-phosphate dehydrogenase expression, as described previously (Bujalska et al. 2002b). In addition, sc and om preadipocyte cultures were used for enzymatic activity assays on day 1 and day 14 of differentiation.
Enzyme assays
Paired sc and om preadipocyte proliferation cultures from 19 women were incubated in serum-free DMEM without phenol for 20 h with 40 nM androstenedione containing 100 000 c.p.m. [1,2,6,7-3H] androstenedione (specific activity 25 Ci/mmol; Perkin-Elmer, Cambridge, Cambs, UK).
Paired sc and om preadipocyte differentiation cultures from 5 women were incubated on day 1 and day 14 in serum-free DMEM without phenol for 20 h with 40 nM androstenedione containing 100 000 c.p.m. [1,2,6,7-3H] androstenedione or with 40 nM testosterone containing 100 000 c.p.m. [1,2,6,7-3H] testosterone (specific activity 78.5 Ci/mmol; Perkin-Elmer).
Steroids were extracted in 5 vols dichloromethane, concentrated by evaporation, and separated by thin layer chromatography (TLC) on silica gel/aluminium foil-coated TLC plates (Fluka Chemika, Buchs, Switzerland) with chloroform/ethylacetate (80:20) as the solvent system. Fractional conversion of steroids was quantified using a Bioscan 2000 Imager (LabLogic, Sheffeld, UK). Steroids were identified by referring to co-migration of unlabelled steroid standards (Sigma, UK) visualised by Liebermann-Burchard reagent as previously described (Quinkler et al. 1999). Cell protein content was determined with a modified Bradford method (Bio-Rad Laboratories, Munich, Germany), and enzyme activities were expressed as pmol or fmol product formed per mg protein per h. All incubations were carried out at least in triplicate.
RNA extraction and RT
Total RNA was extracted from whole fat tissue and preadipocyte cultures using a single step extraction method (Tri reagent, Sigma, UK (preadipocytes), or Genelute total mammalian RNA extraction kit, Sigma, UK (whole adipose tissue)). RNA integrity was assessed by gel electrophoresis and concentrations were measured by spectrophotometry at A260 and checked for purity using the ratio A260/280. Reverse transcription of RNA was performed as previously described (Bujalska et al. 1999) employing reagents from Promega (Southampton, UK).
PCR for 17ß-HSD isozymes
Qualitative PCR analysis for expression of 17ß-HSD isozymes was carried out using cDNA generated from paired sc and om fat samples of 5 women, employing the following primers: 17ß-HSD1 (HSD17B1), forward: 5'-TTTCA ATGACGTTTATTGCGCCAGCA-3', reverse: 5'-TTG CTGTGGGCGAGGTATTGGTAGAA-3'; 17ß-HSD2 (HSD17B2), forward: 5'-CTGGTGACAGGTGGTGA TTG-3', reverse: 5'-TTATCTGCACTGGCTTCGTG-3'; 17ß-HSD3 (HSD17B3), forward: 5'-TCCTGAACGCACCGGATGAAAT-3', reverse: 5'-TACCTGACCTTG GTGTTGAGCTTCAG-3'; 17ß-HSD4 (HSD17B4), forward: 5'-AGTTCTCTCTCTTTCTTGTTGGCTC TGGA-3', reverse: 5'-GCGTCCTATTTCCTCAAA TACAAAGGTACTCT-3'; 17ß-HSD5 (AKR1C3), forward: 5'-ACTTCATGCCTGTATTGGGATTTG-3', reverse: 5'-CTGCCTGCGGTTGAAGTTTGACA-3'. 17ß-HSD5 primers differ in two bases (forward primer) and three bases (reverse primer) respectively, from the AKR1C2 sequence (see underlined bases above) and are specific for 17ß-HSD5 (AKR1C3) as previously shown by Bumke-Vogt et al.(2002). In addition to the primer sequences for 17ß-HSD isozymes 1, 2, and 3 given above, we also performed specific PCR reactions with the 17ß-HSD primers used by Corbould et al.(1998). Specific PCR reactions (20 µl) were carried out in 1 x PCR buffer (Promega) containing 50 mM KCl, 10 mM Tris–HCl (pH 9.0), and 0.1% Triton X-100, 2 mM MgCl2, 0.2 µM of each dNTP, 0.6 µM of forward and reverse primer and 1 U Taq DNA polymerase (Promega). Samples were amplified using initial denaturation at 94 °C (5 min) followed by 34 cycles at 94 °C (30 s), 60 °C (30 s), and 72 °C (30 s) with final elongation at 72 °C (7 min). After gel electrophoresis, PCR products of reactions with 17ß-HSD5 primers were excised under UV light, extracted with QIAquick Gel Extraction Kit (Qiagen) and subjected to direct sequencing.
Microarray
Total RNA was extracted from paired sc and om whole fat tissue as well as from preadipocyte proliferation cultures from five women. Biotin-labelled cRNA was reverse transcribed from 10 µg total RNA (pool of 2 µg total RNA from each cell preparation) according to the Affymetrix technical protocol (GeneChip Expression Analysis, Technical Manual, http://www.a3ymetrix.com/support/index.a3x). Integrity of the samples was tested on Affymetrix Test3 array and samples were accepted if their 3'/5'ratio of human housekeeping genes was lower than 3, referring to the house-keeping genes beta-actin (ACTB, Affymetrix probe HSAC07/X00351) and glyceraldehyde-3-phosphate dehydrogenase (GAPD, Affymetrix probe HUMGAPDH/M33197) were accepted. Fragmented cRNA (15 µg) was hybridised to each of the array of the Human Genome U133 set (Affymetrix, High Wycombe, UK). Affymetrix software (Data Mining Tool, Version 3.0) and Microarray Data Suite 5.0 (Affymetrix) were used for analysing microarray data. Accordingly, results are presented as qualitative (=detection) and quantitative (=signal) measures of expression level, which represent arbitrary data. The inter-assay variability between microarrays was below 5%. The probe set for 17ß-HSD5 (209160_at) on the HG U133A chip includes 11 probes, all matching the published sequence. Due to the sequence difference between 17ß-HSD5 and other 17ß-HSD enzymes, none of the probes coding for 17ß-HSD5 match the probe sets of 17ß-HSD isozymes 1, 2, 3 or 4. The enzymes AKR1C1 (probe set 204151_x_at) and AKR1C2 (probe set 209699_x_at) have a high homology to 17ß-HSD5 (AKR1C3); however only 2 and 3 probes, respectively, out of 11 probes matched the 17ß-HSD5 sequence.
Quantitative PCR
17ß-HSD5 mRNA expression was analysed using an ABI Prism 7700 sequence detection system (Perkin–Elmer Applied Biosystems, Warrington, UK) that employs Taq–Man chemistry for highly accurate mRNA quantification as previously described (Bujalska et al. 2002a). Reactions were performed in 25-µl vol on 96-well plates, in buffer containing TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and 25 ng cDNA template. All reactions were multiplexed with the housekeeping gene 18S (Perkin-Elmer). Reactions were as follows: 50 °C for 2 min, 95 °C for 10 min, and then 44 cycles at 95 °C for 15 s and 60 °C for 1 min. Oligonucleotide primers and a Taqman probe for 17ß-HSD5 were as follows: forward, GGGATCTCAACGAGACAAACG; reverse, AAAGGACTGGGTCCTCCAAGA; probe, TGG ACCCGAACTCCCCGGTG. Data were expressed as CT values (=cycle number at which logarithmic PCR plots cross a calculated threshold line) and were used to determine 
CT values (=CT of the target gene minus CT of the housekeeping gene; high CT values represent low levels of expression). Fold changes were calculated using transformation [fold increase=2–difference in CT].
Statistical analysis
Data are expressed as means±S.D or S.E.M., as specified. Statistical analysis on real-time PCR data was performed on mean CT values to exclude potential bias owing to averaging data that had been transformed through the equation 2–CT. Statistical analysis of comparisons between groups was undertaken using paired and unpaired t-tests where appropriate, otherwise the Mann–Whitney Rank Sum Test was used. Linear regression analysis was performed using Pearson’s correlation coeffcient.
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The conversion of androstenedione to testosterone and vice versa requires the presence of reductive and oxidative 17ß-HSD activity. Thus, to identify the enzymes responsible for testosterone synthesis and inactivation in adipose tissue, we performed RT-PCR analysis employing specific primers for the amplification of human 17ß-HSD isozymes. When analysing preadipocyte and whole adipose mRNA obtained from sc and om depots of five individual patients, abundant expression of 17ß-HSD4 and 17ß-HSD5 mRNA was detected (Fig. 2). The data suggest that 17ß-HSD4 expression is higher in om than sc whole adipose tissue. 17ß-HSD5 expression appears to be weakest in om preadipocytes. In whole fat and preadipocytes of both sc and om origin no relevant expression of 17ß-HSD1, 2 or 3 was detected, except for a weak band for 17ß-HSD1 and 2 in omental tissue of one subject (Fig. 2). Using the primers and methods reported by Corbould et al.(1998) we were not able to detect mRNA expression of 17ß-HSD isozymes 1, 2 or 3, either in whole fat or in preadipocytes, despite a strong band in the positive control lane (data not shown).
|
Microarray analysis confirmed the absence of 17ß-HSD1, 2 and 3 and the presence of 17ß-HSD4 and 5 in preadipocytes and whole fat tissue of sc and om origin (Table 1). 17ß-HSD5 microarray expression signals were higher in sc than in om fat (511 vs 73 in preadipocytes, P<0.001; 1525 vs 428 in whole fat, P<0.001), with an apparently higher abundance in whole fat than in preadipocytes of sc origin. By contrast, 17ß-HSD4 expression signals did not differ significantly between sc and om fat, either in preadipocytes (263 vs 222) or in whole fat tissue (330 vs 303). The expression levels of AKR1C1 and AKR1C2 were very high (2800 and 2200 respectively) and exceeded those of 17ß-HSD5 (AKR1C3) in whole fat tissue with no significant difference between sc or om tissue.
|
Enzyme activity studies in primary preadipocyte proliferation cultures from 19 patients revealed significant androgen generation, as assessed by the conversion of androstenedione to testosterone, with no apparent difference between sc and om preadipocyte cultures (0.83 ± 0.24 vs 0.86 ± 0.23 pmol/mg/h).
Quantitative PCR for site-specific expression of 17ß-HSD5
For validation of the results on 17ß-HSD5 expression in fat achieved by microarray analysis, we performed quantitative real-time PCR on cDNA generated from paired sc and om fat biopsies of 19 women. In keeping with the micorarray data, 17ß-HSD5 mRNA expression levels were significantly higher in sc than in om fat, both in preadipocytes (P<0.01) and in whole fat (P=0.05) (Fig. 3). However, in both sc and om depots, 17ß-HSD5 mRNA expression was significantly higher in whole fat tissue than in preadipocytes (P<0.001) (Fig. 3). This suggests a much higher abundance of 17ß-HSD5 expression in mature adipocytes than in preadipocytes.
|
). 17ß-HSD5 mRNA expression in whole adipose tissue was significantly correlated with BMI in the sc compartment (r=0.51, P=0.027) but not in the om depot (r=0.11) (Fig. 4A). By contrast, expression of 17ß-HSD5 in preadipocytes, which was considerably lower than in whole fat tissue, did not correlate with BMI, either in cells of om (r=0.078) or sc (r=0.014) origin (Fig 4B). There was no significant correlation between 17ß-HSD5 mRNA expression and age in whole fat or preadipocytes.
|
We performed quantitative real-time PCR on cDNA generated from subcutaneous buttock biopsies of six women who underwent a weight loss study. The mRNA expression of 17ß-HSD5 was significantly reduced (P<0.05) in the biopsies taken after the weight loss compared with those taken before the weight loss (Fig. 5).
|
To further explore the expression of 17ß-HSD5 across differentiation, primary preadipocyte cultures from sc and om fat of eight individuals were differentiated to mature adipocytes in adipogenic medium. 17ß-HSD5 mRNA levels were assessed by real-time RT-PCR and again were found to be significantly higher (P<0.05) in sc than in om preadipocytes on day 1. Upon differentiation to adipocytes (day 1 compared with day 14), 17ß-HSD5 mRNA levels in both om and sc cultures increased significantly (P<0.005) (Fig. 6A).
|
We studied the conversion of androstenedione to testosterone and vice versa across differentiation using primary preadipocyte differentiation cultures from sc and om fat of five women. On day 1 we could not detect any conversion of androstenedione to testosterone in sc and om preadipocytes (Fig. 6B). Omental, but not subcutaneous, preadipocytes readily converted testosterone to androstenedione on day 1. After differentiation to mature adipocytes on day 14, om and sc cultures exhibited similar conversion rates of androstenedione to testosterone, whereas the reverse conversion of testosterone to androstenedione was much stronger in the om than in cultures of sc origin (Fig 6B). When calculating the net conversion in preadipocyte differentiation cultures, om preadipocytes predominantly inactivated testosterone to androstenedione both before (day 1) and after 14 days of differentiation (Fig. 6C). By contrast, in differentiated cells (day 14) of sc origin net conversion revealed a significant gain in androgen activation, i.e. conversion of androstenedione to testosterone (Fig. 6C).
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Previous studies by Corbould et al.(1998, 2002) suggested that 17ß-HSD3, which primarily shows gonadal expression, is also expressed in female adipose tissue. They concluded that 17ß-HSD3 may be responsible for the conversion of androstenedione to testosterone, because no functional 17ß-HSD1 enzyme was found in adipose tissue (Corbould et al. 1998). However, we were not able to detect any 17ß-HSD3 mRNA expression in our fat tissue samples, even using the primers described by Corbould et al. and highly sensitive microarray techniques. There are some differences between the study presented by Corbould et al.(1998) and our study, in particular with regard to tissue handling and preadipocyte cultures. We have grown the preadipocytes in proliferation culture until confluence, i.e. for 5–7 days, before isolating RNA, whereas Corbould et al. used preadipocytes immediately after isolation and without further culturing. However, Corbould et al. did not investigate 17ß-HSD5 expression in their fat samples, which is a likely candidate enzyme for the catalysis of the conversion of androstenedione to testosterone (Dufort et al. 1999, El-Alfy et al. 1999, Qiu et al. 2004). Very recently, 17ß-HSD5 has been shown to be expressed in human adipose tissue (Blouin et al. 2003). We did not observe expression of 17ß-HSD3, but did define abundant expression of 17ß-HSD5. Thus we consider it highly likely that 17ß-HSD5 represents the main reductive 17ß-HSD isozyme responsible for conversion of androstenedione to testosterone in human fat. The only other 17ß-HSD enzyme we found to be expressed in adipose tissue was 17ß-HSD4, which only catalyses the oxidative reaction and therefore cannot convert androstenedione to testosterone (Adamski & Jakob 2001, Luu-The 2001, Mindnich et al. 2004).
According to our microarray data and quantitative real-time PCR results comparing whole fat with preadipocytes, we found 17ß-HSD5 to be predominantly expressed in mature adipocytes, suggesting a role for this enzyme in adipocyte differentiation (Singh et al. 2003). This is further supported by the outcome of our preadipocyte differentiation assays, which showed a significant increase in 17ß-HSD5 expression upon differentiation from stromal preadipocytes to mature adipocytes. However, it is not clear if the increased expression of 17ß-HSD5 represents cause or consequence of ongoing differentiation. The increase in intracrine generation of androgens via the conversion of androstenedione to testosterone may influence differentiation (Singh et al. 2003). 17ß-HSD5 also catalyses the conversion of DHEA to androstenediol, which has been shown to occur in female adipose tissue following incubation with radio-labelled DHEA (Schindler & Aymar 1975). Androstenediol has very similar structural characteristics to 5-androstanediol, which recently has been shown to exhibit differentiating effects in the prostate via selective activation of the oestrogen receptor ß(ERß) (Weihua et al. 2002).
The results of the enzymatic activity assay in our preadipocyte differentiation cultures revealed predominant androgen inactivation, i.e. conversion of testosterone to androstenedione, which is likely to be be catalysed by 17ß-HSD4, as we did not detect expression of the other oxidative 17ß-HSD isozyme, 17ß-HSD2. Blouin et al.(2003) previously suggested that omental adipose tissue represents an androgen inactivating rather than an androgen activating tissue. This is further supported by their finding of increased inactivation of 5-dihydrotestosterone by 3-HSD activity, possibly catalysed by AKR1C2 (Blouin et al. 2003).
In contrast to the predominant androgen inactivation in om cultures, calculation of net conversion in our preadipocyte differentiation cultures of sc origin revealed significant androgen activation, i.e. conversion of androstenedione to testosterone, suggesting that sc fat depots participate in systemic androgen production.
Our findings strongly suggest a site-specific role for 17ß-HSD5. First, 17ß-HSD5 expression was significantly higher in sc than in om adipose tissue. Secondly, we found a significant positive correlation of BMI with 17ß-HSD5 expression in sc, but not in om fat in our female cohort. Conversely, we could show that 10% weight loss resulted in a significant decrease in 17ß-HSD5 expression in sc fat. This lends some support to the view that 17ß-HSD5 expression plays a site-specific role in female obesity. However, the weight loss data should be interpreted with some caution; in this study we have used gluteal sc adipose tissue, which may differ from abdominal sc adipose tissue with respect to both enzymatic expression patterns and differentiation behaviour.
Interestingly, our findings with regard to 17ß-HSD5 expression exactly mirror previous observations on the expression of the androgen receptor (AR) in human adipose tissue, describing an increased expression in om compared with sc fat and a decrease in AR expression with differentiation of preadipocytes to mature adipocytes (Dieudonne et al. 1998). Higher conversion to more active androgen in subcutaneous adipose tissue may reflect a compensatory mechanism to counteract the lower AR expression. Our findings therefore highlight the importance of understanding site-specific regulation of adipogenesis by sex steroids.
In conclusion, we have shown that human female preadipocytes are capable of active androgen generation with the conversion of androstenedione to testosterone most likely catalysed by 17ß-HSD5. We observed a site-and cell type-specific expression pattern for 17ß-HSD5 with predominant expression in sc mature adipocytes, therefore suggesting a possible role for this enzyme in the regulation of adipocyte differentiation. We have shown that 17ß-HSD5 expression increases across differentiation from stromal preadipocytes to mature adipocytes and that the interconversion of androstenedione and testosterone is shifted towards testosterone generation with ongoing differentiation of sc preadipocytes. In addition, we observed a positive correlation between BMI and sc 17ß-HSD5 expression and a decrease in 17ß-HSD5 expression with weight loss. This supports the hypothesis that human adipose tissue may represent an intracrine source of androgen synthesis, possibly also contributing to the previously described positive correlation between circulating androgens and BMI. Further studies are warranted to explore adipose tissue-specific metabolism of sex steroids in both males and females and to elucidate the clinical significance of these findings, bearing in mind the importance of regional fat distribution for cardiovascular complications of obesity.
|
Acknowledgements |
|---|
|
Funding |
|---|
This work was supported by the Deutsche Forschungs-gemeinschaft (Research Fellowship to M Q, and Senior Clinical Fellowship to W A), the Medical Research Council (Research Training Fellowship to J W T, and Senior Clinical Fellowship to P M S) and by a University of Birmingham Rowbotham Bequest Research Grant (to W A).
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Blouin K, Richard C, Belanger C, Dupont P, Daris M, Laberge P, Luu-The V & Tchernof A 2003 Local androgen inactivation in abdominal visceral adipose tissue. Journal of Clinical Endocrinology and Metabolism 88 5944–5950.
Bujalska IJ, Kumar S & Stewart PM 1997 Does central obesity reflect ‘Cushing’s disease of the omentum’? Lancet 349 1210–1213.[CrossRef][Web of Science][Medline]
Bujalska IJ, Kumar S, Hewison M & Stewart PM 1999 Differentiation of adipose stromal cells: the roles of glucocorticoids and 11ß-hydroxysteroid dehydrogenase. Endocrinology 140 3188–3196.
Bujalska IJ, Walker EA, Hewison M & Stewart PM 2002a A switch in dehydrogenase to reductase activity of 11ß-hydroxysteroid dehydrogenase type 1 upon differentiation of human omental adipose stromal cells. Journal of Clinical Endocrinology and Metabolism 87 1205–1210.
Bujalska IJ, Walker EA, Tomlinson JW, Hewison M & Stewart PM 2002b 11ß-Hydroxysteroid dehydrogenase type 1 in differentiating omental human preadipocytes: from de-activation to generation of cortisol. Endocrine 28 449–461.[CrossRef][Web of Science][Medline]
Bumke-Vogt C, Bahr V, Diederich S, Herrmann SM, Anagnostopoulos I, Oelkers W & Quinkler M 2002 Expression of the progesterone receptor and progesterone-metabolising enzymes in the female and male human kidney. Journal of Endocrinology 175 349–364.[Abstract]
Corbould AM, Judd SJ & Rodgers RJ 1998 Expression of types 1, 2, and 3 17ß-hydroxysteroid dehydrogenase in subcutaneous abdominal and intra-abdominal adipose tissue of women. Journal of Clinical Endocrinology and Metabolism 83 187–194.
Corbould AM, Bawden MJ, Lavranos TC, Rodgers RJ & Judd SJ 2002 The effect of obesity on the ratio of type 3 17ß-hydroxysteroid dehydrogenase mRNA to cytochrome P450 aromatase mRNA in subcutaneous abdominal and intra-abdominal adipose tissue of women. International Journal of Obesity and Related Metabolic Disorders 26 165–175.
Dieudonne MN, Pecquery R, Boumediene A, Leneveu MC & Giudicelli Y 1998 Androgen receptors in human preadipocytes and adipocytes: regional specificities and regulation by sex steroids. American Journal of Physiology 274 C1645–C1652.
Dufort I, Rheault P, Huang X-F, Soucy P & Luu-The V 1999 Characteristics of a highly labile human type 5 17ß-hydroxysteroid dehydrogenase. Endocrinology 140 568–574.
Dunaif A & Thomas A 2001 Current concepts in the polycystic ovary syndrome. Annual Review of Medicine 52 401–419.[CrossRef][Web of Science][Medline]
El-Alfy M, Luu-The V, Huang X-F, Berger L, Labrie F & Pelletier G 1999 Localization of type 5 17ß-hydroxysteroid dehydrogenase, 3ß-hydroxysteroid dehydrogenase, and androgen receptor in the human prostate by in situ hybridization and immunocytochemistry. Endocrinology 140 1481–1491.
Elting MW, Korsen TJ, Bezemer PD & Schoemaker J 2001 Prevalence of diabetes mellitus, hypertension and cardiac complaints in a follow-up study of a Dutch PCOS population. Human 16 556–560.
Fassnacht M, Schlenz N, Schneider SB, Wudy SA, Allolio B & Arlt W 2003 Beyond adrenal and ovarian androgen generation: increased peripheral 5-reductase activity in women with polycystic ovary syndrome. Journal of Clinical Endocrinology and Metabolism 88 2760–2766.
Franks S 1995 Polycystic ovary syndrome. New England Journal of Medicine 333 853–861.
Haffner SM, Valdez RA, Stern MP & Katz MS 1993 Obesity, body fat distribution and sex hormones in men. International Journal of Obesity and Related Metabolic Disorders 17 643–649.
Hauner H, Schmid P & Pfeiffer EF 1987 Glucocorticoids and insulin promote the differentiation of human adipocyte precursor cells into fat cells. Journal of Clinical Endocrinology and Metabolism 64 832–835.
Holte J, Bergh T, Gennarelli G & Wide L 1994 The independent effects of polycystic ovary syndrome and obesity on serum concentrations of gonadotrophins and sex steroids in premenopausal women. Clinical Endocrinology 41 473–481.[Medline]
Luu-The V 2001 Analysis and characteristics of multiple types of human 17ß-hydroxysteroid dehydrogenase. Journal of Steroid Biochemistry and Molecular Biology 76 143–151.[CrossRef][Web of Science][Medline]
Luu-The V, Dufort I, Pelletier G & Labrie F 2001 Type 5 17ß-hydroxysteroid dehydrogenase: its role in the formation of androgens in women. Molecular and Cellular Endocrinology 171 77–82.[CrossRef][Web of Science][Medline]
Mindnich R, Moller G & Adamski J 2004 The role of 17ß-hydroxysteroid dehydrogenases. Molecular and Cellular Endocrinology 218 7–20.[CrossRef][Web of Science][Medline]
Penning TM, Burczynski ME, Jez JM, Hung CF, Lin HK, Ma H, Moore M, Palackal N & Ratnam K 2000 Human 3-hydroxysteroid dehydrogenase isoforms (AKR1C1-AKR1C4) of the aldo-keto reductase superfamily: functional plasticity and tissue distribution reveals roles in the inactivation and formation of male and female sex hormones. Biochemical Journal 351 67–77.[CrossRef][Web of Science][Medline]
Qiu W, Zhou M, Labrie F & Lin SX 2004 Crystal structures of the multispecific 17ß-hydroxysteroid dehydrogenase type 5: critical androgen regulation in human peripheral tissues. Molecular Endocrinology 18 1798–1807.
Quinkler M, Johanssen S, Grossmann C, Bahr V, Muller M, Oelkers W & Diederich S 1999 Progesterone metabolism in the human kidney and inhibition of 11ß-hydroxysteroid dehydrogenase type 2 by progesterone and its metabolites. Journal of Clinical Endocrinology and Metabolism 84 4165–4171.
Schindler AE & Aymar M 1975 Metabolism of 14C-dehydro-epiandrosterone in female adipose tissue and venous blood. Endocrinological Experimentia 9 215–222.
Singh R, Artaza JN, Taylor WE, Gonzalez-Cadavid NF & Bhasin S 2003 Androgens stimulate myogenic differentiation and inhibit adipogenesis in C3H 10T1/2 pluripotent cells through an androgen receptor-mediated pathway. Endocrinology 144 5081–5088.
Stewart PM, Shackleton CH, Beastall GH & Edwards CR 1990 5-Reductase activity in polycystic ovary syndrome. Lancet 335 431–433.[CrossRef][Web of Science][Medline]
Taponen S, Martikainen H, Jarvelin MR, Laitinen J, Pouta A, Hartikainen AL, Sovio U, McCarthy MI, Franks S & Ruokonen A 2003 Hormonal profile of women with self-reported symptoms of oligomenorrhea and/or hirsutism: Northern Finland Birth Cohort 1966 Study. Journal of Clinical Endocrinology and Metabolism 88 141–147.
Tomlinson JW, Moore JS, Clark PM, Holder G, Shakespeare L & Stewart PM 2004 Weight loss increases 11ß-hydroxysteroid dehydrogenase type 1 expression in human adipose tissue. Journal of Clinical Endocrinology and Metabolism 89 2711–2716.
Weihua Z, Lathe R, Warner M & Gustafsson JA 2002 An endocrine pathway in the prostate, ERß, AR, 5-androstane-3ß,17ß-diol, and CYP7B1, regulates prostate growth. PNAS 99 13589–13594.
Williams DP, Boyden TW, Pamenter RW, Lohman TG & Going SB 1993 Relationship of body fat percentage and fat distribution with dehydroepiandrosterone sulfate in premenopausal females. Journal of Clinical Endocrinology and Metabolism 77 80–85.[Abstract]
Received 9 July 2004
Accepted 22 July 2004
This article has been cited by other articles:
|
|
 |
|
  X. Du, R. L. Rosenfield, and K. Qin KLF15 Is a Transcriptional Regulator of the Human 17{beta}-Hydroxysteroid Dehydrogenase Type 5 Gene. A Potential Link between Regulation of Testosterone Production and Fat Stores in Women J. Clin. Endocrinol. Metab., July 1, 2009; 94(7): 2594 - 2601. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Nakamura, P. J. Hornsby, P. Casson, R. Morimoto, F. Satoh, Y. Xing, M. R. Kennedy, H. Sasano, and W. E. Rainey Type 5 17{beta}-Hydroxysteroid Dehydrogenase (AKR1C3) Contributes to Testosterone Production in the Adrenal Reticularis J. Clin. Endocrinol. Metab., June 1, 2009; 94(6): 2192 - 2198. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Blouin, M. Nadeau, J. Mailloux, M. Daris, S. Lebel, V. Luu-The, and A. Tchernof Pathways of adipose tissue androgen metabolism in women: depot differences and modulation by adipogenesis Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E244 - E255. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wiegand, A. Richardt, T. Remer, S. A Wudy, J. W Tomlinson, B. Hughes, A. Gruters, P. M Stewart, C. J Strasburger, and M. Quinkler Reduced 11{beta}-hydroxysteroid dehydrogenase type 1 activity in obese boys Eur. J. Endocrinol., September 1, 2007; 157(3): 319 - 324. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mohlig, M. O Weickert, E. Ghadamgadai, A. Machlitt, B. Pfuller, A. M Arafat, A. F H Pfeiffer, and C. Schofl Adipocyte fatty acid-binding protein is associated with markers of obesity, but is an unlikely link between obesity, insulin resistance, and hyperandrogenism in polycystic ovary syndrome women Eur. J. Endocrinol., August 1, 2007; 157(2): 195 - 200. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Qiu, M. Zhou, M. Mazumdar, A. Azzi, D. Ghanmi, V. Luu-The, F. Labrie, and S.-X. Lin Structure-based Inhibitor Design for an Enzyme That Binds Different Steroids: A POTENT INHIBITOR FOR HUMAN TYPE 5 17beta-HYDROXYSTEROID DEHYDROGENASE J. Biol. Chem., March 16, 2007; 282(11): 8368 - 8379. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Blouin, C. Richard, G. Brochu, F.-S. Hould, S. Lebel, S. Marceau, S. Biron, V. Luu-The, and A. Tchernof Androgen inactivation and steroid-converting enzyme expression in abdominal adipose tissue in men J. Endocrinol., December 1, 2006; 191(3): 637 - 649. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L. Rosenfield Hirsutism N. Engl. J. Med., December 15, 2005; 353(24): 2578 - 2588. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Quinkler, I. J. Bujalska, K. Kaur, C. U. Onyimba, S. Buhner, B. Allolio, S. V. Hughes, M. Hewison, and P. M. Stewart Androgen Receptor-Mediated Regulation of the {alpha}-Subunit of the Epithelial Sodium Channel in Human Kidney Hypertension, October 1, 2005; 46(4): 787 - 798. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) and subcutanous (sc,
) whole fat. (B) Expression in om (
